We thank the collaborative efforts of Dr. Thao Dang and members of her lab for use of their imaging and microscope equipment. We also thank the Biorepository and Tissue Research Facility (BTRF) core, Jeff Harper, and the residents at the University of Virginia for providing us with uterine tissue. We thank Karol Szlachta for the help with Schematic Overview.

Hysterectomy specimens used in this manuscript were collected in concordance with a University IRB-approved ethics protocol numbered IRB-HSR #14424.
1. Sample Acquisition from Clinical Source
<ol>
	<li>Obtain government and institution-based ethical guidelines and approval documentation before beginning.</li>
	<li>Conduct all steps in sterile conditions.</li>
	<li>Preserve patient-derived tissue in media (RPMI or DMEM/High Glucose) in a 50 ml tube at 4 &#176;C if the sample cannot be processed in culture immediately. Samples can be stored in this state for a maximum of 24 hr.</li>
	<li>Wash tissue sample three times with 1X sterile phosphate buffered saline (PBS) and discard the solution between washes.</li>
</ol>
2. Preparation of Primary Cell Lines using the Scraping Method
<ol>
	<li>Add 4-10 ml of growth media (RPMI or DMEM/High Glucose supplemented with 10% Fetal Bovine Serum and 1% Penicillin-streptomycin) to tissue and add Fungizone (0.25 &#181;g/ml final concentration) for 30 min.</li>
	<li>Discard the growth media.</li>
	<li>Wash tissue twice with 1X PBS.</li>
	<li>Place the tissue on a 6 cm cell culture plate to distinguish between myometrium and endometrium layers (refer to Figures 2A-2C for further description). Separate the endometrium.</li>
	<li>Using a scalpel or razor blade, transect the tissue into small pieces while scratching onto the 6 cm cell culture dish. These scratches facilitate the attachment of the emerging primary endometrial cells. Compared to the trypsin method, more tissue is needed (see Figure 2D for an approximation).</li>
	<li>Gently, add 2 ml of growth media to scratched dish (tissue fragments will be visible and ideally immobilized from the scratching motion).</li>
	<li>Transfer the plate(s) to a designated cell culture incubator (37 &#176;C and 5% CO2). Designate a place for primary cell lines, away from other cell culture dishes. Primary cultures are more sensitive to infection and contamination.</li>
	<li>Examine the cells under a light microscope daily. Small populations of cells should emerge by day two or three from around the sliced tissues (see Figure 3B).</li>
	<li>To maintain cultures, wash gently with 1X PBS and add fresh growth media (2ml) every three days. When proliferation rate increases, additional growth media (3-4 ml) can be added to the 6 cm culture plate(s). 
	Note: During washing and media changes, pieces of tissue will likely be aspirated. This will not affect growth of adherent cells. Pieces of tissue should be aspirated by the subsequent step (2.10) as new colonies are unlikely to emerge after one week.</li>
	<li>When the 6 cm plate is approximately 75 - 80% confluent (see Figure 3B), passage using 0.05% trypsin. Primary cells cannot be passaged indefinitely - freeze down one plate of cells as soon as two or three plates are maintained. If more passages are required, follow an immortalization protocol (reviewed in Ref 3).</li>
</ol>
3. Preparation of Primary Cell Lines using the Trypsin Method
<ol>
	<li>Place a small piece of endometrial tissue (see Figure 2D for an approximation) in 2 ml of 0.25% trypsin supplemented with Kanamycin (0.03 mg/ml final concentration).</li>
	<li>Incubate tissue at 37 &#176;C on rotating platform for 30 min.</li>
	<li>Briefly vortex the tissue.</li>
	<li>Centrifuge the sample at 200-400 x g for 2 min&#160;and discard the supernatant.</li>
	<li>Add fresh trypsin and Kanamycin.</li>
	<li>Incubate the tissue at 37 &#176;C while rotating for an hr.</li>
	<li>Vortex the tissue for 5-10 sec.</li>
	<li>Add 2ml of growth media (supplemented with 10% Fetal Bovine Serum and 1% Penicillin-streptomycin) to deactivate the trypsin.</li>
	<li>Centrifuge cells at 200-400 x g for 2-3 min.</li>
	<li>Discard the supernatant and add 2 ml of growth media to the pelleted cells.</li>
	<li>Plate onto a 6 cm cell culture dish. Scraping the plate as in Step 2.5 of Preparing Primary Cell Lines using the Scraping Method is not necessary, but enhances the attachment and outgrowth of primary cultures.</li>
	<li>Monitor cells under a light microscope daily. Cells are usually visible under a light microscope after 24-48 hr&#160;(see Figure 3C).</li>
	<li>To maintain the cultures, monitor the cells and change media every 2-3 days as in Step 2.9.</li>
	<li>To passage the cells, use 0.05% or 0.25% Trypsin when cells reach 75-80% confluency (see Figure 3C).</li>
</ol>
4. Saving Extra Tissue for Analysis (Snap Freezing and Formalin Fixation)
<ol>
	<li>Wash sample twice with 1X PBS.</li>
	<li>Aspirate as much liquid as possible.</li>
	<li>For Snap Freezing, place endometrial tissue sample in a 1.7 centrifuge tube (see Figures 2F and 2G). Place the 1.7 centrifuge tube in liquid nitrogen for 10 sec&#160;or until it can be seen that the tissue has frozen down. 
	Note: Take care not to directly touch liquid nitrogen when preparing samples. Samples can be stored at -80 &#176;C until further processing or analysis.</li>
	<li>For formalin fixation, cut a small piece of endometrial tissue (see Figure 2H), and submerge in 10% buffered zinc formalin. After 24 hr, discard formalin and add 70% ethanol to tissue samples until further processing.</li>
</ol>
5. Immunofluorescence (IF)
<ol>
	<li>Cell fixation
	<ol>
		<li>Prepare cells on a culture slide or plate.</li>
		<li>Gently, wash cells with 1X PBS.</li>
		<li>Add pre-chilled (4 &#176;C) Methanol and Acetone (mixed at a 1:1 ratio) for 5 min.</li>
		<li>Air dry the slide before proceeding. Slide can be stored at 4 &#176;C for 1-2 weeks if needed.</li>
	</ol>
	</li>
	<li>Processing IF
	<ol>
		<li>Rehydrate cells with 1X PBS for 10 min. For the following Steps 1-6, conduct all washes and incubations on a rotating platform.</li>
		<li>Block using 1X PBS supplemented with 1% Bovine Serum Albumin (BSA) and 1% species specific serum (source of 2nd antibody) for 30 min&#160;at room temperature (RT).</li>
		<li>Incubate in primary antibody (see manufacturers recommendations for antibody dilutions). Refer to Materials for specific antibodies. Dilute the primary antibody in fresh blocking buffer as in Step 5.2.2. This incubation can be conducted for at least 2 hr&#160;at RT or overnight at 4 &#176;C.</li>
		<li>Wash 3 times with 1X PBS for 5 min&#160;each.</li>
		<li>Incubate in secondary antibody (see manufacturers recommendations for antibody dilutions). Dilute the secondary antibody in fresh blocking buffer as in Step 5.2.2. To prevent photo-bleaching, it is important to conduct this and subsequent steps in the absence of light.</li>
		<li>Wash 3 times with 1X PBS for 5 min&#160;each.</li>
		<li>Thoroughly dry the slides.</li>
		<li>Add mounting media and DAPI counterstaining solution.</li>
		<li>Apply coverslip and seal the edges using sealant(s). Slides can be stored at 4 &#176;C in the dark for up to 2 weeks.</li>
	</ol>
	</li>
</ol>
6. RNA Extraction
<ol>
	<li>Pellet 1 x 107 cells by centrifugation. All materials and reagents in this protocol should be RNAse free.</li>
	<li>Lyse cells in 1 ml TRIZOL reagent, and incubate the homogenized samples for 10 min&#160;at room temperature to complete dissociation of nucleoprotein complexes.</li>
	<li>Add 200 &#181;l of chloroform per 1 ml of TRIZOL. Shake vigorously by hand for 15 sec&#160;and incubate for 2-3 min&#160;at RT.</li>
	<li>Centrifuge at maximum speed (15,000 x g) for 15 min&#160;at 4 &#176;C. Three layers will result.</li>
	<li>Transfer the top aqueous phase into a fresh microcentrifuge tube. Add 1 &#181;l glycogen to increase the RNA yield; however, this step is only necessary when a small amount of RNA is anticipated.</li>
	<li>Add 0.5 ml of isopropyl alcohol to the aqueous layer, and invert the samples 3-5 times. Incubate samples at RT for 10 min. To increase yield, samples can be placed in -20 &#176;C or -80 &#176;C for 30 min.</li>
	<li>Centrifuge at maximum speed for 10 min&#160;at 4 &#176;C.</li>
	<li>At this point, a small pellet of RNA should be visible. Discard the supernatant.</li>
	<li>Wash the RNA with 1 ml of 75% ethanol.</li>
	<li>Centrifuge at maximum speed for 5 min&#160;and discard the supernatant. Samples can be washed once more to rid inorganic contaminants, but this step is not necessary.</li>
	<li>Briefly, dry the RNA pellet until RNA pellet is dry (usually takes 7-10 min). 
	Note: One additional step can be used to decrease inorganic matter and decrease drying time. After discarding the supernatant from the ethanol wash, spin samples at maximum speed for an additional minute and aspirate residual liquid. Take care not to aspirate pellet.</li>
	<li>Dissolve RNA in RNase-free water, depending on the size of the RNA pellet. Volumes typically range from 10-50 &#181;l.</li>
	<li>Incubate samples at 55 &#176;C for 10 min, and measure the concentration of RNA.</li>
	<li>Store samples at -20 &#176;C until further processing.</li>
</ol>
7. Reverse Transcription
<ol>
	<li>Bring the sample RNA (1-3 &#181;g) to a volume of 9 &#181;l with H2O.</li>
	<li>Heat RNA to 70 &#176;C for 10 min.</li>
	<li>To generate an AMV master mix, combine the following reagents: 5 &#181;l of dNTP (working concentration of 50 &#181;M), 5 &#181;l of N6 DNA oligos (working concentration of 80 &#181;M), 5 &#181;l of 5X AMV buffer, and 1 &#181;l of AMV. This master mix solution is designed per one sample.</li>
	<li>Add 16 &#181;l of the master mix to the heated RNA. The final reaction volume will be 25 &#181;l reaction.</li>
	<li>Use the following PCR conditions for reverse transcription: (Stage 1) 42 &#176;C for 90 min, (Stage 2) 95 &#176;C for 5 min, and (Stage 3) 4 &#176;C until further processing.</li>
</ol>
8. Real Time PCR
<ol>
	<li>Conduct PCR reactions using the primers, annealing temperatures, cycle numbers, and reagents found in Table 1. 
	Note: It is ideal to follow manufacturer instructions when using PCR reagents (refer to company and catalog numbers in Materials).</li>
</ol>
9. In vitro Decidualization Protocol (Derived from Ref 4 and 5)
<ol>
	<li>Plate endometrial cells.</li>
	<li>Grow to a confluency of 75-85%.</li>
	<li>After cells become confluent, wash once with 1X PBS.</li>
	<li>Quickly, add hormone-free media (Phenol free RPMI supplemented with 5% charcoal strip FBS and 1% Penicillin-streptomycin).</li>
	<li>After 24 hr, add hormone free media supplemented with medroxyprogesterone acetate (MPA) at a final concentration of 1 &#181;M and 8-bromoadenosine 3&#39;,5&#39;-cyclic monophosphate (cAMP) at a final concentration of 0.5 mM.</li>
	<li>After at least 48 hr, stop the reaction and save the plate(s) for further processing.</li>
</ol>

<ol>
	<li>Heller, D., Heller, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> in The endometrium: a clinicopathologic approach. , 56-75 (1994).</li><li>Emera, D., Romero, R., Wagner, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+menstruation:+a+new+model+for+genetic+assimilation:+explaining+molecular+origins+of+maternal+responses+to+fetal+invasiveness.">The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness.</a> Bioessays. 34, 26-35 (2011).</li><li>Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+protocols+used+in+cell+culture+models+of+human+breast+morphogenesis.">Immortalization protocols used in cell culture models of human breast morphogenesis.</a> Cell Mol Life Sci. 61, 2523-2534 (2004).</li><li>Brosens, J. J., Hayashi, N., White, J. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progesterone+receptor+regulates+decidual+prolactin+expression+in+differentiating+human+endometrial+stromal+cells.">Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells.</a> Endocrinology. 140, 4809-4820 (1999).</li><li>Jones, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+SUMO+pathway+sensitizes+differentiating+human+endometrial+stromal+cells+to+progesterone.">Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone.</a> Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).</li><li>Salamonsen, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+the+human+endometrium+and+uterine+fluid:+a+pathway+to+biomarker+discovery.">Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery.</a> Fertil Steril. 99, 1086-1092 (2013).</li><li>Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+human+endometrial+receptivity+from+transcriptomic+and+proteomic+data.">Insights into human endometrial receptivity from transcriptomic and proteomic data.</a> Reprod Biomed Online. 24, 23-34 (2012).</li><li>Chen, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+characterization+of+midproliferative+and+midsecretory+human+endometrium.">Proteomic characterization of midproliferative and midsecretory human endometrium.</a> J Proteome Res. 8, 2032-2044 (2009).</li><li>Talbi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+phenotyping+of+human+endometrium+distinguishes+menstrual+cycle+phases+and+underlying+biological+processes+in+normo-ovulatory+women.">Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women.</a> Endocrinology. 147, 1097-1121 (2006).</li><li>Punyadeera, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oestrogen-modulated+gene+expression+in+the+human+endometrium.">Oestrogen-modulated gene expression in the human endometrium.</a> Cell Mol Life Sci. 62, 239-250 (2005).</li><li>Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+human+endometrium+during+the+menstrual+cycle.">Molecular profiling of human endometrium during the menstrual cycle.</a> Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).</li><li>Zhang, L., Rees, M. C., Bicknell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+isolation+and+long-term+culture+of+normal+human+endometrial+epithelium+and+stroma.+Expression+of+mRNAs+for+angiogenic+polypeptides+basally+and+on+oestrogen+and+progesterone+challenges.">The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges.</a> J Cell Sci. 108 (1), 323-331 (1995).</li><li>Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblast+cells+from+term+human+decidua+closely+resemble+endometrial+stromal+cells:+induction+of+prolactin+and+insulin-like+growth+factor+binding+protein-1+expression).">Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression).</a> Biol Reprod. 52, 609-615 (1995).</li><li>Gellersen, B., Brosens, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+AMP+and+progesterone+receptor+cross-talk+in+human+endometrium:+a+decidualizing+affair.">Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair.</a> J Endocrinol. 178, 357-372 (2003).</li><li>Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+characterization+of+endothelin+released+by+human+endometrial+epithelial+cells+in+culture.">Production and characterization of endothelin released by human endometrial epithelial cells in culture.</a> J Clin Endocrinol Metab. 79, 1625-1631 (1994).</li><li>Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histochemical+identification+of+cultured+cells+from+human+endometrium.">Histochemical identification of cultured cells from human endometrium.</a> In Vitro. 20, 25-32 (1984).</li><li>Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase+production+by+cultured+human+endometrial+stromal+cells:+identification+of+interstitial+collagenase,+gelatinase-A,+gelatinase-B,+and+stromelysin-1+and+their+differential+regulation+by+interleukin-1+alpha+and+tumor+necrosis+factor-alpha.">Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha.</a> J Clin Endocrinol Metab. 79, 530-536 (1994).</li><li>Dimitriadis, E., Robb, L., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin+11+advances+progesterone-induced+decidualization+of+human+endometrial+stromal+cells.">Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 8, 636-643 (2002).</li><li>Sakai, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+histone+acetylation+in+ovarian+steroid-induced+decidualization+of+human+endometrial+stromal+cells.">Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells.</a> J Biol Chem. 278, 16675-16682 (2003).</li><li>Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cyclic+AMP+and+estrogen/progesterone+on+the+transcription+of+DNA+methyltransferases+during+the+decidualization+of+human+endometrial+stromal+cells.">Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 19, 302-312 (2013).</li><li>Tamura, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+IGFBP-1+expression+by+cAMP+is+associated+with+histone+acetylation+status+of+the+promoter+region+in+human+endometrial+stromal+cells.">Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells.</a> Endocrinology. 153, 5612-5621 (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> American Society for Reproductive Medicine: Quick facts about infertility. , (2013).</li><li>Salker, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+selection+of+human+embryos:+impaired+decidualization+of+endometrium+disables+embryo-maternal+interactions+and+causes+recurrent+pregnancy+loss.">Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss.</a> PLoS One. 5, (2010).</li></ol>

The authors have nothing to disclosure.

Other groups have described and adapted methodology for the preparation of endometrial stromal cultures, most of which utilize collagenase&#160;4,12,13,15-18. In this manuscript, we have provided methodology and evidence for two simplified primary endometrial stromal culture methods, both of which are utilized by our lab for economical reasons and the convenient availability of trypsin and/or a razor blade.
When comparing our two methods, both successfully generate viable primary cultures. Our preferred method is the trypsin method as there is typically a higher yield with a smaller sample size requirement. However, if preparation time is limited, the scraping method requires 30 minutes whereas plating cells using the trypsin method takes more than an hour and a half.
Also noteworthy is that we demonstrate these methods with hysterectomy samples as opposed to endometrial biopsies. Endometrial biopsies are taken without significant intrusion and tend to produce smaller specimens. Still, the methods described in this manuscript (especially the trypsin method) should yield cultures from endometrial biopsies.
There are numerous applications for primary endometrial stromal cells. Comparing endometrial stromal cultures from human versus other mammals may provide clues to the questions that have been debated for centuries about why humans menstruate. There are other unexplored physiology studies that require in vitro culture. Of particular interest are the discoveries that provide insights into reproductive cycle events such as the findings that have linked epigenetic molecular events to the functional events of the reproductive cycle&#160;19,20,21, and reviewed in Ref&#160;11.
Clinicians would benefit greatly from studying endometrial stromal culture and identifying biomarkers in the instances of reproductive disorders and cancer malignancies. Between 2006 and 2010, it was reported that 7.4 million women and their partners used infertility services in the United States&#160;22. A significant percent of infertility is due to failure of decidualization&#160;23. Moreover, the relationship between endometrial diseases such as hyperplasia and endometriosis to infertility is only recently being assessed. The capacity to study uterine gynecological cancers through in vitro modeling is also invaluable because even though advanced endometrial sarcoma is rare, it can be lethal. By establishing in vitro primary cultures, we study the impact of the molecular events associated with the diseases and can generate putative clinical applications.
In conclusion, generating representative and efficacious in vivo models for many of these applications is difficult. This makes the development of in vitro primary endometrial cultures to study several in vivo functions critical. These two endometrial isolation methods, &#8220;the scraping method&#8221; and &#8220;the trypsin method,&#8221; will help provide the foothold for our understanding of endometrial physiology and pathology.&#160;&#160;

The human uterus corpus is comprised of three layers, the perimetrium (or serosa), the myometrium, and the endometrium. Distinguishing each of these layers is an important step to establish endometrial cell lines. The perimetrium is the outer most layer of the uterus and composed of thin, serous cells. The myometrium is the thick, middle layer of the uterus and comprised of smooth muscle cells. The endometrium is identified as the inner layer of the uterus and includes epithelial and stromal cell populations.
The endometrium is further subdivided into the basalis layer whose stem cell population is hypothesized to repopulate the functionalis layer approximately every 28 days&#160;1. The functionalis layer of the human endometrium undergoes significant biochemical and morphological changes in response to circulating hormones. These hormones are derived from the pituitary gland and the ovaries.
The coordinated production and release of hormones results in a reproductive cycle. The reproductive cycle is designed to prepare the endometrium for potential embryo implantation events. In humans, the reproductive cycle is known as &#8220;the menstrual cycle&#8221; and divided into three phases &#8211; proliferative, secretory, and menstrual. The proliferative phase involves the proliferation of the functionalis endometrial layer whereas the secretory phase is marked by functionalis maturation. Specifically, extracellular alterations, secretions, and cellular differentiation signal a potential implantation. If implantation does not occur before the end of the secretory phase, the functionalis endometrial layer is shed during the menstrual phase. The importance of menstruation and the events that trigger the shedding of the functionalis layer are still being debated. In humans, it has been posed that menstruation is the result of a specific mid-secretory phase differentiation event known as &#8220;spontaneous decidualization&#8221;&#160;2. In this manuscript, we provide detailed methodology for both endometrial stromal cell isolation methods, and use a combination of immunofluorescence and digital images to demonstrate efficacy of these approaches. In addition, we apply a commonly used in vitro model of spontaneous decidualization to confirm endometrial stromal cell isolation.

<table border="0" cellpadding="0" cellspacing="0" width="713">
	<tbody>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">0.25 Trypsin or 0.05% Trypsin&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH3023602 or SH30004202&#160;&#160;</td>
			<td style="width:63px;"></td>
		</tr>
		<tr height="27">
			<td dir="LTR" height="27" style="height:27px;width:235px;">1.7 micro Centrifuge Tube&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">22-272A&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">1&#181;l,20&#181;l, 200ml and 1000&#181;l Pipette&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">24-401,24-402, 24-412, 24-430&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">15ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339650</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">50ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339652</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">6cm Cell Culture Dish&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-556-002&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">8 well Chambers&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Acetate&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher scientific&#160;</td>
			<td dir="LTR" style="width:216px;">C4-100&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">AMV RT Enzyme/Buffer&#160;</td>
			<td dir="LTR" style="width:201px;">Bio Labs&#160;</td>
			<td dir="LTR" style="width:216px;">M077L&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Bovine Serum Albumin (BSA)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-1605-100&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Buffered Zinc Formalin&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">59201ZF&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Charcoal strip FBS&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher&#160;</td>
			<td dir="LTR" style="width:216px;">NC9019735&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Chloroform&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP1145-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cover slip&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Brand&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-544D&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cyclic AMP (cAMP)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">B7880</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">DMEM/High Glucose&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH30243FS&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">dNTP&#160;</td>
			<td dir="LTR" style="width:201px;">Bioline&#160;</td>
			<td dir="LTR" style="width:216px;">BIO-39025&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Anti Goat -TRITC&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-3855&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Serum&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s lab&#160;</td>
			<td dir="LTR" style="width:216px;">&#160;017-000-002&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">E Cadherin Antibody&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">1702-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Ethanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">BP2818-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific</td>
			<td dir="LTR" style="width:216px;">03-600-511&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fungizone Amphotericin B&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">15290-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">GAPDH Probe&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">HS99999905&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Glycogen&#160;</td>
			<td dir="LTR" style="width:201px;">5Prime&#160;</td>
			<td dir="LTR" style="width:216px;">2301440</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Goat Anti Mouse -FITC&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s Lab&#160;</td>
			<td dir="LTR" style="width:216px;">115-096-003&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Isopropanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP2618-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Kanamycin&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP906-5&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Medroxyprogesterone acetate (MPA)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">M1629</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">MeOH (Methanol)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">A4-08-1&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Mounting Media (w/DAPI)&#160;</td>
			<td dir="LTR" style="width:201px;">Vector Labratories&#160;</td>
			<td dir="LTR" style="width:216px;">H-1500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">N6 DNA Oligos&#160;</td>
			<td dir="LTR" style="width:201px;">Invitrogen&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Number 15 Scraper&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">BD&#160;</td>
			<td dir="LTR" style="width:216px;">371615</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Pan Cytokeratin&#160; Mouse mAB&#160;</td>
			<td dir="LTR" style="width:201px;">Cell Signaling&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">4545</td>
			<td></td>
		</tr>
		<tr height="29">
			<td dir="LTR" height="29" style="height:29px;width:235px;">PBS (phosphate buffered saline)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-399-4&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Penicillin-Streptomycin Glutamine Solution 100X&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SV30082.01&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">PML Anti Goat Anti body&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-9862&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Primer(s)&#160;</td>
			<td dir="LTR" style="width:201px;">Eurofins&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SH30027FS&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI (Phenol free)&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">11835</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Sybr Green&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Taqman&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4138</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Trizol&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">15596018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Vimentin Antibody&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">4211-1</td>
			<td></td>
		</tr>
	</tbody>
</table>

two methods for establishing primary human endometrial stromal cells from hysterectomy specimens

Many efforts have been devoted to establish in vitro cell culture systems. These systems are designed to model a vast number of in vivo processes. Cell culture systems arising from human endometrial samples are no exception. Applications range from normal cyclic physiological processes to endometrial pathologies such as gynecological cancers, infectious diseases, and reproductive deficiencies. Here, we provide two methods for establishing primary endometrial stromal cells from surgically resected endometrial hysterectomy specimens. The first method is referred to as &#8220;the scraping method&#8221; and incorporates mechanical scraping using surgical or razor blades whereas the second method is termed &#8220;the trypsin method.&#8221; This latter method uses the enzymatic activity of trypsin to promote the separation of cells and primary cell outgrowth. We illustrate step-by-step methodology through digital images and microscopy. We also provide examples for validating endometrial stromal cell lines via quantitative real time polymerase chain reactions (qPCR) and immunofluorescence (IF).

As emphasized in the Protocol section, be sure to conduct all methods under government, institutional, and ethical guidelines when handling and preparing human tissue.
Included in this manuscript is an illustration of the general workflow of "the scraping method" (Figure 1A) and "the trypsin method" (Figure 1B) used to establish primary endometrial cultures. These methods are described in detail in the Protocol section (see parts&#160;1. - 3.). Both methods prove successful in the growth of primary endometrial cultures. The advantage to "the scraping method" is the shortened preparation time; however, the time it takes to observe viable cells is usually 2 - 4 times longer compared to "the trypsin method."
Provided are digital images of the initial human tissue received from tissue procurement. The uterine layers can be distinguished by the coarseness of the layer, i.e. the myometrium is thick and muscular and the endometrium is thin and more yielding. We have highlighted the thick, smooth muscle layer (myometrium) in white and outlined the endometrial layer of interest in black from two different hysterectomy samples (Figures 2A and 2B). In Figure 2C, tissues are oriented with the myometrium facing up while the endometrium is positioned down. The thin, perimetrial layer was surgically resected and not highlighted in these images. It is also important to note that the size of the endometrial layer in these digital 2-dimensional images is misrepresented as the actual 3-dimensional layer is very thin compared to the myometrium.
Cutting the appropriate tissue size is important for both "the scraping method" and "the trypsin method." In Figure 2D, appropriate sizes are designated for each method above the respective sample. Using one 0.5x0.5x0.5 cm piece for "the trypsin method" [left] is sufficient for establishing a culture. The representative starting tissue for "the scraping method" [right] includes all uterine layers. The final product for "the scraping method" is represented in Figure 2E, and it is recommended that at least 1x1x1 cm of endometrial tissue be used to establish viable cultures. The requirement for this much tissue sample is a disadvantage of "the scraping method."
Remaining tissue is often used in numerous ways including protein and RNA analyses. To ensure preservation of tissue quality, it is important to use a "snap freezing" method as in the Protocol section (see 4.). This method is also illustrated in Figure 2F and Figure 2G. Saving extra tissue by formalin fixation is also a common practice of pathologists and researchers. Preparing tissue for formalin fixation is described in the Protocol section (see 4.) and illustrated in Figure 2H.
Light microscopy is essential for monitoring primary endometrial cultures. Individual endometrial stromal cells should exhibit fibroblast morphology (Figure 3A). "The scraping method" typically generates clusters of early emerging cells, primarily along scalpel-induced scratches (Figure 3B, Day 2). "The trypsin method" generates both cluster and dispersed cell growth patterns (Figure 3C, Day 4). We have included several representative images from the initial plating (day 0) to the first passage of each method (Figure 3B and 3C).
Many tissues are defined by their expression of tissue-specific markers such as smooth muscle actin (SMA) for smooth muscle, CD34 for immune stem cells, etc. While gene and protein expression experiments have been conducted for the endometrium&#160;6-11, an endometrial stromal cell specific marker has yet to be discovered. Instead, researchers commonly assess endometrial stroma purity by measuring markers from potential cell contaminants. For example, cytokeratin markers are used to show epithelial populations. However, it is less of a concern, because establishing and maintaining endometrial epithelia are difficult and usually selected against (Ref 12 and Figure 4A). If samples were to be obtained during pregnancy, positive expression of HLA-A, -B, -C demonstrates germ, trophoblast cells&#160;13. On the other hand, like other mesenchymal fibroblasts, endometrial stromal cells express vimentin (CDH1). We demonstrate with immunofluorescence, the expression of vimentin and the absence of cytokeratin and E cadherin (CDH1) in our established endometrial stromal cells (Figure 4B).
Finally, we provide functional evidence of primary endometrial culture via an in vitro spontaneous decidualization assay. This method was adapted from Ref 4&#160;and 5, and involves treatment of cultures with a combination of Medroxyprogesterone acetate (MPA) and 8- bromoadenosine 3&#8217;,5&#8217;-cyclic monophosphate (cAMP) (described in 9. In vitro Decidualization Protocol and modeled in Figure 5A). In the presence of MPA and cAMP, endometrial stromal cells exhibit significantly altered gene expression profiles (reviewed in Ref&#160;14). The frequently published spontaneous decidualization markers are Prolactin (PRL) and Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (reviewed in Ref 14). The response of these two genes to MPA and cAMP are strong indicators of both spontaneous decidualization and successful establishment of an endometrial stromal culture. We demonstrate this in Figure 5B.
<img alt="Figure 1" fo:content-width="5in" src="/files/ftp_upload/51513/51513fig1highres.jpg" width="500" /> 
Figure 1. Schematic of the two primary endometrial isolation methods. (A) Steps 2.1-2.10 of the scraping method displayed in an organization chart. (B) Steps 3.1-3.14 of the trypsin method displayed in an organization chart. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig1highres.jpg" target="_blank">Click here to view larger image.</a>
<img alt="Figure 2" fo:content-width="2.75in" src="/files/ftp_upload/51513/51513fig2highres.jpg" width="500" /> 
Figure 2. Processing uterine tissue. (A-C) Clinical uterine samples from two female patients. A &#38; C are derived from Patient 1 and B is derived from Patient 2. Surgically resected uterine tissue (left) and highlighted uterine layers (right). (A &#38; B) The myometrium is circled in white and the endometrium in black. (C) The myometrium is facing the camera. (D) Initial representative endometrial sample sizes for both isolation methods are indicated. The trypsin method requires pure endometrium before addition of the trypsin whereas the scraping method can uses the entire uterine specimens. (E) Example of the processed endometrial sample of the scraping method. (F &#38; G) Image of remaining uterine tissue being prepared for Snap Freezing. Shown is a lab-made metal container utilized for this method. (H) Formalin fixation of endometrial sample. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig2highres.jpg" target="_blank">Click here to view larger image.</a>
<img alt="Figure 3" fo:content-width="3in" src="/files/ftp_upload/51513/51513fig3highres.jpg" width="400" /> 
Figure 3. Light microscopy images of primary endometrial cultures. (A) Representative images of endometrial stromal cell cultures taken at various powers and confluency. (B) Representative images of the scraping method (Days 0 - 16) taken of the same culture dish, powered at 10x. Note: Visual lines indicate scratches from surgical blade. (C) Representative images of the trypsin method (Days 0 - 16) taken of the same culture dish, powered at 10x. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig3highres.jpg" target="_blank">Click here to view larger image.</a>
<img alt="Figure 4" fo:content-width="4in" src="/files/ftp_upload/51513/51513fig4highres.jpg" width="400" /> 
Figure 4. Immunofluorescence images of endometrial stromal cells. (A) Immunofluorescence of primary endometrial cultures isolated via the scraping method. Images demonstrate loss of cytokeratin between passage 2 (P2) and passage 5 (P5). Promyelocytic leukemia protein (PML) nuclear protein and DAPI staining were used as controls. (B) Images demonstrate positive staining for the mesenchymal marker Vimentin. Images also show negative staining for E cadherin (CDH1) and Cytokeratin. Staining for DAPI and Promyelocytic leukemia protein (PML) were provided as controls. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig4highres.jpg" target="_blank">Click here to view larger image.</a>
<img alt="Figure 5" fo:content-width="5in" src="/files/ftp_upload/51513/51513fig5highres.jpg" width="500" /> 
Figure 5. Spontaneous decidualization of two primary endometrial stromal cells. (A) Outline of experimental procedure. (B) Upregulation of Prolactin (PRL) and Insulin-like Growth Factor Binding Protein 1 (IGFBP1) gene expression in response to MPA and cAMP. Results were measured via RT-qPCR, and expression was normalized to GAPDH. Significance was calculated using students t-test (P &#60; 0.001 *** and P &#60; 0.0001 ****). Both cell lines were isolated using the scraping method. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig5highres.jpg" target="_blank">Click here to view larger image.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence</td>
			<td>Annealing Temperature (&#176;C)</td>
			<td>Cycles</td>
			<td>Assay</td>
		</tr>
		<tr>
			<td>Prolactin (PRL) Forward</td>
			<td>CATATTGCGATCCTGGAATGAGC</td>
			<td>60</td>
			<td>40</td>
			<td>Sybrgreen</td>
		</tr>
		<tr>
			<td>Prolactin (PRL) Reverse</td>
			<td>TCCTCAATCTCTACAGCTTTGGA</td>
			<td>60</td>
			<td>40</td>
			<td>Sybrgreen</td>
		</tr>
		<tr>
			<td>Insulin-like growth factor binding protein 1 (IGFBP1) Forward</td>
			<td>TCCTTTGGGACGCCATCAGTAC</td>
			<td>60</td>
			<td>40</td>
			<td>Sybrgreen</td>
		</tr>
		<tr>
			<td>Insulin-like growth factor binding protein 1 (IGFBP1) Reverse</td>
			<td>GATGTCTCCTGTGCCTTGGCTA</td>
			<td>60</td>
			<td>40</td>
			<td>Sybrgreen</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td>Unspecified (see reagent list)</td>
			<td>60</td>
			<td>40</td>
			<td>Taqman</td>
		</tr>
	</tbody>
</table>
Table 1. PCR conditions for decidualization markers.

Watch this Scientific Journal Video about Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens at JoVE.com

Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Establishing primary endometrial stromal cell culture systems from hysterectomy specimens is a valuable biological technique and a crucial step prior to pursuing a vast array of research aims. Here, we describe two methods used to establish stromal cultures from surgically resected endometrial tissues of human patients.&#160;

Many efforts have been devoted to establish in vitro cell culture systems. These systems are designed to model a vast number of in vivo processes. Cell ...

two-methods-for-establishing-primary-human-endometrial-stromal-cells

Nanyang Technological University

Research

JoVE Journal

Medicine

22.6K Views.  University of Virginia. Establishing primary endometrial stromal cell culture systems from hysterectomy specimens is a valuable biological technique and a crucial step prior to pursuing a vast array of research aims. Here, we describe two methods used to establish stromal cultures from surgically resected endometrial tissues of human patients. 

Video: Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Mammary Transplantation of Stromal Cells and Carcinoma Cells in C57BL/6J Mice

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular through transplantation of stromal cells and epithelial cells in the mammary gland of mice. Current transplantation models often involve the use of immunocompromised mice due to the different genetic backgrounds of stromal cells and epithelial cells. Extracellular matrices are often used to embed the two different cell types for consistent cell-cell interactions, but involve the use of Matrigel or rat tail collagen, which are immunogenic substrates. The lack of functional T cells from immunocompromised mice prevents accurate assessment of stromal cells on mammary tumor progression in vivo, with important implications on drug development and efficacy. Moreover, immunocompromised mice are costly, hard to breed and require special care conditions. To overcome these obstacles, we have developed an approach to orthotopically transplant stromal cell and epithelial cells into mice from the same genetic background to induce consistent tumor formation. This system involves harvesting normal, carcinoma associated fibroblasts, PyVmT mammary carcinoma cells and collagen from donor C57BL/6J mice. The cells are then embedded in collagen and transplanted in the inguinal mammary glands of female C57BL/6J mice. Transplantation of PyVmT cells alone form palpable tumors 30-40 days post transplantation. Endpoint analysis at 60 days indicates that co-transplantation with fibroblasts enhances mammary tumor growth compared to PyVmT cells transplanted alone. While cells and matrix from C57BL/6J mice were used in these studies, the isolation of cells and matrix and transplantation approach may be applied towards mice from different genetic backgrounds demonstrating versatility. In summary, this system may be used to investigate molecular interactions between stromal cells and epithelial cells, and overcomes critical limitations in immunocompromised mouse models.

In this report, we demonstrate a system to isolate and culture donor cells from the mouse mammary gland, and orthotopically transplant these cells in recipient mice to analyze stromal: epithelial interactions during mammary tumor development.

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of extracellular matrix (ECM) and a variety of mesenchymal cells, including fibroblasts, myofibroblasts, endothelial cells, pericytes and leukocytes 1-3.
The tumour-associated stroma is responsive to substantial paracrine signals released by neighbouring carcinoma cells. During the disease process, the stroma often becomes populated by carcinoma-associated fibroblasts (CAFs) including large numbers of myofibroblasts. These cells have previously been extracted from many different types of human carcinomas for their in vitro culture. A subpopulation of CAFs is distinguishable through their up-regulation of &alpha;-smooth muscle actin (&alpha;-SMA) expression4,5. These cells are a hallmark of 'activated fibroblasts' that share similar properties with myofibroblasts commonly observed in injured and fibrotic tissues 6. The presence of this myofibroblastic CAF subset is highly related to high-grade malignancies and associated with poor prognoses in patients.
Many laboratories, including our own, have shown that CAFs, when injected with carcinoma cells into immunodeficient mice, are capable of substantially promoting tumourigenesis 7-10. CAFs prepared from carcinoma patients, however, frequently undergo senescence during propagation in culture limiting the extensiveness of their use throughout ongoing experimentation. To overcome this difficulty, we developed a novel technique to experimentally generate immortalised human mammary CAF cell lines (exp-CAFs) from human mammary fibroblasts, using a coimplantation breast tumour xenograft model.
In order to generate exp-CAFs, parental human mammary fibroblasts, obtained from the reduction mammoplasty tissue, were first immortalised with hTERT, the catalytic subunit of the telomerase holoenzyme, and engineered to express GFP and a puromycin resistance gene. These cells were coimplanted with MCF-7 human breast carcinoma cells expressing an activated ras oncogene (MCF-7-ras cells) into a mouse xenograft. After a period of incubation in vivo, the initially injected human mammary fibroblasts were extracted from the tumour xenografts on the basis of their puromycin resistance 11.
We observed that the resident human mammary fibroblasts have differentiated, adopting a myofibroblastic phenotype and acquired tumour-promoting properties during the course of tumour progression. Importantly, these cells, defined as exp-CAFs, closely mimic the tumour-promoting myofibroblastic phenotype of CAFs isolated from breast carcinomas dissected from patients. Our tumour xenograft-derived exp-CAFs therefore provide an effective model to study the biology of CAFs in human breast carcinomas. The described protocol may also be extended for generating and characterising various CAF populations derived from other types of human carcinomas.

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Carcinoma-associated fibroblasts (CAFs) rich in myofibroblasts present within the tumour stroma, play a major role in driving tumour progression. We developed a coimplantation tumour xengraft model for experimentally generating CAFs from human mammary fibroblasts. The protocol describes how to establish CAF myofibroblasts that acquire an ability to promote tumourigenesis.

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Repair of a Critical-sized Calvarial Defect Model Using Adipose-derived Stromal Cells Harvested from Lipoaspirate

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. Adipose-derived stromal cells (ASCs) have proven to be an abundant source of multipotent stem cells capable of undergoing osteogenic, chondrogenic, adipogenic, and myogenic differentiation. Many studies have explored the osteogenic potential of these cells in vivo with the use of various scaffolding biomaterials for cellular delivery. It has been demonstrated that by utilizing an osteoconductive, hydroxyapatite-coated poly(lactic-co-glycolic acid) (HA-PLGA) scaffold seeded with ASCs, a critical-sized calvarial defect, a defect that is defined by its inability to undergo spontaneous healing over the lifetime of the animal, can be effectively show robust osseous regeneration. This in vivo model demonstrates the basis of translational approaches aimed to regenerate the bone tissue - the cellular component and biological matrix. This method serves as a model for the ultimate clinical application of a progenitor cell towards the repair of a specific tissue defect.

This protocol describes the isolation of adipose-derived stromal cells from lipoaspirate and the creation of a 4 mm critical-sized calvarial defect to evaluate skeletal regeneration.

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Improved Protocol For Laser Microdissection Of Human Pancreatic Islets From Surgical Specimens

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected cells can be used for a variety of investigations, such as transcriptomic or proteomic studies, DNA assessment or chromosomal analysis 2,3. An especially challenging application of LMD is transcriptome analysis, which, due to the lability of RNA 4, can be particularly prominent when cells are dissected from tissues that are rich of RNases, such as the pancreas. A microdissection protocol that enables fast identification and collection of target cells is essential in this setting in order to shorten the tissue handling time and, consequently, to ensure RNA preservation. 
Here we describe a protocol for acquiring human pancreatic beta cells from surgical specimens to be used for transcriptomic studies 5. Small pieces of pancreas of about 0.5-1 cm3 were cut from the healthy appearing margins of resected pancreas specimens, embedded in Tissue-Tek O.C.T. Compound, immediately frozen in chilled 2-Methylbutane, and stored at -80 &deg;C until sectioning. Forty serial sections of 10 &mu;m thickness were cut on a cryostat under a -20 &deg;C setting, transferred individually to glass slides, dried inside the cryostat for 1-2 min, and stored at -80 &deg;C. 
Immediately before the laser microdissection procedure, sections were fixed in ice cold, freshly prepared 70% ethanol for 30 sec, washed by 5-6 dips in ice cold DEPC-treated water, and dehydrated by two one-minute incubations in ice cold 100% ethanol followed by xylene (which is used for tissue dehydration) for 4 min; tissue sections were then air-dried afterwards for 3-5 min. Importantly, all steps, except the incubation in xylene, were performed using ice-cold reagents - a modification over a previously described protocol 6. utilization of ice cold reagents resulted in a pronounced increase of the intrinsic autofluorescence of beta cells, and facilitated their recognition. For microdissection, four sections were dehydrated each time: two were placed into a foil-wrapped 50 ml tube, to protect the tissue from moisture and bleaching; the remaining two were immediately microdissected. This procedure was performed using a PALM MicroBeam instrument (Zeiss) employing the Auto Laser Pressure Catapulting (AutoLPC) mode. The completion of beta cell/islet dissection from four cryosections required no longer than 40-60 min. Cells were collected into one AdhesiveCap and lysed with 10 &mu;l lysis buffer. Each single RNA specimen for transcriptomic analysis was obtained by combining 10 cell microdissected samples, followed by RNA extraction using the Pico Pure RNA Isolation Kit (Arcturus). This protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their rapid and accurate recognition and collection. Further improvement of this procedure could enable the dissection of phenotypically different beta cells, with possible implications for better understanding the changes associated with type 2 diabetes.

Laser microdissection is a technique that allows the recovery of selected cells from minute amounts of parenchyma. Here we describe a protocol for acquiring human pancreatic islets from surgical specimens to be used for transcriptomic studies. Our protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their collection.

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected ...

Transcriptomic Analysis of Human Retinal Surgical Specimens Using jouRNAl

Retinal detachment (RD) describes a separation of the neurosensory retina from the retinal pigmented epithelium (RPE). The RPE is essential for normal function of the light sensitive neurons, the photoreceptors. Detachment of the retina from the RPE creates a physical gap that is filled with extracellular fluid. RD initiates cellular and molecular adverse events that affect both the neurosensory retina and the RPE since the physiological exchange of ions and metabolites is severely perturbed. The consequence for vision is related to the duration of the detachment since a rapid reapposition of the two tissues results in the restoration of vision 1. The treatment of RD is exclusively surgical. Removal of vitreous gel (vitrectomy) is followed by the removal non essential part of the retina around the detached area to favor retinal detachment. The removed retinal specimens are res nullius (nothing) and consequently normally discarded. To recover RNA from these surgical specimens, we developed the procedure jouRNAl that allows RNA conservation during the transfer from the surgical block to the laboratory. We also standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for global gene expression analysis. The quality of the RNA was validated both by RT-PCR and microarray analysis. Analysis of the data shows a simultaneous involvement of inflammation and photoreceptor degeneration during RD.

We used retinal samples from retinectomy for a transcriptomic analysis of retinal detachment. We developed a procedure that allows RNA conservation between the surgical blocks and the laboratory. We standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for microarray analysis.

Retinal detachment (RD) describes a separation of the neurosensory retina  from the retinal pigmented epithelium (RPE). The RPE is essential for normal  ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

A Novel Clinical Grade Isolation Method for Human Kidney Perivascular Stromal Cells

Mesenchymal Stromal Cells (MSCs) are tissue homeostatic and immune modulatory cells that have shown beneficial effects in kidney diseases and transplantation. Perivascular Stromal Cells (PSCs) share characteristics with bone marrow MSCs (bmMSCs). However, they also possess, most likely due to local imprinting, tissue-specific properties and play a role in local tissue homeostasis. This tissue specificity may result in tissue specific repair, also within the human kidney. We previously showed that human kidney PSCs (kPSCs) have enhanced kidney epithelial wound healing whereas bmMSCs did not have this potential. Moreover, kPSCs can ameliorate kidney injury in vivo. Therefore, kPSCs constitute an interesting source for cell therapy, particularly for kidney diseases and renal transplantation. Here we show the detailed isolation and culture method for kPSCs from transplant-grade human kidneys based on whole-organ perfusion of digestive enzymes via the renal artery and enrichment for the perivascular marker NG2. In this way, large cell quantities can be obtained that are suitable for cellular therapy.

Here we present a novel clinical grade isolation and culture method for kidney Perivascular Stromal Cells (kPSCs) based on whole organ perfusion with digestive enzymes and NG2-cell enrichment. With this method, it is possible to acquire sufficient cell numbers for cellular therapy.