The authors would like to acknowledge the support of Universiti Putra Malaysia.

NOTE: All the chemical and biochemical reagents to be used should be of analytical grade and used without further purification. Prepare all solutions using sterile deionized water. Autoclave all glassware prior to sterilization.
Caution: Please use all appropriate safety practices when performing laboratory activities including the use of engineering controls (fume hood, glovebox) and personal protective equipment (safety glasses, gloves, lab coat, full length pants, closed-toe shoes).
1. Fabrication and Characterization of Modified Electrode using PLA-AuNPs
<ol>
	<li>Preparation and characterization of PLA-AuNPs
	<ol>
		<li>Quickly add 10 mL of sodium citrate solution (38.8 mM) to 100 mL of boiling aqueous chloroauric acid solution (1 mM) and cool it down to ambient temperature. Observe the changes in color in the prepared AuNPs solution which starts as yellow, changes to blackish and finally ends as dark ruby red.</li>
		<li>Place the PLA pellets in a stainless-steel mold for the melting process and preheat them at a temperature of 190 &#176;C for 10 min. Follow with the pressing procedure: put them under a pressure of 2.2 MPa for 1 min as part of the PLA sheet preparation. The PLA sheet will be ready for use after cooling for about 3 h.</li>
		<li>Stirring vigorously, dissolve 0.68 mg of the PLA sheets in 5 mL of chloroform at room temperature. Mix the dissolved PLA with 10 mL of the previously prepared AuNPs solution and homogeneously stir it at room temperature. The homogeneous mixtures can then be denoted as PLA-AuNPs and characterized using UV-Vis, XRD, TEM, and FESEM with EDX.</li>
	</ol>
	</li>
	<li>Preparation and characterization of modified screen-printed carbon electrode 
	NOTE: The SPCE used in this study comprises a three-electrode system: a counter electrode, a carbon working electrode, and an Ag/AgCl reference electrode.
	<ol>
		<li>Quickly pipette 25 &#181;L of the homogenous solution of PLA-AuNPs onto the SPCE and then air dry it for 24 h prior to use.</li>
		<li>Electrochemically characterize the modified electrodes, SPCE/PLA-AuNPs, in potassium ferro cyanide (K3[Fe(CN)6]3-/4-) to measure active surface area, electrochemical impedance spectroscopy, repeatability, reproducibility, and stability30.</li>
	</ol>
	</li>
</ol>
2. Development of the Electrochemical DNA Biosensor
<ol>
	<li>Probe preparation 
	Note: The sequences of the ssDNA probe and complementary DNA were chosen based on information from the National Center for Biotechnology Information (NCBI) database.
	<ol>
		<li>Purchase synthetic oligonucleotides (20-mer ssDNA probe, 20-mer complementary DNA, 20-mer mismatched DNA, and 21-mer non-complementary DNA) as lyophilized powder from commercial laboratories, based on the following sequences: 
		thiolated ssDNA probe: 5&#8242;- / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3&#8242; 
		complementary DNA: 5&#8242; - CAGTGCTTCTGCATAATCCG - 3&#8242; 
		one-base mismatched DNA: 5&#8242; - CAGTGCTTCTGC &#7786;TAATCCG - 3&#8242; 
		three-base mismatched DNA: 5&#8242; - CAGTGCTTCT &#266; &#7786;&#7786;TAATCCG - 3&#8242; 
		non-complementary DNA: 5&#8242; - CGCACAAGGCTCGACGGCTGA - 3&#8242;</li>
		<li>Prepare stock solutions of all oligonucleotides (100 &#181;M) using a sterile TE solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5), divided into analytical portions. Keep this at -4 &#176;C and then make the appropriate dilutions just prior to use.</li>
	</ol>
	</li>
	<li>Optimization of Immobilization and Hybridization 
	Note: An SPCE modified with PLA-AuNPs, denoted as SPCE/PLA-AuNPs, was used for this study and a drop casting method was used for the DNA immobilization and hybridization.
	<ol>
		<li>First, immobilize 25 &#181;L of thiolated ssDNA probe on the SPCE/PLA-AuNPs and then air dry it for 24 h at room temperature, after which it will be finally denoted as SPCE/PLA-AuNPs/ssDNA. Determine optimization of the immobilization condition by using three factors: the concentration of ssDNA (ranging from 0.2 to 1.4 &#181;M), time (ranging from 30 to 210 min), and temperature (ranging from 25 to 75 &#176;C).</li>
		<li>Pipette 25 &#181;L of the complementary DNA on to the surface of SPCE/PLA-AuNPs/ssDNA to carry out the hybridization event after which it can be finally denoted as SPCE/PLA-AuNPs/dsDNA. Determine optimization of the hybridization condition via the two factors of time (ranging from 5 to 30 min) and temperature (ranging from 25 to 75 &#176;C).</li>
		<li>Immerse the immobilized and hybridized electrodes in 20 &#181;M MB for 30 min. Remove the non-specifically adsorbed DNA and excess MB by washing with 0.5 M ABS/20 mM NaCl (pH 4.5) and then rinsing with deionized water. Measure the peak current of MB reduction using DPV technique. Execute the DPV measurement using 0.1 M PBS (pH 7) containing no indicator.</li>
	</ol>
	</li>
	<li>Characterization of the fabricated DNA biosensor
	<ol>
		<li>Immerse the SPCE/PLA-AuNPs in 20 &#181;M MB for 30 min, wash with 0.5 M ABS/20 mM NaCl (pH 4.5), and then rinse with deionized water prior to measuring. Follow a similar procedure for all interactions including the probe DNA, complementary DNA, mismatched DNA, and non-complementary DNA samples.</li>
		<li>Measure the electrochemical reduction. 
		NOTE: We measured DPV using a commercially manufactured Autolab with interface software. 
		The DPV measurements of the MB electrochemical reduction performed at a potential ranging from -0.5 V to 0.25 V, with a step potential of 0.005 V, modulation amplitude of 0.05 V, and a scan rate of 7.73 mVs-1 in 0.1 M PBS (pH 7), containing no indicator. The selectivity, sensitivity, reproducibility, and heat stability of the fabricated DNA biosensor were further studied. Reported results were presented as mean value measurements in three replicates.</li>
	</ol>
	</li>
</ol>
3. Validation of the Fabricated DNA Biosensor Using Real Samples
<ol>
	<li>Preparation of bacterial strains
	<ol>
		<li>Select bacterial samples based on their significant contamination of seafood31,32 . 
		NOTE: V. parahaemolyticus as reference strains and 8 other bacterial strains (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, Salmonella enteritis, Klebsiella pneumonia, Escherichia coli O157:H7, Bacillus cereus, and Vibrio alginolyticus) of the common foodborne pathogen were employed for the electrochemical DNA biosensor validation in this study.</li>
		<li>Conduct a routine sub-culture of bacterial strains on their respective agar every two weeks to maintain their viability, refer Table 1 for culture conditions.</li>
		<li>Maintain long-term preservation of the bacterial strains in their respective growing broths containing 20% (v/v) glycerol at -80 &#176;C as glycerol protects bacteria by preventing the formation of ice crystals that can damage them during the freezing process. Next, inoculate a loop of preserved bacterial cell culture in glycerol stocks into the respective broths. Incubate the broths according to their respective growth time and temperature when needing to revive the bacteria.</li>
		<li>Determine the quantity of V. parahaemolyticus cells using a spread plate technique33, a standard and a well-known method for enumerating microorganisms derived from a series of dilutions.
		<ol>
			<li>Culture V. parahaemolyticus in Trypticase Soy Broth (TSB + 3% NaCl) at 37 &#176;C in a 140-rpm shaking condition. Then, transfer 1 mL of the bacteria cell culture into 9 mL of TSB + 3% NaCl to obtain a 10-1 dilution factor.</li>
		</ol>
		</li>
		<li>Repeat this step nine times to get a full series of up to 10-10 dilution factor. Next, spread 0.1 mL of each dilution factor (starting from 10-1 to 10-10) on a Vibrio&#39;s selective agar plate for colony counting, respectively. Incubate the plates incubated at 37 &#176;C for 24 h.</li>
		<li>Use a colony counter to count individual colonies and then back-calculate (count the CFU/pipetted amount x dilution factor) to get a colony-forming unit per milliliter density (CFU mL-1). Derive the concentration of the colony forming units (CFUs) in the bacteria cell suspensions from the calibration plot of CFU mL-1 against absorbance.</li>
	</ol>
	</li>
	<li>Preparation of the PCR assay
	<ol>
		<li>Extract genomic DNA following a modified boiled lysis procedure34. First, streak an individual bacterial strain on agar media and inoculate it in broth media, followed by incubating it at its relative growth condition, a 140 rpm shaking condition.</li>
		<li>Pipette a 1 mL culture of broth into a micro centrifuge tube. Centrifuge this at 4830 x g and 4 &#176;C for 1 min to obtain pellets. Use about 500 &#181;L of sterile TE buffer for re-suspension with the pellet. Hold the resulting suspension for 10 min at 98 &#177; 2 &#176;C in a heating block and immediately chill it at -18 &#176;C for 10 min to lyse the cells and release the DNA.</li>
		<li>Centrifuge the genomic DNA at 4830 x g and 4 &#176;C for 3 min to obtain a clear suspension and keep the supernatant at -20 &#176;C for further use. Use a biophotometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light) to determine the concentration and purity of the extracted genomic DNA and then identify all strains using standard biochemical assays35 and verifying them by 16S rRNA gene sequencing36. Finally, denature the genomic DNA at 92 &#176;C for 2 min and cool it rapidly in ice water prior to application to the biosensor.</li>
		<li>Further confirm the presence V. parahaemolyticus using PCR to target the toxR gene. Perform this procedure in a thermocycler using a primer pair (5&#39;-GTCTTCTGACGCAATCGTTG-3&#39; and 5&#39;-ATACGAGTGGTTGCTGTCATG-3&#39;). Optimize the PCR amplification in a total reaction volume of 25 &#181;L consisting of sterile water (15.5 &#181;L), buffer (5 &#181;L), primer (1 &#181;L, 10 &#181;M), dNTP mix (1 &#181;L), DNA template (2 &#181;L), and Taq DNA polymerase (0.2 &#181;L, 10x).</li>
		<li>Mix the components well and arrange the PCR amplification of the target sequence in a thermocycler programmed for 30 cycles of amplification. In our study, each cycle consisted of three-step reactions i.e., initial denaturation (94 &#176;C, 3 min) followed by 30 cycles of denaturation (94 &#176;C, 1 min), annealing (63 &#176;C, 1.5 min) and extension (72 &#176;C, 1.5 min), followed by final extension (72 &#176;C, 7 min).</li>
		<li>Determine the amplified products and their sizes via electrophoresis on 1.5% agarose gel. Capture the gel images with a commercially produced gel-documentation system.</li>
	</ol>
	</li>
	<li>Preparation of cockle samples
	<ol>
		<li>Obtain fresh samples. 
		NOTE: Our fresh cockles (Anadara granosa) were obtained from the wet market in Serdang, Selangor, and quickly brought to the laboratory in an ice cooler box for analysis. Divide the samples into 2 groups, namely the treated and untreated group, assuming that the cockles were harvested uniformly from the start of the harvest until placing them into cold storage.</li>
		<li>Pre-treat cockles in the treated group by storing them at -20 &#176;C for 24 h, followed by exposure to UV light at 20 &#176;C for 4 h prior to DNA extraction. 
		NOTE: The freezing temperature and UV exposure used for the controlled group kills or at least limits the naturally accumulating V. parahaemolyticus in the cockles. Do not apply a higher pasteurization regime of 70 &#176;C as the aim of the controlled condition in this study is to mimic the actual situation of the fresh cockles. Meanwhile, analyze samples directly from the untreated group without any pre-treatment as soon as they arrive in the laboratory.</li>
		<li>Subculture a strain of V. parahaemolyticus ATCC 17802 in TSB (3% NaCl). Determine the level of viable cells in the inoculum via plating of appropriate dilutions of TSB (3% NaCl) on CA in order to obtain an inoculum of 104 CFU mL-1 of V. parahaemolyticus. Wash each cockle in distilled water and scrub it free of dirt before using sterile forceps in a laminar flow cabinet to remove the tissues from the shell.</li>
		<li>Homogenize about 10 g of cockle tissue samples with a homogenizer in 90 mL of sterile TSB (3% NaCl) for 60 s. Add a known amount of V. parahaemolyticus to 9 mL of the homogenized sample broth for the spiked samples. Use the unspiked samples as a negative control. Estimate the cell counts of V. parahaemolyticus spiked on to the cockle samples by plating 0.1 mL of the samples on CA, and subsequently, pipetting 1 mL of samples into a microcentrifuge tube for DNA sample extraction, to be used in the biosensor and PCR assay.</li>
		<li>Extract the genomic DNA of the V. parahaemolyticus from the spiked and unspiked samples following a modified boiled lysis procedure36. Finally, determine the DNA concentration and purity using a bio photometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light).</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

The critical steps in a framework for successful development of this type of electrochemical biosensor are selection of appropriate biological recognition elements for the transducer (nucleic acid or DNA here); chemical approach for constructing the sensing layer of the transducer; transduction material; optimization of DNA immobilization and hybridization; and validation of the developed biosensor using real samples.
Core to the successful development of a sensitive and selective electrochemi...

A major topic of public and scientific debate in recent years, food poisoning is mainly associated with 3 agents: microorganisms1, chemicals2, and parasites3. Contaminated food can cause serious health consequences in humans, especially in the higher risk group of those with weak immune systems, the elderly, pregnant women, babies, and young children4. With more than a million cases of acute diarrhea occurring annually in children under 5 years old in Africa, Asia, and Latin America, food poisoning is a major global disease5,6 and the World Health Organization has established microorganisms as the most important contributor7. Vibrio parahaemolyticus stands out amongst the most widely recognized virulent strains. Usually found in coastal, estuarine, and marine environments8, it is a Gram-negative bacterium, which becomes active in high salt environments, and causes serious human gastroenteritis when eaten in inadequately cooked, mishandled or raw marine products9. Additionally, existing medical conditions in some people make them prone to wound infection, septicemia or ear infection arising from V. parahaemolyticus10. The virulence factors of V. parahaemolyticus hemolysins are divided into two types which contribute to the disease pathogenesis: thermostable direct hemolysin (TDH) coded by tdh genes, and TDH-related hemolysin coded by trh genes11. The virulence markers (tdh and trh genes) of V. parahaemolyticus are mostly found in clinical specimens rather than in environmental specimens.
V. parahaemolyticus possesses the ability to survive under a broad range of conditions, rapidly responding to environmental changes12. Its proliferation mechanism escalates its hazard potential as its toxicity increases in parallel with cell mass13. Even worse, climate change is providing these bacteria with ample conditions to accelerate their cell population growth14. Due to its high frequency, V. parahaemolyticus needs to be monitored along the food supply chain, particularly in the trade and production of seafood since those products are where they are found in enormous quantities15,16 throughout the world. Currently the bacteria are identified and isolated using a range of methods including biochemical tests, enrichment and selective media17, enzyme-linked immunomagnetic sorbent assay (ELISA)18, pulse-field gel electrophoresis (PFGE)19, latex agglutination tests, and polymerase chain reaction (PCR) tests20. These methods usually require qualified personnel, sophisticated instruments, and laborious techniques which do not provide information about contamination immediately. This severely limits the likelihood of promptly detecting harmful contamination and on-site applications. Rapid detection tools remain an outstanding challenge.
Biosensing is emerging as a promising option for the detection of foodborne pathogens because it offers a time-saving, cost-effective, practical, and real-time analysis method21,22,23,24. However, although there have been many positive results of analyte detection in spiked samples and standard solution using biosensors, there is still a lack of research applied to real samples either in aqueous mixtures or organic extracts25. Recently, electrochemical biosensors using direct and/or indirect deoxyribonucleic acid (DNA) detection have received increased attention among scientists, due to their specific detection of the complementary target via a hybridization event26,27,28,29. These unique approaches are more stable in comparison with enzyme-based biosensors, thus offering a promising technology for miniaturization and commercialization. The target of the study reported here is to construct a fast tool that can detect V. parahaemolyticus with high selectivity, sensitivity, and practicality, based on the DNA sequence specificity during hybridization. Identification strategies involve the combination of polylactic acid-stabilized gold nanoparticles (PLA-AuNPs)30 and screen-printed carbon electrodes (SPCEs) in the presence of the hybridization indicator, methylene blue (MB). The potential of the developed detection construct is further explored using bacteria DNA lysate and fresh cockle samples.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Acetic acid</td>
			<td>Merck</td>
			<td>100056</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Merck</td>
			<td>102445</td>
			<td></td>
		</tr>
		<tr>
			<td>Diaminoethane tetraacetic acid</td>
			<td>Promega</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>Dibasic sodium phosphate&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>S9763</td>
			<td></td>
		</tr>
		<tr>
			<td>Disodium hydrogen phosphate</td>
			<td>Sigma-Aldrich</td>
			<td>255793</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>16368</td>
			<td></td>
		</tr>
		<tr>
			<td>Gold (III) chloride trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>520918</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid</td>
			<td>Merck</td>
			<td>100317</td>
			<td></td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M44907</td>
			<td></td>
		</tr>
		<tr>
			<td>Monobasic sodium phosphate, monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S3522</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-buffered saline</td>
			<td>Sigma-Aldrich</td>
			<td>P5119</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly(lactic acid) resin, commercial grade 4042D</td>
			<td>NatureWorks</td>
			<td>4042D</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>R&#38;M Chemicals</td>
			<td>59435</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sigma-Aldrich</td>
			<td>P9791</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium hexacyanoferrate III</td>
			<td>R&#38;M Chemicals</td>
			<td>208019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium acetate anhydrous salt</td>
			<td>Sigma-Aldrich</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>Trisodium citrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl) aminomethane</td>
			<td>Fisher Scientific</td>
			<td>T395-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-500</td>
			<td></td>
		</tr>
		<tr>
			<td>2X PCR Master Mix with Dual-Dye</td>
			<td>Norgen Biotek</td>
			<td>28240</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose gel</td>
			<td>Merck</td>
			<td>101236</td>
			<td></td>
		</tr>
		<tr>
			<td>Bolton Agar</td>
			<td>Merck</td>
			<td>100079</td>
			<td></td>
		</tr>
		<tr>
			<td>Bolton Broth</td>
			<td>Merck</td>
			<td>100079</td>
			<td></td>
		</tr>
		<tr>
			<td>CHROMagar Vibrio</td>
			<td>CHROMagar</td>
			<td>VB910</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Promega</td>
			<td>U1511</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Thermo Scientific</td>
			<td>R0581</td>
			<td></td>
		</tr>
		<tr>
			<td>Eosin methylene blue agar&#160;</td>
			<td>Merck</td>
			<td>101347</td>
			<td></td>
		</tr>
		<tr>
			<td>GelRed</td>
			<td>Biotium</td>
			<td>41001</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Merck</td>
			<td>104092</td>
			<td></td>
		</tr>
		<tr>
			<td>Go Taq Buffer</td>
			<td>Promega</td>
			<td>M7911</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading dye 100 bp DNA ladder</td>
			<td>Promega</td>
			<td>G2101</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading dye 1kb DNA ladder</td>
			<td>Promega</td>
			<td>G5711</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Promega</td>
			<td>91176</td>
			<td></td>
		</tr>
		<tr>
			<td>Mannitol egg yolk polymyxin agar</td>
			<td>Merck</td>
			<td>105267</td>
			<td></td>
		</tr>
		<tr>
			<td>McConkey Agar</td>
			<td>Merck</td>
			<td>105465</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutrient Broth</td>
			<td>Merck</td>
			<td>105443</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq polymerase</td>
			<td>Merck</td>
			<td>71003</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypticase Soy Broth</td>
			<td>Merck</td>
			<td>105459</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypticase Soy Agar</td>
			<td>Merck</td>
			<td>105458</td>
			<td></td>
		</tr>
	</tbody>
</table>

development of an electrochemical dna biosensor to detect a foodborne pathogen

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

Formation of AuNPs was revealed through the change in color of the aqueous solution with sodium citrate present. This caused the color to change from light yellow to a deep ruby red. The generation of PLA-AuNPs was confirmed from the UV-vis spectra (Figure 1) where the growth of the surface plasmon resonance (SPR) peak was found at around 540 nm. The formation and existence of PLA-AuNPs was indicated at 500-600 nm wavelength ranges, depending on particle size...

Watch this Scientific Journal Video about Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen at JoVE.com

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

development-an-electrochemical-dna-biosensor-to-detect-foodborne

Research

JoVE Journal

Bioengineering

13.0K Views.  Universiti Putra Malaysia. A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Video: Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

High-throughput, Automated Extraction of DNA and RNA from Clinical Samples using TruTip Technology on Common Liquid Handling Robots

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. Consequently, the sample preparation format is compatible with most liquid handling instruments, and can be used for many medium to high-throughput clinical applications and sample types.

TruTip is a simple nucleic acid extraction  technology whereby a porous, monolithic binding matrix is inserted into a  pipette tip. The geometry of the ...

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) antibody conjugated latex beads have been utilized to create a biosensor designed for discrimination of methicillin resistant (MRSA) and sensitive (MSSA) S. aureus species 1,2. The lytic phages have been converted into phage spheroids by contact with water-chloroform interface. Phage spheroid monolayers have been moved onto a biosensor surface by Langmuir-Blodgett (LB) technique 3. The created biosensors have been examined by a quartz crystal microbalance with dissipation tracking (QCM-D) to evaluate bacteria-phage interactions. Bacteria-spheroid interactions led to reduced resonance frequency and a rise in dissipation energy for both MRSA and MSSA strains. After the bacterial binding, these sensors have been further exposed to the penicillin-binding protein antibody latex beads. Sensors analyzed with MRSA responded to PBP 2a antibody beads; although sensors inspected with MSSA gave no response. This experimental distinction determines an unambiguous discrimination between methicillin resistant and sensitive S. aureus strains. Equally bound and unbound bacteriophages suppress bacterial growth on surfaces and in water suspensions. Once lytic phages are changed into spheroids, they retain their strong lytic activity and show high bacterial capture capability. The phage and phage spheroids can be utilized for testing and sterilization of antibiotic resistant microorganisms. Other applications may include use in bacteriophage therapy and antimicrobial surfaces.

Lytic phage biosensors and antibody beads are able to discriminate between methicillin resistant (MRSA) and sensitive staphylococcus bacteria. The phages were immobilized by a Langmuir-Blodgett method onto a surface of a quartz crystal microbalance sensor and worked as broad range staphylococcus probes. Antibody beads recognize MRSA.

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) ...

Sensing of Barrier Tissue Disruption with an Organic Electrochemical Transistor

The gastrointestinal tract is an example of barrier tissue that provides a physical barrier against entry of pathogens and toxins, while allowing the passage of necessary ions and molecules. A breach in this barrier can be caused by a reduction in the extracellular calcium concentration. This reduction in calcium concentration causes a conformational change in proteins involved in the sealing of the barrier, leading to an increase of the paracellular flux. To mimic this effect the calcium chelator ethylene glycol-bis(beta-aminoethyl ether)-N,N,N&#39;,N&#39;-tetra acetic acid (EGTA) was used on a monolayer of cells known to be representative of the gastrointestinal tract. Different methods to detect the disruption of the barrier tissue already exist, such as immunofluorescence and&#160;permeability assays. However, these methods are time-consuming and costly and not suited to dynamic or high-throughput measurements. Electronic methods for measuring barrier tissue integrity also exist for measurement of the transepithelial resistance (TER), however these are often costly and complex. The development of rapid, cheap, and sensitive methods is urgently needed as the integrity of barrier tissue is a key parameter in drug discovery and pathogen/toxin diagnostics. The organic electrochemical transistor (OECT) integrated with barrier tissue forming cells has been shown as a new device capable of dynamically monitoring barrier tissue integrity. The device is able to measure minute variations in ionic flux with unprecedented temporal resolution and sensitivity, in real time, as an indicator of barrier tissue integrity. This new method is based on a simple device that can be compatible with high throughput screening applications and fabricated at low cost.

The Organic Electrochemical Transistor is integrated with live cells and used to monitor ion flux across the gastrointestinal epithelial barrier. In this study, an increase in ion flux, related to disruption of tight junctions, induced by the presence of the calcium chelator EGTA (ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetra acetic acid), is measured.

The gastrointestinal tract is an example of barrier tissue that provides a physical barrier against entry of pathogens and toxins, while allowing the ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

Development of an In Vitro Ocular Platform to Test Contact Lenses

Currently, in vitro evaluations of contact lenses (CLs) for drug delivery are typically performed in large volume vials,1-6 which fail to mimic physiological tear volumes.7 The traditional model also lacks the natural tear flow component and the blinking reflex, both of which are defining factors of the ocular environment. The development of a novel model is described in this study, which consists of a unique 2-piece design, eyeball and eyelid piece, capable of mimicking physiological tear volume. The models are created from 3-D printed molds (Polytetrafluoroethylene or Teflon molds), which can be used to generate eye models from various polymers, such as polydimethylsiloxane (PDMS) and agar. Further modifications to the eye pieces, such as the integration of an explanted human or animal cornea or human corneal construct, will permit for more complex in vitro ocular studies. A commercial microfluidic syringe pump is integrated with the platform to emulate physiological tear secretion. Air exposure and mechanical wear are achieved using two mechanical actuators, of which one moves the eyelid piece laterally, and the other moves the eyeballeyepiece circularly. The model has been used to evaluate CLs for drug delivery and deposition of tear components on CLs.

Development of an In Vitro Ocular Platform to Test Contact Lenses

Current in vitro models for evaluating contact lenses (CLs) and other eye-related applications are severely limited. The presented ocular platform simulates physiological tear flow, tear volume, air exposure and mechanical wear. This system is highly versatile and can be applied to various in vitro analyses with CLs.

Currently, in vitro evaluations of contact lenses (CLs) for drug delivery are typically performed in large volume vials,1-6 which fail to mimic ...

The Use of a &#946;-lactamase-based Conductimetric Biosensor Assay to Detect Biomolecular Interactions

Biosensors are becoming increasingly important and implemented in various fields such as pathogen detection, molecular diagnosis, environmental monitoring, and food safety control. In this context, we used &#946;-lactamases as efficient reporter enzymes in several protein-protein interaction studies. Furthermore, their ability to accept insertions of peptides or structured proteins/domains strongly encourages the use of these enzymes to generate chimeric proteins. In a recent study, we inserted a single-domain antibody fragment into the Bacillus licheniformis BlaP &#946;-lactamase. These small domains, also called nanobodies, are defined as the antigen-binding domains of single chain antibodies from camelids. Like common double chain antibodies, they show high affinities and specificities for their targets. The resulting chimeric protein exhibited a high affinity against its target while retaining the &#946;-lactamase activity. This suggests that the nanobody and &#946;-lactamase moieties remain functional. In the present work, we report a detailed protocol that combines our hybrid &#946;-lactamase system to the biosensor technology. The specific binding of the nanobody to its target can be detected thanks to a conductimetric measurement of the protons released by the catalytic activity of the enzyme.

In this work, we report a new method to study protein-protein interactions using a conductimetric biosensor based on the hybrid &#946;-lactamase technology. This method relies on release of protons upon hydrolysis of &#946;-lactams.