המחברים רוצה להכיר את התמיכה של מלזיה Universiti Putra.

הערה: כל ריאגנטים כימי וביוכימי כדי לשמש צריך להיות של כיתה אנליטית, ללא טיהור נוסף. להכין את כל הפתרונות באמצעות מים יונים סטרילי. אוטוקלב כל כלי זכוכית לפני העיקור.
התראה: אנא השתמש כל נוהלי בטיחות המתאים בעת ביצוע פעילויות מעבדה, כולל את השימוש הנדסה פקדים (fume הוד, הכפפות), ציוד מגן אישי (בטיחות משקפיים, כפפות, חלוק המעבדה, מכנסיים באורך מלא, סגורות נעלי).
1. ייצור, אפיון של שינוי אלקטרודה באמצעות ה-PLA-AuNPs
<ol><li>
הכנה ואפיון של ה-PLA-AuNPs
	<ol>
<li>להוסיף 10 מ של הפתרון סודיום ציטרט (38.8 מ מ) ל- 100 מ של רותחים chloroauric מימית תמיסה חומצית (1 מ מ) ובמהירות תירגע עד טמפרטורת הסביבה. לבחון את השינויים בצבע בפתרון AuNPs מוכן אשר מתחיל כמו צהוב, שינויים שחור ומסתיים לבסוף כמו אדום רובי כהה.</li>
		<li>מניחים את כדורי ה-PLA תבנית מפלדת לתהליך ההיתוך ומחממים אותם בטמפרטורה של 190 מעלות במשך 10 דקות אחרי ההליך הקשה: שים אותם תחת לחץ של MPa 2.2 עבור 1 דקות כחלק הכנת גיליון ה-PLA. הגיליון PLA יהיה מוכן לשימוש לאחר קירור במשך כ-3 שעות.</li>
		<li>לערבב נמרצות, להמיס 0.68 מ ג של הסדינים PLA ב 5 מ של כלורופורם בטמפרטורת החדר. מערבבים ה-PLA מומס עם 10 מ"ל של הפתרון AuNPs בעבר מוכן ומערבבים homogeneously זה בטמפרטורת החדר. תערובות הומוגנית אז יכול להיות denoted כמו ה-PLA-AuNPs, מאופיין באמצעות UV-Vis, XRD, TEM, ו- FESEM עם EDX.</li>
	</ol>
</li>
	<li>
הכנה ואפיון של פחמן המסך המודפס ששונה אלקטרודה הערה: SPCE השתמשו במחקר זה כוללת מערכת 3-אלקטרודה: אלקטרודה מונה אלקטרודה עבודה של פחמן, אלקטרודה הפניה Ag/AgCl.<ol>
<li>במהירות פיפטה 25 µL של פתרון הומוגני של ה-PLA-AuNPs על גבי SPCE ולאחר מכן אוויר יבש זה עבור 24 שעות לפני השימוש.</li>
		<li>Electrochemically לאפיין את האלקטרודות ששונה, SPCE/ה-PLA-AuNPs, בפרו אשלגני (K3[Fe(CN)6]3 -/4 -) כדי למדוד את שטח פעיל, ספקטרוסקופיה עכבה אלקטרוכימי, הדיר, הפארמצבטית, יציבות30.</li>
	</ol>
</li>
</ol>2. פיתוח ביוסנסור אלקטרוכימי DNA
<ol><li>
בדיקה הכנה הערה: הרצף של בדיקה ssDNA ו- DNA משלימים נבחרו בהתבסס על מידע של המרכז הארצי עבור מסד הנתונים ביוטכנולוגיה מידע (NCBI).<ol>
<li>לרכוש oligonucleotides סינתטי (20-מר ssDNA בדיקה, DNA משלימים 20-mer, 20-מר לא תואמים DNA ו 21-מר-משלימה דנ א) אבקת lyophilized ממעבדות מסחרי, בהתבסס על רצפי הבאים: thiolated ssDNA בדיקה: יונקות - / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3′ DNA משלימים: יונקות - CAGTGCTTCTGCATAATCCG - 3′ DNA שאינם תואמים אחד-בסיס: יונקות - CAGTGCTTCTGC ṪTAATCCG - 3′ 3-בסיס DNA שאינם תואמים: יונקות - CAGTGCTTCT Ċ ṪṪTAATCCG - 3′ DNA שאינם משלימים: יונקות - CGCACAAGGCTCGACGGCTGA - 3′</li>
		<li>להכין מלאי פתרונות של כל oligonucleotides (100 מיקרומטר) באמצעות סטרילי טה פתרון (10 מ מ טריס-HCl, 1 מ"מ EDTA, pH 7.5), מחולק לחלקים אנליטית. לשמור את זה ב-4 ° C ולאחר מכן בצע את דילולים המתאים רק לפני השימוש.</li>
	</ol>
</li>
	<li>
אופטימיזציה של קיבעון של הכלאה הערה: SPCE שופרת PLA-AuNPs, מסומן בתור SPCE/ה-PLA-AuNPs, נעשה שימוש במחקר זה, שיטת הליהוק טיפה שימש כדי להפוך את ה-DNA הנייח הכלאה.<ol>
<li>ראשית, לשתק 25 µL של thiolated ssDNA בדיקה על ה-PLA/SPCE-AuNPs, ואז האוויר יבש זה עבור 24 שעות בטמפרטורת החדר, לאחר מכן זה להיות סוף סוף מסומן בתור SPCE/ה-PLA-AuNPs/ssDNA. לקבוע אופטימיזציה של התנאי הנייח באמצעות שלושה גורמים: הריכוז של ssDNA (החל 0.2 1.4 µM), זמן (החל מ-30 ועד 210 דקות), טמפרטורה (החל מ- 25 ועד 75 ° C).</li>
		<li>פיפטה 25 µL של ה-DNA משלימים על פני השטח של SPCE/ה-PLA-AuNPs/ssDNA כדי לבצע את האירוע הכלאה לאחר מכן זה יכול להיות סוף סוף מסומן בתור SPCE/ה-PLA-AuNPs/dsDNA. לקבוע אופטימיזציה של התנאי הכלאה באמצעות שני גורמים של זמן (החל מ-5 עד 30 דקות) וטמפרטורה (החל מ- 25 ועד 75 ° C).</li>
		<li>לטבול את קיבוע של אלקטרודות hybridized ב- 20 מיקרומטר MB עבור 30 דקות להסיר את ה-DNA הלא ספציפית הספוחה ו MB עודף על ידי כביסה עם 0.5 M ABS/20 מ מ NaCl (pH 4.5) ולאחר מכן שטיפה בעזרת יונים מים. מדד השיא הנוכחי של הפחתת MB DPV בטכניקה. לבצע את המדידה DPV באמצעות 0.1 M PBS (pH 7) המכיל אין מחוון.</li>
	</ol>
</li>
	<li>
אפיון החיישן DNA מפוברק
	<ol>
<li>לטבול את SPCE/ה-PLA-AuNPs ב- 20 מיקרומטר MB במשך 30 דקות, לשטוף עם 0.5 M ABS/20 מ מ NaCl (pH 4.5) ולאחר מכן לשטוף עם מים יונים לפני מדידה. בצע הליך דומה עבור כל האינטראקציות לרבות בדיקת DNA, DNA משלימים, DNA שאינם תואמים, דגימות די אן איי שאינם משלימים.</li>
		<li>למדוד ההפחתה אלקטרוכימי. הערה: מדדנו DPV באמצעות ממשק התוכנה של Autolab מיוצרים באופן מסחרי. המדידות DPV MB להפחתת אלקטרוכימי בנטילת פוטנציאלי ועד-V 0.5 0.25 V, בצעד פוטנציאלי של 0.005 V, אפנון משרעת של 0.05 V, ושיעור סריקה של 7.73 mVs-1 ב- PBS 0.1 M (pH 7), המכיל אין מחוון. סלקטיביות, רגישות, הפארמצבטית, יציבות החום של החיישן DNA מפוברק נחקרו בהמשך. התוצאות המדווחות הוצגו מדידות ערך רשע ב משכפל שלוש.</li>
	</ol>
</li>
</ol>3. אימות של החיישן מפוברק הדנ א באמצעות דוגמאות אמיתיות
<ol><li>הכנה של זני חיידקים
	<ol>
<li>בחר דגימות בקטריאליות בהתבסס על שלהם זיהום משמעותי של מאכלי ים31,32 . הערה: נ' parahaemolyticus וגם הפניה זנים 8 אחרים זני חיידקים (קמפילובקטר jejuni ליסטריה, סלמונלה typhimurium, סלמונלה דלקת מעיים, דלקת ריאות קלבסיאלה, Escherichia coli O157:H7, Bacillus קובו, ויבריו alginolyticus) של והקאה נפוצות הפתוגן הועסקו לשם אימות ביוסנסור אלקטרוכימי DNA במחקר זה.</li>
		<li>התנהגות שגרתית תת תרבות של זני חיידקים על אגר בהתאמה שלהם כל שבועיים כדי לשמור על יכולת הקיום שלהם, עיין טבלה 1 עבור תנאים תרבות.</li>
		<li>לשמור על שימור לטווח ארוך זני חיידקים ב שלהם broths גדל בהתאמה המכיל 20% (v/v) גליצרול ב-80 מעלות צלזיוס כפי גליצרול מגן על חיידקים על ידי מניעת היווצרות של גבישי קרח אשר יכולים לגרום להם נזק במהלך תהליך ההקפאה. בשלב הבא, לחסן לולאה של תא החיידק משומרת תרבות במניות גליצרול לתוך broths בהתאמה. דגירה את broths על פי טמפרטורה וזמן צמיחה בהתאמה שלהם בעת הצורך להחיות את החיידקים.</li>
		<li>לקבוע את הכמות נ' parahaemolyticus תאים באמצעות טכניקה של צלחת כפולה33, תקן ושיטה ידועה לספירת מיקרואורגניזמים נגזר סדרת דילולים.<ol>
<li>תרבות נ' parahaemolyticus ב Trypticase סויה מרק (TSB + 3% NaCl) ב 37 מעלות צלזיוס במצב חזק 140-סל ד. לאחר מכן, להעביר 1 מ"ל של התרבות תאי חיידקים לתוך 9 מיליליטר TSB + 3% NaCl להשיג גורם לדילול 10-1 .</li>
		</ol>
</li>
		<li>חזור על שלב זה תשע פעמים כדי לקבל סדרה מלאה של גורם לדילול-10 עד 10. הבא, התפשטה 0.1 מ"ל של כל גורם לדילול (החל מ 10-1 כדי 10-10) על צלחת אגר סלקטיבי של ויבריו המושבה ספירה, בהתאמה. דגירה הלוחות מודגרות ב 37 מעלות צלזיוס במשך 24 שעות ביממה.</li>
		<li>השתמש מונה המושבה כדי לספור מושבות בודדות, ואז חזרה-לחשב (ספירת הסכום CFU/pipetted x פקטור דילול) כדי לקבל יחידת המושבה יוצרי לאדם צפיפות מיליליטר (מ"ל CFU-1). שואבים את הריכוז של המושבה יוצרי יחידות (CFUs) ב השעיות התא חיידקים מן העלילה כיול של mL CFU-1 נגד ספיגת.</li>
	</ol></li>
	<li>הכנת וזמינותו PCR
	<ol>
<li>תמצית הדנ א בעקבות ששונה מבושלים הליך פירוק34. עם הנץ החמה בקטריאלי בודדים זן במדיה אגר, לחסן אותו בתקשורת מרק, ואחריו המקננת זה על מצבו היחסי צמיחה, סל"ד 140 רועד תנאי.</li>
		<li>Pipette תרבות 1 מ"ל של מרק לתוך שפופרת צנטרפוגה מיקרו. Centrifuge זה-4830-g ו- 4 מעלות צלזיוס במשך 1 דקה להשיג כדורי. השתמש בערך 500 µL מאגר טה סטרילי re-השעיה עם בגדר. להחזיק ההשעיה וכתוצאה מכך במשך 10 דקות על 98 ± 2 ° C בתוך גוש חימום, מיד תרגעו ב-18 מעלות צלזיוס למשך 10 דקות lyse התאים ולשחרר את ה-DNA.</li>
		<li>Centrifuge ה-DNA גנומי-4830-g ו- 4 מעלות צלזיוס למשך 3 דקות לקבל השעיה ברורה ולשמור את תגובת שיקוע ב-20 ° C לשימוש נוסף. השתמש מדידה biophotometer עם הקליטה UV באורך-גל של 260 ננומטר (כמו חומצות גרעין קליטת אורך הגל של אור) וגם ב אורך גל של 280 ננומטר (כמו החלבונים סופגי אורך הגל של אור) כדי לקבוע את הריכוז ואת טוהר חילוץ דנ א גנומי ולאחר מכן לזהות את כל זני באמצעות מבחני הביוכימי רגיל35 ואימות אותם על ידי מטוסי אף-16 rRNA ג'ין רצף36. לבסוף, denature ה-DNA גנומי ב 92 מעלות צלזיוס למשך 2 דקות, לצנן את זה במהירות במי קרח לפני היישום החיישן.</li>
		<li>נוסף לאשר הנוכחות נ' parahaemolyticus באמצעות PCR למקד את הגן toxR. ביצוע הליך זה thermocycler באמצעות זוג פריימר (5'-GTCTTCTGACGCAATCGTTG-3' ו 5'-ATACGAGTGGTTGCTGTCATG-3'). למטב את הגברה PCR נפח התגובה הכולל של 25 µL המורכב במים סטריליים (15.5 µL), מאגר (5 µL), פריימר (1 µL, 10 מיקרומטר), dNTP מיקס (1 µL), תבנית ה-DNA (2 µL) ו- Taq DNA פולימראז (0.2 µL, 10 x).</li>
		<li>מערבבים את רכיבי היטב, לארגן הגברה PCR של הרצף היעד ב- thermocycler מתוכנת מחזורים של הגברה. במחקר שלנו, בכל מחזור כללה שלושה שלבים תגובות כלומר., דנטורציה הראשונית (94 ° C, 3 דקות) ואחריו 30 מחזורי דנטורציה (94 ° C, 1 דקות), חישול (63 ° C, כ- 1.5 דקות) והסיומת (72 ° C, כ- 1.5 דקות), ואחריו הסיומת הסופי (72 ° C, 7 דקות).</li>
		<li>לקבוע את המוצרים מוגבר, הגדלים שלהם באמצעות אלקטרופורזה על 1.5% agarose ג'ל. ללכוד את התמונות ג'ל עם מערכת ג'ל המיוצר מסחרית-תיעוד.</li>
	</ol></li>
	<li>הכנת דוגמאות פשוט נתעלף
	<ol>
<li>להשיג דגימות טריות. הערה: הלב שלנו טריים (Anadara granosa) היו המתקבל בשוק רטוב Serdang, Selangor, והביא במהירות את המעבדה בתיבת קרח קריר יותר לניתוח. לחלק את הדגימות 2 קבוצות, כלומר קבוצת טיפול ללא טיפול, בהנחה כי הלב נבצרו בצורה אחידה מתחילת הקציר עד הצבתם לתוך אחסון הקרה.</li>
		<li>מראש לטפל הלב בקבוצה שטופלו על ידי אחסונם ב-20 מעלות צלזיוס במשך 24 שעות, ואחריו חשיפה לאור UV ב 20 מעלות צלזיוס במשך 4 שעות לפני מיצוי הדנ א. הערה: את טמפרטורת הקיפאון ואת חשיפה UV המשמש מבוקרת קבוצה או לפחות מגביל את צבירת באופן טבעי נ' parahaemolyticus ב הלב. אל תחיל משטר פסטור גבוה יותר של 70 מעלות צלזיוס כמו מטרת התנאי מבוקרת במחקר זה היא לחקות את המצב בפועל של הלב טריים. בינתיים, לנתח דגימות ישירות מן הקבוצה מטופל ללא כל טיפול קדם ברגע שהם מגיעים במעבדה.</li>
		<li>תת-תרבות זן של נ' parahaemolyticus בקרת האוויר 17802 ב TSB (3% NaCl). לקבוע את רמת התאים קיימא ב inoculum באמצעות ציפוי של דילולים המתאים של TSB (3% NaCl) ב- CA על מנת לקבל את inoculum של 104 CFU מ ל-1 של נ' parahaemolyticus. לשטוף כל אחרים במים מזוקקים, לקרצף אותה ללא לכלוך לפני באמצעות מלקחיים סטרילי זרימה שכבתית בארון כדי להסיר הרקמות הקליפה.</li>
		<li>Homogenize בערך 10 גרם של דגימות רקמה אחרים עם מהמגן ב- 90 מיליליטר TSB סטרילי (3% NaCl) 60 s. הוסף כמות ידועה של נ' parahaemolyticus 9 מ ל ציר מדגם הומוגני על הדגימות מחודדים. השתמש הדגימות unspiked כפקד שלילי. מעריכים את ספירת תאים של נ' parahaemolyticus עלה על הדגימות אחרים על ידי ציפוי 0.1 מ"ל של הדגימות על CA, לאחר מכן, pipetting 1 מ"ל של דגימות לתוך צינור microcentrifuge עבור ה-DNA לטעום החילוץ, כדי לשמש את ביוסנסור ואת וזמינותו PCR.</li>
		<li>תמצית ה-DNA גנומי של נ' parahaemolyticus בין דגימות מחודדים, unspiked בעקבות ששונה מבושלים הליך פירוק36. לבסוף, לקבוע את ריכוז הדנ א ואת טוהר באמצעות מדידה photometer ביו עם הקליטה UV באורך-גל של 260 ננומטר (כמו חומצות גרעין קליטת אורך הגל של אור) וגם ב אורך גל של 280 ננומטר (כמו החלבונים סופגי אורך הגל של אור).</li>
	</ol></li>
</ol>

המחברים אין לחשוף.

השלבים הקריטיים במסגרת להתפתחותן של סוג זה של ביוסנסור אלקטרוכימי הם מבחר אלמנטים המתאימים זיהוי ביולוגי המתמר (חומצת גרעין או DNA כאן); הגישה כימיים עבור בניית השכבה חישה של המתמר; התמרה חושית חומר; אופטימיזציה של ה-DNA הנייח, הכלאה; ואימות החיישן מפותחת באמצעות דוגמאות אמיתיות.
ליבה להתפתחות מוצלחת של רגיש, סלקטיבי אלקטרוכימי DNA ביוסנסור, אופטימיזציה של התנאי הנייח של הכלאה. בעבודה זו, השתמשנו MB בתור מורכבים חמצון-חיזור. עקרונות שונים של אינטראקציות MB-DNA: (i) על ידי האינטראקציה אלקטרוסטטית של החיוב cationic MB עם פוספט את עמוד השדרה המטען anionic של ssDNA ו- dsDNA; (ii) על ידי העיבור MB דרך הכניסה המוצלחת של MB בין לסירוגין G-C בסיסי זוגות ב- dsDNA; (iii) על-ידי קשר קוולנטי לסוף ssDNA המטרה, אשר מייצרת תווית נמוך צפיפות (אחד או שניים MB מולקולות לכל צירוף ד. נ); ו- (ד) על ידי MB אינטראקציות עם גואנין לא מאוגד לבסיס ssDNA. אנחנו מיושם העיקרון הרביעי, אשר מזהה במדויק נ' parahaemolyticus מן הצלב תגובתיות של חיידקים, הלב טריים. אחרי oxidization עניין מיוחד, היה יש זיקה חזקה בין מגה ssDNA. הכלאה של ssDNA עם רצף משלים שלו מחליף את המולקולות MB בונדד, ובכך מפחית את האות.
הסדרה של תוצאות ניסויית שהובאו לעיל מתמקדת בפיתוח של שיטה מהירה של גילוי נ' parahaemolyticus סלקטיביות גבוהה ורגישות שימוש בעקרונות ה-DNA הכלאה. הצעד הראשון הוא סינתזה אפיון polylactic מיוצב חומצה חלקיקי זהב (PLA-AuNPs) עבור שינוי של האלקטרודה (המספרים 1-6 ו לטבלה 2). איכות חלקיקי זהב הוערך באמצעות ספקטרוסקופית הגלוי אולטרה סגול (UV-Vis), קרני רנטגן (XRD), מיקרוסקופ אלקטרונים סורק פליטת שדה (FESEM), הילוכים מיקרוסקופ אלקטרונים (TEM), Voltammetry מחזורית (CV) ו ניתוח אימפדנס. החלק השני של ההתפתחות מעורב של אפיון אלקטרוכימי של האלקטרודה ששונתה (איורים 7-12 ו לטבלה 3-4) אשר קבע שיפור מוצלחת של האלקטרודה שהשתנה ביחס האלקטרודה חשופים ב תנאי גילוי האירוע הכלאה.
הצעד השלישי של פיתוח ביוסנסור DNA מבוסס התבססה על אופטימיזציה של התנאים ניסיוני של האירוע הכלאה והיישום של החיישן מפותחת כדי הגילוי של המחלה בפועל (דמויות 13-20). האירוע הכלאה שקבעה את ההצלחה של הגילוי של המחלה הוערכה באמצעות הדופק דיפרנציאלי voltammetry (DPV). קיום חיובי הפתוגן יישוב הייתה מצוינת דרך הפחתת של הזרם. הרגישות של החיישן מפותחת הוערך באמצעות הקמת מגרש כיול והוא החישוב של לוד (איור 15). החיישן מפוברק היה מסוגל להבחין במיוחד נ' parahaemolyticus מפני פתוגנים אחרים בהתבסס על רמות שונות של הפחתת הנוכחי (דמויות 17 ו-18). הערכת היתכנות החיישן שפותחו לצורך זיהוי של נ' parahaemolyticus אוכל אמיתי מדגם מוצג דמויות 19 ו-20 ומצוין קיום המחלה יישוב חיובי על ידי הפחתת הנוכחי . פיתוח מוצלח של ביולוגיים מבוססי DNA תלויה מאוד בחירה בדיקה דנ א, שיפור של האלקטרודה ששונתה וכן אופטימיזציה של התנאים ניסיוני. החללית ה-DNA כאן כבר ממאמרו של העבודה הקודמת של נאקאנו67. שיפור של האלקטרודות ששונה בוצעה באמצעות חלקיקי זהב התייצב עם חומצה polylactic כדי לאפשר את התקינה של nanosize. הפונקציה חלקיקי זהב כמו אלקטרו גשמי קטליטי68 ולפעול כדי להגביר את קצב ההעברה של האלקטרון ולספק גם משטח שעליו ניתן לעגן את החללית ה-DNA. הפרמטרים ניסיוני אופטימציה מבחינת טמפרטורה וזמן הדגירה אשר הוא קריטי עבור ה-DNA לטופס דופלקס. הטמפרטורה הכלאה משפיע מההפרדה בין ספיחה לא ספציפית את זה מגביר את מידת הבררנות של החיישן. זמן הדגירה של הכלאה מגדיל את הסיכויים של היווצרות דופלקס. חייב להיות מוטבת ההליך הנייח על מנת לוודא כי המכשיר דנ א יהיה בכיוון מתאים לשם יצירת דופלקס לטופס.
משווה בין טבלה 5 מדגם של פותח לאחרונה אלקטרוכימי DNA ביולוגיים69,70,71,72,73,74,75 ,. Biosensing מבוסס DNA היא שיטה מבטיחה להחלפת טכניקות מולקולריות מבוסס אמנם ישנן כמה מגבלות שמחייבות לפני השיטה יכולה להיות מספיק נייד לשימוש באתר. המגבלה העיקרית היא דוגמת עיבוד ה-DNA החילוץ כמו הטוהר, כמות ה-DNA שחולצו באתר אינו עשוי להיות טוב כמו זה מופק בשיטה מבוססת-מעבדה סטנדרטיים. עם זאת, חלופה מבטיח אם ה-PCR וג'ל אלקטרופורזה יכול להיות מוחלף עם דוגמת מערכת pretreatment כגון microfluidic.
ביולוגיים מבוססי דנ א יכולות להיות שימושיות עבור יישומים רבים כולל אבחון רפואי, ניטור סביבתי וניטור מזון. טכניקה זו יאפשר ניטור מקוון של תהליכי בקרת איכות, כמו גם בשלב של טיפול ניטור של חולים. הניידות של חיישן כל המערכת תאפשר את ביזור של תהליכי האבחון שבו הצרכן יכול להשתמש במערכת זיהוי בנוחות של הבית שלהם.

נושא מרכזי של הדיון הציבורי ומדעיים בשנים האחרונות, הרעלת מזון היא מזוהה בעיקר עם שלושה סוכנים: מיקרואורגניזמים1, כימיקלים2וטפילים3. מזון מזוהם עלול לגרום לתוצאות בריאות רציניות בבני אדם, במיוחד אצל קבוצת סיכון גבוה יותר של אלה עם מערכות החיסון חלשה, נשים בהריון, קשישים, תינוקות, ילדים צעירים4. עם יותר ממיליון מקרים של שלשול אקוטי המתרחשים מדי שנה אצל ילדים מתחת לגיל 5 שנים ב אפריקה, אסיה, אמריקה הלטינית, הרעלת מזון היא מחלה הגלובלית הגדולות5,6 , הקימה ארגון הבריאות העולמי מיקרואורגניזמים כמו התורם החשוב ביותר7. ויבריו parahaemolyticus בולטת בין זנים מידבק ביותר המוכר. בדרך כלל שנמצאו לאורך החוף, estuarine, ימית סביבות8, הוא חיידק גראם שליליים, אשר הופכת לפעילה בסביבות מלח גבוהה, והוא גורם להרעלתו אנושי רציני כאשר אוכלים מבושל כראוי, כושלת או raw ימית מוצרים9. בנוסף, קיימים מצבים רפואיים אצל אנשים מסוימים להפוך אותם נוטה פצע הזיהום זיהום, ספטיסמיה או האוזן הנובעים נ' parahaemolyticus10. הגורמים התקפה אלימה של נ' parahaemolyticus hemolysins נחלקים לשני סוגים אשר לתרום בפתוגנזה המחלה: thermostable המוליזין ישירה (TDH) מקודד על ידי הגנים tdh ולאחר הקשורות TDH המוליזין מקודד על ידי גנים trh11. הקריטריונים התקפה אלימה (גנים tdh ו- trh) של parahaemolyticus (פ') נמצאים בעיקר דגימות קליניות, במקום דגימות סביבתיים.
(פ') parahaemolyticus יש את היכולת לשרוד תחת מגוון רחב של תנאים, להגיב במהירות על שינויים סביבתיים12. מנגנון התפשטות שלה מסלים את פוטנציאל הסיכון שלו ככל שלה רעילות במקביל תא המוני13. חמור מכך, שינוי האקלים מספקת חיידקים אלה בתנאים בשפע כדי להאיץ את הצמיחה שלהם האוכלוסייה תא14. בשל תדירותו גבוהה, נ' parahaemolyticus צריך להיות במעקב לאורך שרשרת אספקת המזון, במיוחד בתחום הסחר והייצור של פירות ים מאז מוצרים אלה הם שבו הם נמצאים בכמויות עצומות15,16 ברחבי העולם. כיום החיידקים מזוהות ואת וזמינותו מבודדים באמצעות מגוון של שיטות כולל בדיקות ביוכימיות, העשרה, מדיה סלקטיבי17, מקושרים-אנזים immunomagnetic sorbent (אליסה)18, הדופק-שדה בג'ל (PFGE) 19התלכדות לייטקס בדיקות, בדיקות פולימראז תגובת שרשרת (PCR)20. שיטות אלו דורשות בדרך כלל מוסמכים, מכשירים מתוחכמים וטכניקות מפרך אשר אינם מספקים מידע אודות זיהום באופן מיידי. זה קשות מגביל את הסבירות מיד גילוי זיהום מזיקים ויישומים באתר. כלי איתור מהיר עדיין מהווה אתגר יוצא מן הכלל.
Biosensing מתגלה כאופציה מבטיחה איתור והקאה פתוגנים משום שהיא מציעה לחיסכון בזמן, חסכונית, מעשית, בזמן אמת וניתוח בשיטת21,22,23,24 . עם זאת, אמנם היו תוצאות חיוביות רבות של analyte בזיהוי כל פתרון באמצעות ביולוגיים ודוגמאות מחודדים, יש עדיין חוסר מחקר חלה על דוגמאות אמיתיות או תערובות מימית או תמציות אורגניות25. לאחרונה, ביולוגיים אלקטרוכימי באמצעות זיהוי ישיר ו/או עקיף חומצה deoxyribonucleic (DNA) קיבלו תשומת לב מוגברת בקרב מדענים, עקב שלהם זיהוי ספציפי של המטרה משלימים באמצעות אירוע הכלאה26 , 27 , 28 , 29. גישות ייחודיות אלה יציבים יותר בהשוואה ביולוגיים מבוססי אנזים, ובכך מציע טכנולוגיה מבטיח המזעור, מסחור. המטרה של המחקר דיווח הנה כדי לבנות כלי מהיר יכול לזהות נ' parahaemolyticus עם סלקטיביות גבוהה, רגישות, מעשיות, המבוססת על רצף ה-DNA יחודיות במהלך הכלאה. זיהוי אסטרטגיות כוללות השילוב של חומצה מיוצב חלקיקי זהב (PLA-AuNPs) polylactic30 ואלקטרודות פחמן המסך המודפס (SPCEs) בנוכחות מחוון הכלאה, מתילן כחול (MB). הפוטנציאל של הבונה הזיהוי מפותחת הוא חקר נוסף באמצעות חיידקים דגימות די אן איי פשוט נתעלף lysate ורענן.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Acetic acid</td>
			<td>Merck</td>
			<td>100056</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Merck</td>
			<td>102445</td>
			<td></td>
		</tr>
		<tr>
			<td>Diaminoethane tetraacetic acid</td>
			<td>Promega</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>Dibasic sodium phosphate&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>S9763</td>
			<td></td>
		</tr>
		<tr>
			<td>Disodium hydrogen phosphate</td>
			<td>Sigma-Aldrich</td>
			<td>255793</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>16368</td>
			<td></td>
		</tr>
		<tr>
			<td>Gold (III) chloride trihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>520918</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid</td>
			<td>Merck</td>
			<td>100317</td>
			<td></td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M44907</td>
			<td></td>
		</tr>
		<tr>
			<td>Monobasic sodium phosphate, monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>S3522</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-buffered saline</td>
			<td>Sigma-Aldrich</td>
			<td>P5119</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly(lactic acid) resin, commercial grade 4042D</td>
			<td>NatureWorks</td>
			<td>4042D</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>R&#38;M Chemicals</td>
			<td>59435</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sigma-Aldrich</td>
			<td>P9791</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium hexacyanoferrate III</td>
			<td>R&#38;M Chemicals</td>
			<td>208019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium acetate anhydrous salt</td>
			<td>Sigma-Aldrich</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>Trisodium citrate</td>
			<td>Sigma-Aldrich</td>
			<td>S1804</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl) aminomethane</td>
			<td>Fisher Scientific</td>
			<td>T395-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-500</td>
			<td></td>
		</tr>
		<tr>
			<td>2X PCR Master Mix with Dual-Dye</td>
			<td>Norgen Biotek</td>
			<td>28240</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose gel</td>
			<td>Merck</td>
			<td>101236</td>
			<td></td>
		</tr>
		<tr>
			<td>Bolton Agar</td>
			<td>Merck</td>
			<td>100079</td>
			<td></td>
		</tr>
		<tr>
			<td>Bolton Broth</td>
			<td>Merck</td>
			<td>100079</td>
			<td></td>
		</tr>
		<tr>
			<td>CHROMagar Vibrio</td>
			<td>CHROMagar</td>
			<td>VB910</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Promega</td>
			<td>U1511</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Thermo Scientific</td>
			<td>R0581</td>
			<td></td>
		</tr>
		<tr>
			<td>Eosin methylene blue agar&#160;</td>
			<td>Merck</td>
			<td>101347</td>
			<td></td>
		</tr>
		<tr>
			<td>GelRed</td>
			<td>Biotium</td>
			<td>41001</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Merck</td>
			<td>104092</td>
			<td></td>
		</tr>
		<tr>
			<td>Go Taq Buffer</td>
			<td>Promega</td>
			<td>M7911</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading dye 100 bp DNA ladder</td>
			<td>Promega</td>
			<td>G2101</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading dye 1kb DNA ladder</td>
			<td>Promega</td>
			<td>G5711</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Promega</td>
			<td>91176</td>
			<td></td>
		</tr>
		<tr>
			<td>Mannitol egg yolk polymyxin agar</td>
			<td>Merck</td>
			<td>105267</td>
			<td></td>
		</tr>
		<tr>
			<td>McConkey Agar</td>
			<td>Merck</td>
			<td>105465</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutrient Broth</td>
			<td>Merck</td>
			<td>105443</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq polymerase</td>
			<td>Merck</td>
			<td>71003</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypticase Soy Broth</td>
			<td>Merck</td>
			<td>105459</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypticase Soy Agar</td>
			<td>Merck</td>
			<td>105458</td>
			<td></td>
		</tr>
	</tbody>
</table>

development of an electrochemical dna biosensor to detect a foodborne pathogen

ויבריו parahaemolyticus (V. parahaemolyticus) הוא. חיידק נפוץ והקאה אשר תורם חלק ניכר של בעיות בריאות הציבור ברחבי העולם, באופן משמעותי משפיע על הקצב של האדם תמותה ותחלואה קרדיווסקולרית. שיטות קונבנציונליות איתור נ' parahaemolyticus כגון שיטות מבוססות-תרבות, מבחני אימונולוגי מולקולרי המבוסס על שיטות דורשים טיפול מסובך לדוגמה, זמן רב, מייגע, ויקרות. לאחרונה, ביולוגיים הוכיחו להיות שיטה לזיהוי מבטיח ומקיף עם היתרונות של זיהוי מהיר, משתלמת, ו המעשיות. מחקר זה מתמקד בפיתוח שיטה מהירה של גילוי נ' parahaemolyticus סלקטיביות גבוהה ורגישות שימוש בעקרונות ה-DNA הכלאה. עבודה, אפיון polylactic מסונתז מיוצב חומצה חלקיקי זהב (PLA-AuNPs) הושג באמצעות קרני רנטגן (XRD), ספקטרוסקופיה הגלוי אולטרה סגול (UV-Vis), הילוכים מיקרוסקופ אלקטרונים (TEM), פליטת שדה מיקרוסקופ אלקטרונים סריקה (FESEM), וולטמטריה ציקלית (CV). אנחנו גם ביצעו בדיקה נוספת של יציבות, רגישות הפארמצבטית של ה-PLA-AuNPs. . מצאנו ה-PLA AuNPs נוצר מבנה הקול של חלקיקים מיוצב בתמיסה המימית. גם הבחנו כי שיפרה הרגישות כתוצאה ערך התנגדות (Rct) קטן יותר תשלום העברה, גידול של פעיל שטח (2ס מ 0.41). פיתוח ביוסנסור הדנ א שלנו מבוססת על שינוי של אלקטרודות פחמן המסך המודפס (SPCE) עם ה-PLA-AuNPs ושימוש מתילן כחול (MB) כאינדיקטור חמצון-חיזור. אנחנו לאומדן האירועים הנייח והכלאה הדופק דיפרנציאלי voltammetry (DPV). מצאנו כי משלימים, שאינם משלימים, oligonucleotides לא תואמת במיוחד היו מכובדים על ידי החיישן מפוברק. זה הראה גם זיהוי רגיש בצורה אמינה במחקרים אשיג נגד פתוגנים שונים שמקורם במזון, הזיהוי של נ' parahaemolyticus בתוך הלב טריים.

Watch this Scientific Journal Video about Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen at JoVE.com

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

התפתחות ביוסנסור אלקטרוכימי דנ א כדי לזהות חיידק והקאה

פרוטוקול לפיתוח ביוסנסור אלקטרוכימי DNA הכוללת של אלקטרודות פחמן חלקיקי-לאחרונה, המסך המודפס מיוצב חומצה, זהב polylactic לזהות ויבריו parahaemolyticus מוצג.

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, ...

development-an-electrochemical-dna-biosensor-to-detect-foodborne

Nanyang Technological University

Research

JoVE Journal

Bioengineering

13.0K Views.  Universiti Putra Malaysia. פרוטוקול לפיתוח ביוסנסור אלקטרוכימי DNA הכוללת של אלקטרודות פחמן חלקיקי-לאחרונה, המסך המודפס מיוצב חומצה, זהב polylactic לזהות ויבריו parahaemolyticus מוצג.

Video: Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

המצאה של אלקטרוכימי-DNA Biosensors לגילוי Reagentless של חומצות, חלבונים ומולקולות קטנות גרעין

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

עיצוב של bioreactor לחץ על מחזורי Ex Vivo מחקר של מסתמי הלב אבי העורקים

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

חיישן הולו Microneedle מבוסס על מרובב דרך העור אלקטרוכימי חישה

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

Bacterial Detection & Identification Using Electrochemical Sensors

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

גילוי חיידקים וזיהוי באמצעות חיישנים אלקטרוכימיים

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

High-throughput, Automated Extraction of DNA and RNA from Clinical Samples using TruTip Technology on Common Liquid Handling Robots

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. Consequently, the sample preparation format is compatible with most liquid handling instruments, and can be used for many medium to high-throughput clinical applications and sample types.

הפקת תפוקה גבוהה, אוטומטית של DNA ו-RNA מדגימות קליניות באמצעות הטכנולוגיה TruTip על רובוטים טיפול נוזל נפוצים

TruTip is a simple nucleic acid extraction  technology whereby a porous, monolithic binding matrix is inserted into a  pipette tip. The geometry of the ...

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) antibody conjugated latex beads have been utilized to create a biosensor designed for discrimination of methicillin resistant (MRSA) and sensitive (MSSA) S. aureus species 1,2. The lytic phages have been converted into phage spheroids by contact with water-chloroform interface. Phage spheroid monolayers have been moved onto a biosensor surface by Langmuir-Blodgett (LB) technique 3. The created biosensors have been examined by a quartz crystal microbalance with dissipation tracking (QCM-D) to evaluate bacteria-phage interactions. Bacteria-spheroid interactions led to reduced resonance frequency and a rise in dissipation energy for both MRSA and MSSA strains. After the bacterial binding, these sensors have been further exposed to the penicillin-binding protein antibody latex beads. Sensors analyzed with MRSA responded to PBP 2a antibody beads; although sensors inspected with MSSA gave no response. This experimental distinction determines an unambiguous discrimination between methicillin resistant and sensitive S. aureus strains. Equally bound and unbound bacteriophages suppress bacterial growth on surfaces and in water suspensions. Once lytic phages are changed into spheroids, they retain their strong lytic activity and show high bacterial capture capability. The phage and phage spheroids can be utilized for testing and sterilization of antibiotic resistant microorganisms. Other applications may include use in bacteriophage therapy and antimicrobial surfaces.

Lytic phage biosensors and antibody beads are able to discriminate between methicillin resistant (MRSA) and sensitive staphylococcus bacteria. The phages were immobilized by a Langmuir-Blodgett method onto a surface of a quartz crystal microbalance sensor and worked as broad range staphylococcus probes. Antibody beads recognize MRSA.

Biosensor לאיתור של חיידקי סטפילוקוקוס עמידים לאנטיביוטיקה

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) ...

Sensing of Barrier Tissue Disruption with an Organic Electrochemical Transistor

The gastrointestinal tract is an example of barrier tissue that provides a physical barrier against entry of pathogens and toxins, while allowing the passage of necessary ions and molecules. A breach in this barrier can be caused by a reduction in the extracellular calcium concentration. This reduction in calcium concentration causes a conformational change in proteins involved in the sealing of the barrier, leading to an increase of the paracellular flux. To mimic this effect the calcium chelator ethylene glycol-bis(beta-aminoethyl ether)-N,N,N&#39;,N&#39;-tetra acetic acid (EGTA) was used on a monolayer of cells known to be representative of the gastrointestinal tract. Different methods to detect the disruption of the barrier tissue already exist, such as immunofluorescence and&#160;permeability assays. However, these methods are time-consuming and costly and not suited to dynamic or high-throughput measurements. Electronic methods for measuring barrier tissue integrity also exist for measurement of the transepithelial resistance (TER), however these are often costly and complex. The development of rapid, cheap, and sensitive methods is urgently needed as the integrity of barrier tissue is a key parameter in drug discovery and pathogen/toxin diagnostics. The organic electrochemical transistor (OECT) integrated with barrier tissue forming cells has been shown as a new device capable of dynamically monitoring barrier tissue integrity. The device is able to measure minute variations in ionic flux with unprecedented temporal resolution and sensitivity, in real time, as an indicator of barrier tissue integrity. This new method is based on a simple device that can be compatible with high throughput screening applications and fabricated at low cost.

The Organic Electrochemical Transistor is integrated with live cells and used to monitor ion flux across the gastrointestinal epithelial barrier. In this study, an increase in ion flux, related to disruption of tight junctions, induced by the presence of the calcium chelator EGTA (ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetra acetic acid), is measured.

חישה של שיבוש טישו גדר עם טרנזיסטור אלקטרוכימי אורגני

The gastrointestinal tract is an example of barrier tissue that provides a physical barrier against entry of pathogens and toxins, while allowing the ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Biochip אלקטרוכימי מבוסס Microfluidic לניתוח הכלאה DNA ללא תווית

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

Development of an In Vitro Ocular Platform to Test Contact Lenses

Currently, in vitro evaluations of contact lenses (CLs) for drug delivery are typically performed in large volume vials,1-6 which fail to mimic physiological tear volumes.7 The traditional model also lacks the natural tear flow component and the blinking reflex, both of which are defining factors of the ocular environment. The development of a novel model is described in this study, which consists of a unique 2-piece design, eyeball and eyelid piece, capable of mimicking physiological tear volume. The models are created from 3-D printed molds (Polytetrafluoroethylene or Teflon molds), which can be used to generate eye models from various polymers, such as polydimethylsiloxane (PDMS) and agar. Further modifications to the eye pieces, such as the integration of an explanted human or animal cornea or human corneal construct, will permit for more complex in vitro ocular studies. A commercial microfluidic syringe pump is integrated with the platform to emulate physiological tear secretion. Air exposure and mechanical wear are achieved using two mechanical actuators, of which one moves the eyelid piece laterally, and the other moves the eyeballeyepiece circularly. The model has been used to evaluate CLs for drug delivery and deposition of tear components on CLs.

Development of an In Vitro Ocular Platform to Test Contact Lenses

Current in vitro models for evaluating contact lenses (CLs) and other eye-related applications are severely limited. The presented ocular platform simulates physiological tear flow, tear volume, air exposure and mechanical wear. This system is highly versatile and can be applied to various in vitro analyses with CLs.

פיתוח של<em&gt; במבחנה</em&gt; פלטפורמת Ocular כדי לבדוק עדשות מגע

Currently, in vitro evaluations of contact lenses (CLs) for drug delivery are typically performed in large volume vials,1-6 which fail to mimic ...

The Use of a &#946;-lactamase-based Conductimetric Biosensor Assay to Detect Biomolecular Interactions

Biosensors are becoming increasingly important and implemented in various fields such as pathogen detection, molecular diagnosis, environmental monitoring, and food safety control. In this context, we used &#946;-lactamases as efficient reporter enzymes in several protein-protein interaction studies. Furthermore, their ability to accept insertions of peptides or structured proteins/domains strongly encourages the use of these enzymes to generate chimeric proteins. In a recent study, we inserted a single-domain antibody fragment into the Bacillus licheniformis BlaP &#946;-lactamase. These small domains, also called nanobodies, are defined as the antigen-binding domains of single chain antibodies from camelids. Like common double chain antibodies, they show high affinities and specificities for their targets. The resulting chimeric protein exhibited a high affinity against its target while retaining the &#946;-lactamase activity. This suggests that the nanobody and &#946;-lactamase moieties remain functional. In the present work, we report a detailed protocol that combines our hybrid &#946;-lactamase system to the biosensor technology. The specific binding of the nanobody to its target can be detected thanks to a conductimetric measurement of the protons released by the catalytic activity of the enzyme.

In this work, we report a new method to study protein-protein interactions using a conductimetric biosensor based on the hybrid &#946;-lactamase technology. This method relies on release of protons upon hydrolysis of &#946;-lactams.