Ringraziamo gli sforzi di collaborazione del Dr. Thao Dang ed i membri del suo laboratorio per l&#39;uso delle loro apparecchiature di imaging e microscopio. Ringraziamo anche il Biorepository e Tissue Research Facility (BTRF) nucleo, Jeff Harper, ei residenti presso l&#39;Università della Virginia per averci fornito con il tessuto uterino. Ringraziamo Karol Szlachta per l&#39;aiuto con schematica panoramica.

I campioni isterectomia utilizzati in questo manoscritto sono stati raccolti in concordanza con un protocollo di etica dell&#39;Università IRB approvato numerato IRB-HSR # 14424. 1. Acquisizione di esempio da Fonte clinica <ol><li> Ottenere governo e orientamenti etici basata sulle istituzioni e la documentazione approvazione prima dell&#39;inizio. </li><li> Eseguire tutti i passaggi condizioni sterili. </li><li> Preservare il tessuto derivato dal paziente nei media (RPMI o DMEM / Alto glucosio) in un tubo da 50 ml a 4 ° C, se il campione non può essere elaborata nella cultura immediatamente. I campioni possono essere conservati in questo stato per un massimo di 24 ore. </li><li> Lavare campione di tessuto tre volte con 1X sterile tampone fosfato (PBS) e scartare la soluzione tra i lavaggi. </li></ol> 2. Preparazione di linee cellulari primarie che utilizzano il metodo raschio <ol><li> Aggiungere 4-10 ml di terreno di coltura (RPMI o DMEM / Alto glucosio supplementato con 10% siero fetale bovino e 1% penicillina-streptomycin) al tessuto e aggiungere Fungizone (0,25 mg / ml concentrazione finale) per 30 min. </li><li> Eliminare i mezzi di crescita. </li><li> Lavare il tessuto due volte con PBS 1X. </li><li> Collocare il tessuto su una piastra di coltura cellulare 6 centimetri di distinguere tra miometrio e strati di endometrio (vedi figure 2A-2C per una descrizione più dettagliata). Separare l&#39;endometrio. </li><li> Usando un bisturi o un rasoio, transezione il tessuto in piccoli pezzi mentre graffi sul piatto di coltura cellulare 6 cm. Questi graffi facilitano il fissaggio delle cellule endometriali primarie emergenti. Rispetto al metodo tripsina, è necessaria più tessuto (vedi Figura 2D per approssimazione). </li><li> Delicatamente, aggiungere 2 ml di terreni di crescita per piatto graffiato (frammenti di tessuto saranno visibili e, idealmente, immobilizzato dal moto graffi). </li><li> Trasferire la piastra (s) per un incubatore di coltura cellulare designata (37 ° C e 5% CO 2). Designare un luogo per linee cellulari primarie, lontano da OTHer piatti di coltura di cellule. Colture primarie sono più sensibili all&#39;infezione e contaminazione. </li><li> Esaminare le cellule al microscopio luce del giorno. Piccole popolazioni di cellule dovrebbero emergere dal giorno due o tre intorno ai tessuti fette (vedere Figura 3B). </li><li> Per mantenere le culture, lavare delicatamente con 1X PBS e aggiungere terreni di crescita fresco (2 ml) ogni tre giorni. Quando aumenta la velocità di proliferazione, terreni di crescita supplementare (3-4 ml) possono essere aggiunti alla piastra di coltura 6 cm (s). Nota: durante il lavaggio e dei media cambia, pezzi di tessuto saranno probabilmente aspirati. Questo non influenzerà la crescita di cellule aderenti. I pezzi di tessuto devono essere aspirati dal passo successivo (2.10) come nuove colonie difficilmente emergere dopo una settimana. </li><li> Quando la piastra 6 CM è circa il 75 - 80% confluenti (vedere Figura 3B), passaggio utilizzando 0,05% tripsina. Cellule primarie non possono essere diversi passaggi a tempo indeterminato - congelamento giù una piastra di cellule appena due o tre piatti sono maintained. Se sono necessari ulteriori passaggi, seguire un protocollo immortalization (rivisto nel Rif. ​​3). </li></ol> 3. Preparazione di linee cellulari primarie che utilizzano il metodo tripsina <ol><li> Mettere un piccolo pezzo di tessuto endometriale (vedere Figura 2D per una approssimazione) in 2 ml di 0,25% tripsina integrati con kanamicina (0,03 mg / ml concentrazione finale). </li><li> Incubare il tessuto a 37 ° C su piattaforma rotante per 30 min. </li><li> Brevemente vortice del tessuto. </li><li> Centrifugare il campione a 200-400 xg per 2 minuti e scartare il surnatante. </li><li> Aggiungi tripsina fresco e kanamicina. </li><li> Incubare il tessuto a 37 ° C durante la rotazione per un ora. </li><li> Agitare il tessuto per 5-10 sec. </li><li> Aggiungere 2 ml di terreni di crescita (supplementato con 10% siero fetale bovino e 1% di penicillina-streptomicina) per disattivare la tripsina. </li><li> Centrifugare le cellule a 200-400 xg per 2-3 min. </li><li> Eliminare il surnatante e aggiungere 2 ml di crescereth supporti alle cellule pellet. </li><li> Piatto su un piatto di coltura cellulare 6 centimetri. Raschiare la piastra come nella Fase 2.5 su Preparazione linee cellulari primarie utilizzando il metodo raschio non è necessaria, ma esalta l&#39;attaccamento e la conseguenza di colture primarie. </li><li> Controllo cellule al microscopio luce giornaliera. Le cellule sono solitamente visibili al microscopio ottico dopo 24-48 ore (vedi Figura 3C). </li><li> Per mantenere le culture, monitorare le cellule e modificare i media ogni 2-3 giorni, come nel passo 2.9. </li><li> Per passare le cellule, usa 0,05% o 0,25% tripsina quando le cellule raggiungono il 75-80% di confluenza (vedi Figura 3C). </li></ol> 4. Risparmio tessuto extra per l&#39;analisi (Snap Congelamento e Formalina Fixation) <ol><li> Lavare campione due volte con PBS 1X. </li><li> Aspirare quanto più liquido possibile. </li><li> Per Snap congelamento, collocare campione di tessuto endometriale in una provetta 1,7 centrifuga (vedi figure 2F e 2G). Posizionare il 1.7provetta da centrifuga in azoto liquido per 10 secondi o finché si può notare che il tessuto è congelato giù. Nota: Fare attenzione a non toccare direttamente l&#39;azoto liquido durante la preparazione dei campioni. I campioni possono essere conservati a -80 ° C fino ad ulteriore trattamento o l&#39;analisi. </li><li> Per la fissazione in formalina, tagliare un piccolo pezzo di tessuto endometriale (vedere Figura 2H), e immergere nel 10% formalina tamponata zinco. Dopo 24 ore, scartare in formalina e aggiungere il 70% di etanolo per i campioni di tessuto fino ad ulteriore trasformazione. </li></ol> 5. Immunofluorescenza (IF) <ol><li> Fissazione delle cellule <ol><li> Preparare le cellule su un vetrino cultura o piastra. </li><li> Delicatamente, lavare le cellule con PBS 1X. </li><li> Aggiungere pre-raffreddata (4 ° C) metanolo e acetone (miscelati in un rapporto 1:1) per 5 min. </li><li> Asciugare il vetrino prima di procedere. Diapositiva può essere conservato a 4 ° C per 1-2 settimane se necessario. </li></ol></li><li> Elaborazione IF <ol><li> Reidratare le cellule con PBS 1X per 10 min. Per il following passaggi 1-6, condurre tutti lavaggi e incubazione su una piattaforma rotante. </li><li> Blocco con 1X PBS supplementato con 1% di sieroalbumina bovina (BSA) e 1% specie siero specifico (fonte di anticorpo 2 °) per 30 minuti a temperatura ambiente (RT). </li><li> Incubare in anticorpo primario (vedi produttori raccomandazioni per la diluizione di anticorpi). Vedi Materiali per anticorpi specifici. Diluire l&#39;anticorpo primario in tampone di bloccaggio fresco come al punto 5.2.2. Questo incubazione può essere condotta per almeno 2 ore a temperatura ambiente o per una notte a 4 ° C. </li><li> Lavare 3 volte con PBS 1X per 5 minuti ciascuno. </li><li> Incubare in anticorpo secondario (vedi produttori raccomandazioni per la diluizione di anticorpi). Diluire l&#39;anticorpo secondario in tampone di bloccaggio fresco come al punto 5.2.2. Per evitare fotometabolismo, è importante condurre questo e gradini successivi in ​​assenza di luce. </li><li> Lavare 3 volte con PBS 1X per 5 minuti ciascuno. </li><li> Thoroughly asciugare le diapositive. </li><li> Aggiungi mezzi di montaggio e la soluzione di contrasto DAPI. </li><li> Applicare coprioggetto e sigillare i bordi con sigillante (s). I vetrini possono essere conservati a 4 ° C al buio per un massimo di due settimane. </li></ol></li></ol> 6. RNA Estrazione <ol><li> Pellet 1 x 10 7 cellule per centrifugazione. Tutti i materiali e reagenti di questo protocollo devono essere RNasi libero. </li><li> Lisare le cellule in 1 ml di reagente TRIZOL, e incubare i campioni omogeneizzati per 10 min a temperatura ambiente per completare dissociazione dei complessi nucleoproteici. </li><li> Aggiungere 200 ml di cloroformio per 1 ml di TRIZOL. Agitare vigorosamente a mano per 15 secondi e incubare per 2-3 minuti a temperatura ambiente. </li><li> Centrifugare alla massima velocità (15.000 xg) per 15 min a 4 ° C. Tre strati comporteranno. </li><li> Trasferire la fase acquosa superiore in una nuova provetta. Aggiungere 1 ml di glicogeno per aumentare la resa di RNA; tuttavia, questa fase è necessaria solo quando un piccoloquantità di RNA è anticipato. </li><li> Aggiungere 0,5 ml di alcool isopropilico per lo strato acquoso, e invertire i campioni 3-5 volte. Incubare i campioni a temperatura ambiente per 10 min. Per aumentare la resa, i campioni possono essere collocati in -20 ° C o -80 ° C per 30 min. </li><li> Centrifugare alla massima velocità per 10 min a 4 ° C. </li><li> A questo punto, un piccolo pellet di RNA deve essere visibile. Scartare il surnatante. </li><li> Lavare l&#39;RNA di 1 ml di etanolo al 75%. </li><li> Centrifugare alla massima velocità per 5 minuti e scartare il surnatante. I campioni possono essere lavati più per liberarsi contaminanti inorganici volta, ma questo passaggio non è necessario. </li><li> In breve, asciugare il pellet di RNA fino RNA pellet è asciutto (solitamente richiede 7-10 min). Nota: Un passo aggiuntivo può essere utilizzato per diminuire materia inorganica e diminuire il tempo di asciugatura. Dopo aver scartato il supernatante dal etanolo di lavaggio, campioni centrifuga alla massima velocità per un altro minuto e aspirare liquido residuo. Fare attenzione a non aspirare il pellet. </li><li> Sciogliere RNA in acqua priva di RNasi, a seconda delle dimensioni del pellet di RNA. Volumi in genere varia 10-50 ml. </li><li> Incubare i campioni a 55 ° C per 10 min, e misurare la concentrazione di RNA. </li><li> Conservare i campioni a -20 ° C fino ad ulteriore trasformazione. </li></ol> 7. Trascrizione inversa <ol><li> Portare il campione di RNA (1-3 mg) ad un volume di 9 ml con H 2 O. </li><li> RNA calore a 70 ° C per 10 min. </li><li> Per generare un master mix AMV, combinare i seguenti reagenti: 5 ml di dNTP (concentrazione di lavoro di 50 pm), 5 microlitri di oligo DNA N6 (concentrazione di lavoro di 80 micron), 5 ml di tampone 5X AMV e 1 ml di AMV . Questa soluzione master mix è progettata per un campione. </li><li> Aggiungere 16 microlitri della miscela master al RNA riscaldata. Il volume di reazione finale sarà di 25 microlitri di reazione. </li><li> Utilizzare le seguenti condizioni di PCR per la trascrizione inversa: (fase 1) 42 ° C per 90 min, (STAge 2) 95 ° C per 5 min, e (Fase 3) 4 ° C fino ad ulteriore lavorazione. </li></ol> 8. Real Time PCR <ol><li> Condurre reazioni di PCR utilizzando i primer, temperature di ricottura, numero di cicli e reagenti elencati nella tabella 1. Nota: E &#39;ideale per seguire le istruzioni del produttore quando si utilizzano reagenti PCR (fare riferimento alla società e catalogo numeri in Materials). </li></ol> 9. In vitro decidualizzazione Protocol (Derivato da Rif. ​​4 e 5) <ol><li> Piatto cellule endometriali. </li><li> Crescere ad una confluenza del 75-85%. </li><li> Dopo cellule diventano confluenti, lavare una volta con PBS 1X. </li><li> Rapidamente, aggiungere contenuti multimediali senza ormoni (fenolo libero RPMI supplementato con 5% di carbone striscia di FBS e 1% di penicillina-streptomicina). </li><li> Dopo 24 ore, aggiungere media ormone libero, completata con medrossiprogesterone acetato (MPA) ad una concentrazione finale di 1 mM e 8-bromoadenosine 3 &#39;, 5&#39;-Monofosfato ciclico (cAMP) ad una concentrazione finale di 0,5 mM. </li><li> Dopo almeno 48 ore, bloccare la reazione e salvare la piastra (s) per un&#39;ulteriore elaborazione. </li></ol>

<ol>
	<li>Heller, D., Heller, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> in The endometrium: a clinicopathologic approach. , 56-75 (1994).</li><li>Emera, D., Romero, R., Wagner, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+menstruation:+a+new+model+for+genetic+assimilation:+explaining+molecular+origins+of+maternal+responses+to+fetal+invasiveness.">The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness.</a> Bioessays. 34, 26-35 (2011).</li><li>Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+protocols+used+in+cell+culture+models+of+human+breast+morphogenesis.">Immortalization protocols used in cell culture models of human breast morphogenesis.</a> Cell Mol Life Sci. 61, 2523-2534 (2004).</li><li>Brosens, J. J., Hayashi, N., White, J. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progesterone+receptor+regulates+decidual+prolactin+expression+in+differentiating+human+endometrial+stromal+cells.">Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells.</a> Endocrinology. 140, 4809-4820 (1999).</li><li>Jones, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+SUMO+pathway+sensitizes+differentiating+human+endometrial+stromal+cells+to+progesterone.">Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone.</a> Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).</li><li>Salamonsen, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+the+human+endometrium+and+uterine+fluid:+a+pathway+to+biomarker+discovery.">Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery.</a> Fertil Steril. 99, 1086-1092 (2013).</li><li>Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+human+endometrial+receptivity+from+transcriptomic+and+proteomic+data.">Insights into human endometrial receptivity from transcriptomic and proteomic data.</a> Reprod Biomed Online. 24, 23-34 (2012).</li><li>Chen, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+characterization+of+midproliferative+and+midsecretory+human+endometrium.">Proteomic characterization of midproliferative and midsecretory human endometrium.</a> J Proteome Res. 8, 2032-2044 (2009).</li><li>Talbi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+phenotyping+of+human+endometrium+distinguishes+menstrual+cycle+phases+and+underlying+biological+processes+in+normo-ovulatory+women.">Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women.</a> Endocrinology. 147, 1097-1121 (2006).</li><li>Punyadeera, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oestrogen-modulated+gene+expression+in+the+human+endometrium.">Oestrogen-modulated gene expression in the human endometrium.</a> Cell Mol Life Sci. 62, 239-250 (2005).</li><li>Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+human+endometrium+during+the+menstrual+cycle.">Molecular profiling of human endometrium during the menstrual cycle.</a> Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).</li><li>Zhang, L., Rees, M. C., Bicknell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+isolation+and+long-term+culture+of+normal+human+endometrial+epithelium+and+stroma.+Expression+of+mRNAs+for+angiogenic+polypeptides+basally+and+on+oestrogen+and+progesterone+challenges.">The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges.</a> J Cell Sci. 108 (1), 323-331 (1995).</li><li>Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblast+cells+from+term+human+decidua+closely+resemble+endometrial+stromal+cells:+induction+of+prolactin+and+insulin-like+growth+factor+binding+protein-1+expression).">Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression).</a> Biol Reprod. 52, 609-615 (1995).</li><li>Gellersen, B., Brosens, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+AMP+and+progesterone+receptor+cross-talk+in+human+endometrium:+a+decidualizing+affair.">Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair.</a> J Endocrinol. 178, 357-372 (2003).</li><li>Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+characterization+of+endothelin+released+by+human+endometrial+epithelial+cells+in+culture.">Production and characterization of endothelin released by human endometrial epithelial cells in culture.</a> J Clin Endocrinol Metab. 79, 1625-1631 (1994).</li><li>Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histochemical+identification+of+cultured+cells+from+human+endometrium.">Histochemical identification of cultured cells from human endometrium.</a> In Vitro. 20, 25-32 (1984).</li><li>Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase+production+by+cultured+human+endometrial+stromal+cells:+identification+of+interstitial+collagenase,+gelatinase-A,+gelatinase-B,+and+stromelysin-1+and+their+differential+regulation+by+interleukin-1+alpha+and+tumor+necrosis+factor-alpha.">Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha.</a> J Clin Endocrinol Metab. 79, 530-536 (1994).</li><li>Dimitriadis, E., Robb, L., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin+11+advances+progesterone-induced+decidualization+of+human+endometrial+stromal+cells.">Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 8, 636-643 (2002).</li><li>Sakai, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+histone+acetylation+in+ovarian+steroid-induced+decidualization+of+human+endometrial+stromal+cells.">Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells.</a> J Biol Chem. 278, 16675-16682 (2003).</li><li>Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cyclic+AMP+and+estrogen/progesterone+on+the+transcription+of+DNA+methyltransferases+during+the+decidualization+of+human+endometrial+stromal+cells.">Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 19, 302-312 (2013).</li><li>Tamura, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+IGFBP-1+expression+by+cAMP+is+associated+with+histone+acetylation+status+of+the+promoter+region+in+human+endometrial+stromal+cells.">Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells.</a> Endocrinology. 153, 5612-5621 (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> American Society for Reproductive Medicine: Quick facts about infertility. , (2013).</li><li>Salker, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+selection+of+human+embryos:+impaired+decidualization+of+endometrium+disables+embryo-maternal+interactions+and+causes+recurrent+pregnancy+loss.">Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss.</a> PLoS One. 5, (2010).</li></ol>

Gli autori non hanno nulla da divulgazione.

Altri gruppi hanno descritto e adattato metodologia per la preparazione di colture stromali endometriali, molti dei quali utilizzano collagenasi 4,12,13,15-18. In questo manoscritto, abbiamo fornito metodologia e prove per due metodi di coltura stromale semplificate primarie endometriali, entrambi i quali sono utilizzati dal nostro laboratorio per motivi economici e conveniente disponibilità di tripsina e / o una lama di rasoio. Quando si confrontano i nostri due metodi, entrambi generano successo colture primarie vitali. Il nostro metodo preferito è il metodo tripsina in quanto vi è in genere un rendimento superiore con un requisito piccola dimensione del campione. Tuttavia, se il tempo di preparazione è limitato, il metodo di raschiatura richiede 30 minuti mentre placcatura cellule utilizzando il metodo tripsina richiede più di un&#39;ora e mezza. Da segnalare anche che noi dimostriamo questi metodi con i campioni di isterectomia al contrario di biopsie endometriali. Bio endometrialepsies sono prese senza significative intrusioni e tendono a produrre esemplari più piccoli. Ancora, i metodi descritti in questo manoscritto (in particolare il metodo tripsina) dovrebbero produrre colture da biopsie endometriali. Ci sono numerose applicazioni per le cellule stromali endometriali primarie. Confronto tra culture stromali endometriali da umano rispetto agli altri mammiferi può fornire indizi per le domande che sono state dibattute per secoli sul perché gli esseri umani mestruazioni. Ci sono altri studi di fisiologia inesplorate che richiedono la coltura in vitro. Di particolare interesse sono le scoperte che forniscono intuizioni eventi del ciclo riproduttivo come i risultati che sono collegati eventi molecolari epigenetici agli eventi funzionali del ciclo riproduttivo 19,20, 21, e recensiti Rif. ​​11. I medici potrebbero trarre grandi vantaggi da studiare la cultura dello stroma endometriale e l&#39;identificazione di biomarkers nei casi di disordini riproduttivi e neoplasie tumorali. Tra il 2006 e il 2010, è stato riferito che 7,4 milioni di donne ei loro partner hanno utilizzato servizi di infertilità negli Stati Uniti 22. Una percentuale significativa di infertilità è dovuta al fallimento di decidualizzazione 23. Inoltre, è solo di recente sta valutando la relazione tra patologie endometriali quali iperplasia e l&#39;endometriosi alla sterilità. La capacità di studiare i tumori ginecologici uterini attraverso la modellazione in vitro è anche preziosa perché, anche se advanced sarcoma endometriale è rara, può essere letale. Stabilendo in colture primarie in vitro, si studia l&#39;impatto degli eventi molecolari associati alle malattie e in grado di generare applicazioni cliniche putativi. In conclusione, generando rappresentativo ed efficace in modelli in vivo per molte di queste applicazioni è difficile. Questo rende lo sviluppo di unvitro colture endometriali primarie per studiare diverse funzioni in vivo critica. Questi due metodi di isolamento endometriali, &quot;il metodo scraping&quot; e &quot;il metodo tripsina,&quot; contribuirà a fornire il punto d&#39;appoggio per la nostra comprensione della fisiologia e patologia endometriale.

Il corpus utero umano è costituito da tre strati, il perimetrium (o sierosa), miometrio, e l&#39;endometrio. Distinguere ciascuno di questi livelli è un passo importante per stabilire linee di cellule endometriali. Il perimetrium è strato più esterno dell&#39;utero e composto, cellule sierose sottili. Il miometrio è la spessa, strato intermedio dell&#39;utero e composta da cellule muscolari lisce. L&#39;endometrio è identificato come strato interno dell&#39;utero e comprende popolazioni epiteliali e cellule stromali. L&#39;endometrio è ulteriormente suddivisa in strato basale il cui stelo popolazione cellulare è ipotizzato di ripopolare il livello functionalis circa ogni 28 giorni 1. Lo strato functionalis dell&#39;endometrio umano subisce significative variazioni biochimiche e morfologiche in risposta agli ormoni circolanti. Questi ormoni sono derivati ​​dalla ghiandola pituitaria e le ovaie. Ilproduzione coordinata e il rilascio di ormoni risultati in un ciclo riproduttivo. Il ciclo riproduttivo è progettato per preparare l&#39;endometrio per potenziali eventi impianto dell&#39;embrione. Negli esseri umani, il ciclo riproduttivo è conosciuto come &quot;il ciclo mestruale&quot; e suddiviso in tre fasi - proliferativa, secretori, e mestruali. La fase proliferativa comporta la proliferazione del functionalis livello endometriale mentre la fase secretoria è segnato da functionalis maturazione. In particolare, alterazioni extracellulari, secrezioni e differenziazione cellulare segnalano un potenziale impianto. Se l&#39;impianto non si verifica prima della fine della fase secretoria, lo strato functionalis endometriale è sparso durante la fase mestruale. L&#39;importanza delle mestruazioni e gli eventi che attivano lo spargimento dello strato functionalis sono ancora in discussione. Negli esseri umani, è stato posto che le mestruazioni è il risultato di un evento specifico metà secretoria differenziazione fase conosciutacome &quot;decidualizzazione spontanea&quot; 2. In questo manoscritto, forniamo metodologia dettagliata per entrambi i metodi di isolamento delle cellule stromali dell&#39;endometrio, e usiamo una combinazione di immunofluorescenza e immagini digitali per dimostrare l&#39;efficacia di questi approcci. Inoltre, si applica una comunemente usato modello in vitro di decidualizzazione spontaneo per confermare endometriale isolamento delle cellule stromali.

<table border="0" cellpadding="0" cellspacing="0" width="713">
	<tbody>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">0.25 Trypsin or 0.05% Trypsin&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH3023602 or SH30004202&#160;&#160;</td>
			<td style="width:63px;"></td>
		</tr>
		<tr height="27">
			<td dir="LTR" height="27" style="height:27px;width:235px;">1.7 micro Centrifuge Tube&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">22-272A&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">1&#181;l,20&#181;l, 200ml and 1000&#181;l Pipette&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">24-401,24-402, 24-412, 24-430&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">15ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339650</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">50ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339652</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">6cm Cell Culture Dish&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-556-002&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">8 well Chambers&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Acetate&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher scientific&#160;</td>
			<td dir="LTR" style="width:216px;">C4-100&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">AMV RT Enzyme/Buffer&#160;</td>
			<td dir="LTR" style="width:201px;">Bio Labs&#160;</td>
			<td dir="LTR" style="width:216px;">M077L&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Bovine Serum Albumin (BSA)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-1605-100&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Buffered Zinc Formalin&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">59201ZF&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Charcoal strip FBS&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher&#160;</td>
			<td dir="LTR" style="width:216px;">NC9019735&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Chloroform&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP1145-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cover slip&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Brand&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-544D&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cyclic AMP (cAMP)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">B7880</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">DMEM/High Glucose&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH30243FS&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">dNTP&#160;</td>
			<td dir="LTR" style="width:201px;">Bioline&#160;</td>
			<td dir="LTR" style="width:216px;">BIO-39025&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Anti Goat -TRITC&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-3855&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Serum&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s lab&#160;</td>
			<td dir="LTR" style="width:216px;">&#160;017-000-002&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">E Cadherin Antibody&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">1702-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Ethanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">BP2818-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific</td>
			<td dir="LTR" style="width:216px;">03-600-511&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fungizone Amphotericin B&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">15290-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">GAPDH Probe&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">HS99999905&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Glycogen&#160;</td>
			<td dir="LTR" style="width:201px;">5Prime&#160;</td>
			<td dir="LTR" style="width:216px;">2301440</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Goat Anti Mouse -FITC&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s Lab&#160;</td>
			<td dir="LTR" style="width:216px;">115-096-003&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Isopropanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP2618-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Kanamycin&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP906-5&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Medroxyprogesterone acetate (MPA)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">M1629</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">MeOH (Methanol)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">A4-08-1&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Mounting Media (w/DAPI)&#160;</td>
			<td dir="LTR" style="width:201px;">Vector Labratories&#160;</td>
			<td dir="LTR" style="width:216px;">H-1500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">N6 DNA Oligos&#160;</td>
			<td dir="LTR" style="width:201px;">Invitrogen&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Number 15 Scraper&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">BD&#160;</td>
			<td dir="LTR" style="width:216px;">371615</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Pan Cytokeratin&#160; Mouse mAB&#160;</td>
			<td dir="LTR" style="width:201px;">Cell Signaling&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">4545</td>
			<td></td>
		</tr>
		<tr height="29">
			<td dir="LTR" height="29" style="height:29px;width:235px;">PBS (phosphate buffered saline)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-399-4&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Penicillin-Streptomycin Glutamine Solution 100X&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SV30082.01&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">PML Anti Goat Anti body&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-9862&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Primer(s)&#160;</td>
			<td dir="LTR" style="width:201px;">Eurofins&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SH30027FS&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI (Phenol free)&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">11835</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Sybr Green&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Taqman&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4138</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Trizol&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">15596018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Vimentin Antibody&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">4211-1</td>
			<td></td>
		</tr>
	</tbody>
</table>

two methods for establishing primary human endometrial stromal cells from hysterectomy specimens

Molti sforzi sono stati dedicati ad elaborare sistemi di colture cellulari in vitro. Questi sistemi sono progettati per modellare un vasto numero di processi in vivo. Sistemi di colture cellulari derivanti da campioni endometriali umane non fanno eccezione. Le applicazioni spaziano dai normali processi fisiologici ciclici a patologie endometriali come i tumori ginecologici, malattie infettive, e carenze riproduttive. Qui, mettiamo a disposizione due metodi per stabilire cellule stromali endometriali primarie da campioni di isterectomia endometriale chirurgicamente asportati. Il primo metodo è indicato come &quot;metodo raschiatura&quot; e incorpora raschiatura meccanica usando lame chirurgiche o rasoio mentre il secondo metodo è chiamato &quot;il metodo tripsina.&quot; Quest&#39;ultimo metodo utilizza l&#39;attività enzimatica di tripsina per promuovere la separazione di cellule e primaria escrescenza cellulare. Illustriamo metodologia step-by-step per immagini digitali e microscopia. Abbiamo anche provide gli esempi per convalidare le linee di cellule stromali endometriali mediante reazioni quantitative in tempo reale catena della polimerasi (qPCR) e di immunofluorescenza (IF).

Come sottolineato nella sezione Protocollo, assicurarsi di effettuare tutti i metodi sotto il governo, istituzionali e orientamenti etici durante la manipolazione e preparazione di tessuti umani. Inclusi in questo manoscritto è un esempio del flusso di lavoro generale di &quot;metodo scraping&quot; (Figura 1A) e &quot;il metodo tripsina&quot; (Figura 1B) utilizzato per stabilire colture primarie endometriali. Questi metodi sono descritti in dettaglio nella sezione Protocol (vedere parte 1 -. 3.). Entrambi i metodi di risultati positivi nella crescita di colture primarie endometriali. Il vantaggio di &quot;metodo raschiando&quot; è il tempo di preparazione abbreviato; Tuttavia, il tempo necessario per osservare cellule vitali è solitamente 2 - 4 volte superiore rispetto a &quot;il metodo tripsina.&quot; Purché sono immagini digitali del tessuto umano iniziale ricevuto dai approvvigionamento dei tessuti. Gli strati uterine si distinguono per laruvidezza dello strato, cioè il miometrio è spesso e muscoloso e l&#39;endometrio è sottile e più cedevole. Abbiamo evidenziato la spessa, strato muscolare liscio (miometrio) in bianco e delineato lo strato endometriale di interesse in nero da due differenti campioni di isterectomia (figure 2a e 2b). In Figura 2C, i tessuti sono orientati con il miometrio rivolto verso l&#39;alto mentre l&#39;endometrio è posizionato verso il basso. Il sottile strato perimetrial è stato asportato chirurgicamente e non evidenziata in queste immagini. E &#39;anche importante notare che la dimensione dello strato endometriale in queste immagini 2-digitale dimensionale è travisato come strato 3-dimensionale reale è molto sottile rispetto al miometrio. Tagliare la dimensione del tessuto appropriato è importante sia per &quot;il metodo scraping&quot; e &quot;il metodo tripsina.&quot; In Figura 2D, calibro sono designati per ciascun metodo sopra il rispettivo campione. Utilizzando uno 0.5x00,5 x0.5 cm pezzo per &quot;il metodo tripsina&quot; [left] è sufficiente per creare una cultura. Il tessuto di partenza rappresentante per &quot;il metodo scraping&quot; [a destra] comprende tutti i livelli uterine. Il prodotto finale per &quot;il metodo raschiatura&quot; è rappresentato nella Figura 2E, e si raccomanda che almeno 1x1x1 cm di tessuto endometriale essere utilizzato per stabilire colture vitali. L&#39;esigenza di questo campione di tessuto molto è uno svantaggio di &quot;metodo scraping&quot;. Tessuto rimanente è spesso usato in molti modi tra cui proteine ​​e RNA analisi. Per garantire la conservazione della qualità dei tessuti, è importante utilizzare un metodo &quot;scatto congelamento&quot; come nella sezione Protocollo (vedi 4.). Questo metodo è illustrato anche nella Figura 2F e 2G Figura. Salvataggio tessuto extra fissazione con formalina è anche una pratica comune di patologi e ricercatori. Tessuto Preparazione per la fissazione in formalina è descritto nel protocollo </strong&gt; sezione (vedi 4.) e illustrato in Figura 2H. La microscopia ottica è essenziale per monitorare colture primarie endometriale. Singole cellule stromali endometriali devono mostrare la morfologia dei fibroblasti (Figura 3A). &quot;Il metodo scraping&quot; genera tipicamente gruppi di cellule emergenti prime, principalmente lungo bisturi indotta graffi (Figura 3B, Giorno 2). &quot;Il metodo della tripsina&quot; genera sia cluster e modelli di crescita delle cellule disperse (Figura 3C, Giorno 4). Abbiamo incluso diverse immagini rappresentative della placcatura iniziale (giorno 0) al primo passaggio di ciascun metodo (Figura 3B e 3C). Molti tessuti sono definite dalla loro espressione di marcatori tessuto-specifici come actina della muscolatura liscia (SMA) per muscolatura liscia, cellule staminali CD34 per immunitarie, ecc Mentre sono stati condotti esperimenti di espressione genica e proteine ​​per l&#39;endometrio 6-11, un encellule stromali dometrial marcatore specifico deve ancora essere scoperto. Invece, i ricercatori comunemente valutare endometriale purezza stroma dai marcatori di potenziali contaminanti cella di misura. Ad esempio, i marcatori citocheratinici vengono utilizzati per mostrare le popolazioni epiteliali. Tuttavia, è meno di una preoccupazione, perché stabilire e mantenere epiteli endometriali sono difficili e solitamente selezionato contro (Rif. 12 e Figura 4A). Se i campioni dovessero essere ottenuto durante la gravidanza, positiva espressione di HLA-A,-B,-C dimostra germinali, cellule del trofoblasto 13. D&#39;altra parte, come altri fibroblasti mesenchimali, cellule stromali endometriali esprimono vimentina (CDH1). Dimostriamo con immunofluorescenza, l&#39;espressione di vimentina e l&#39;assenza di citocheratina e E caderina (CDH1) nei nostri stabiliti endometriali cellule stromali (Figura 4B). Infine, forniamo la prova funzionale della cultura endometriale primaria attraverso un in vitro spontaneo test decidualizzazione. Questo metodo è stato adattato da Rif 4 e 5, e comprende il trattamento di culture con una combinazione di medrossiprogesterone acetato (MPA) e 8 - bromoadenosine 3 &#39;, 5&#39;-monofosfato ciclico (cAMP) (descritto in 9 In vitro decidualizzazione protocollo e modellato. in figura 5A). In presenza di MPA e cAMP, cellule stromali endometriali mostrano profili di espressione genica significativamente alterati (recensiti Rif. ​​14). I marcatori decidualizzazione spontanei frequentemente riportati sono prolattina (PRL) e fattore di crescita insulino-simile Binding Protein 1 (IGFBP1) (recensione in rif 14). La risposta di questi due geni per MPA e cAMP sono forti indicatori sia di decidualizzazione spontaneo e di successo creazione di una cultura stromale endometriale. Dimostriamo questo in figura 5B. Figura 1. Schematica dei due metodi di isolamento endometriali primari. (A) I passaggi 2,1-2,10 del metodo raschiamento visualizzato in un organigramma. (B) passaggi 3,1-3,14 del metodo tripsina visualizzato in un organigramma. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig1highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita.</a> <img alt="Figura 2" fo:content-width="2.75in" src="/files/ftp_upload/51513/51513fig2highres.jpg" width="500" /> Figura 2. Elaborazione tessuto uterino. (AC) campioni uterine cliniche dei due pazienti di sesso femminile. A &amp; C sono derivati ​​da paziente 1 e B è derivato da paziente 2. tessuto asportato chirurgicamente uterina (a sinistra) e EVIDENZAstrati d uterini (a destra). (A &amp; B) Il miometrio è cerchiata in bianco e dell&#39;endometrio in nero. (C) Il miometrio è di fronte alla telecamera. (D) rappresentativi campioni di dimensioni dell&#39;endometrio iniziali per entrambi i metodi di isolamento sono indicati. Il metodo tripsina richiede endometrio puro prima aggiunta del tripsina, mentre il metodo raschiando può utilizza l&#39;intera campioni uterine. (E) Esempio del campione endometriale elaborata del metodo raschiatura. (F &amp; G) Immagine del restante tessuto uterino in fase di preparazione per Snap Congelamento. Mostrato è un contenitore di metallo preparata in laboratorio utilizzato per questo metodo. (H) formalina fissazione di campione endometriale. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig2highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita.</a> <img alt="Figura 3" fo:content-width="3in" src=&quot;/ Files/ftp_upload/51513/51513fig3highres.jpg&quot; width = &quot;400&quot; /&gt; Figura 3. Immagini di microscopia luce delle culture endometriale primarie. . (A) Immagini rappresentative della colture di cellule stromali endometriali prese a vari poteri e di confluenza (B) Immagini rappresentative del metodo di raschiatura (giorni 0-16) presa dello stesso piatto cultura, alimentato a 10x Nota:. Linee visuali indicano graffi da lama chirurgica (C) Immagini rappresentative del metodo tripsina.. (giorni 0-16) presa dello stesso piatto cultura, alimentato a 10x <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig3highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita.</a> <img alt="Figura 4" fo:content-width="4in" src="/files/ftp_upload/51513/51513fig4highres.jpg" width="400" /> Figura 4. Immagini di immunofluorescenza di cellule stromali endometriali. (A) immunofluorescenzadelle culture endometriali primarie isolato tramite il metodo scraping. Immagini dimostrano perdita della citocheratina tra passaggio 2 (P2) e passaggio 5 (P5). Proteine ​​leucemia promielocitica (PML) proteina nucleare e colorazione DAPI sono stati usati come controlli. (B) Le immagini dimostrano colorazione positiva per il marcatore mesenchimale vimentina. Le immagini mostrano anche colorazione negativa per E caderina (CDH1) e Citocheratina. Colorazione per DAPI e proteine ​​leucemia promielocitica (PML) sono stati forniti come controlli. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig4highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita.</a> <img alt="Figura 5" fo:content-width="5in" src="/files/ftp_upload/51513/51513fig5highres.jpg" width="500" /> Figura 5. Decidualizzazione spontaneo di due cellule stromali endometriali primarie. (A) Schema di procedura sperimentale. (B) Upregulation di prolattina (PRL) eFattore di crescita insulino-simile Binding Protein 1 (IGFBP1) l&#39;espressione genica in risposta a MPA e cAMP. I risultati sono stati misurati mediante RT-qPCR, e l&#39;espressione è stata normalizzata a GAPDH. La significatività è stata calcolata utilizzando studenti t-test (P &lt;0.001 *** e P &lt;0.0001 ****). Entrambe le linee cellulari sono state isolate utilizzando il metodo del raschiamento. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig5highres.jpg" target="_blank">Clicca qui per vedere l&#39;immagine ingrandita.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Primer </td><td> Sequenza </td><td> Ricottura temperatura (° C) </td><td> Cicli </td><td> Saggio </td></tr><tr><td> La prolattina (PRL) Forward </td><td> CATATTGCGATCCTGGAATGAGC </td><td> 60 </td><td> 40 </td><td> SybrGreen </td></tr><tr><td> La prolattina (PRL) Reverse </td><td> TCCTCAATCTCTACAGCTTTGGA </td><td> 60 </td><td> 40 </td><td> SybrGreen </td></tr><tr><td> Fattore di crescita insulino-simile proteina di legame 1 (IGFBP1)Avanti </td><td> TCCTTTGGGACGCCATCAGTAC </td><td> 60 </td><td> 40 </td><td> SybrGreen </td></tr><tr><td> Fattore di crescita insulino-simile proteina di legame 1 (IGFBP1) Reverse </td><td> GATGTCTCCTGTGCCTTGGCTA </td><td> 60 </td><td> 40 </td><td> SybrGreen </td></tr><tr><td> GAPDH </td><td> Non specificato (vedi lista dei reagenti) </td><td> 60 </td><td> 40 </td><td> Taqman </td></tr></tbody></table> Tabella 1. Condizioni di PCR per i marcatori decidualizzazione.

Watch this Scientific Journal Video about Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens at JoVE.com

Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Stabilire sistemi di coltura primarie endometriali stromali di cellule da campioni di isterectomia è una tecnica biologica prezioso e un passo fondamentale prima di perseguire una vasta gamma di ricerca mira. Qui, descriviamo due metodi utilizzati per stabilire culture stromali da tessuto endometriale chirurgicamente resecati di pazienti umani.

Due metodi per stabilire primarie cellule umane endometriale stromali da isterectomia campioni

Many efforts have been devoted to establish in vitro cell culture systems. These systems are designed to model a vast number of in vivo processes. Cell ...

two-methods-for-establishing-primary-human-endometrial-stromal-cells

Nanyang Technological University

Research

JoVE Journal

Medicine

22.6K Views.  University of Virginia.  Stabilire sistemi di coltura primarie endometriali stromali di cellule da campioni di isterectomia è una tecnica biologica prezioso e un passo fondamentale prima di perseguire una vasta gamma di ricerca mira. Qui, descriviamo due metodi utilizzati per stabilire culture stromali da tessuto endometriale chirurgicamente resecati di pazienti umani. 

Video: Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Mammary Transplantation of Stromal Cells and Carcinoma Cells in C57BL/6J Mice

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular through transplantation of stromal cells and epithelial cells in the mammary gland of mice. Current transplantation models often involve the use of immunocompromised mice due to the different genetic backgrounds of stromal cells and epithelial cells. Extracellular matrices are often used to embed the two different cell types for consistent cell-cell interactions, but involve the use of Matrigel or rat tail collagen, which are immunogenic substrates. The lack of functional T cells from immunocompromised mice prevents accurate assessment of stromal cells on mammary tumor progression in vivo, with important implications on drug development and efficacy. Moreover, immunocompromised mice are costly, hard to breed and require special care conditions. To overcome these obstacles, we have developed an approach to orthotopically transplant stromal cell and epithelial cells into mice from the same genetic background to induce consistent tumor formation. This system involves harvesting normal, carcinoma associated fibroblasts, PyVmT mammary carcinoma cells and collagen from donor C57BL/6J mice. The cells are then embedded in collagen and transplanted in the inguinal mammary glands of female C57BL/6J mice. Transplantation of PyVmT cells alone form palpable tumors 30-40 days post transplantation. Endpoint analysis at 60 days indicates that co-transplantation with fibroblasts enhances mammary tumor growth compared to PyVmT cells transplanted alone. While cells and matrix from C57BL/6J mice were used in these studies, the isolation of cells and matrix and transplantation approach may be applied towards mice from different genetic backgrounds demonstrating versatility. In summary, this system may be used to investigate molecular interactions between stromal cells and epithelial cells, and overcomes critical limitations in immunocompromised mouse models.

In this report, we demonstrate a system to isolate and culture donor cells from the mouse mammary gland, and orthotopically transplant these cells in recipient mice to analyze stromal: epithelial interactions during mammary tumor development.

Trapianto mammaria di cellule stromali e cellule di carcinoma in topi C57BL/6J

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular ...

Ricerca

Medicina

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of extracellular matrix (ECM) and a variety of mesenchymal cells, including fibroblasts, myofibroblasts, endothelial cells, pericytes and leukocytes 1-3.
The tumour-associated stroma is responsive to substantial paracrine signals released by neighbouring carcinoma cells. During the disease process, the stroma often becomes populated by carcinoma-associated fibroblasts (CAFs) including large numbers of myofibroblasts. These cells have previously been extracted from many different types of human carcinomas for their in vitro culture. A subpopulation of CAFs is distinguishable through their up-regulation of &alpha;-smooth muscle actin (&alpha;-SMA) expression4,5. These cells are a hallmark of 'activated fibroblasts' that share similar properties with myofibroblasts commonly observed in injured and fibrotic tissues 6. The presence of this myofibroblastic CAF subset is highly related to high-grade malignancies and associated with poor prognoses in patients.
Many laboratories, including our own, have shown that CAFs, when injected with carcinoma cells into immunodeficient mice, are capable of substantially promoting tumourigenesis 7-10. CAFs prepared from carcinoma patients, however, frequently undergo senescence during propagation in culture limiting the extensiveness of their use throughout ongoing experimentation. To overcome this difficulty, we developed a novel technique to experimentally generate immortalised human mammary CAF cell lines (exp-CAFs) from human mammary fibroblasts, using a coimplantation breast tumour xenograft model.
In order to generate exp-CAFs, parental human mammary fibroblasts, obtained from the reduction mammoplasty tissue, were first immortalised with hTERT, the catalytic subunit of the telomerase holoenzyme, and engineered to express GFP and a puromycin resistance gene. These cells were coimplanted with MCF-7 human breast carcinoma cells expressing an activated ras oncogene (MCF-7-ras cells) into a mouse xenograft. After a period of incubation in vivo, the initially injected human mammary fibroblasts were extracted from the tumour xenografts on the basis of their puromycin resistance 11.
We observed that the resident human mammary fibroblasts have differentiated, adopting a myofibroblastic phenotype and acquired tumour-promoting properties during the course of tumour progression. Importantly, these cells, defined as exp-CAFs, closely mimic the tumour-promoting myofibroblastic phenotype of CAFs isolated from breast carcinomas dissected from patients. Our tumour xenograft-derived exp-CAFs therefore provide an effective model to study the biology of CAFs in human breast carcinomas. The described protocol may also be extended for generating and characterising various CAF populations derived from other types of human carcinomas.

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Carcinoma-associated fibroblasts (CAFs) rich in myofibroblasts present within the tumour stroma, play a major role in driving tumour progression. We developed a coimplantation tumour xengraft model for experimentally generating CAFs from human mammary fibroblasts. The protocol describes how to establish CAF myofibroblasts that acquire an ability to promote tumourigenesis.

Generazione sperimentale di carcinoma-Associated fibroblasti (CAF) da fibroblasti umani mammari

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Repair of a Critical-sized Calvarial Defect Model Using Adipose-derived Stromal Cells Harvested from Lipoaspirate

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. Adipose-derived stromal cells (ASCs) have proven to be an abundant source of multipotent stem cells capable of undergoing osteogenic, chondrogenic, adipogenic, and myogenic differentiation. Many studies have explored the osteogenic potential of these cells in vivo with the use of various scaffolding biomaterials for cellular delivery. It has been demonstrated that by utilizing an osteoconductive, hydroxyapatite-coated poly(lactic-co-glycolic acid) (HA-PLGA) scaffold seeded with ASCs, a critical-sized calvarial defect, a defect that is defined by its inability to undergo spontaneous healing over the lifetime of the animal, can be effectively show robust osseous regeneration. This in vivo model demonstrates the basis of translational approaches aimed to regenerate the bone tissue - the cellular component and biological matrix. This method serves as a model for the ultimate clinical application of a progenitor cell towards the repair of a specific tissue defect.

This protocol describes the isolation of adipose-derived stromal cells from lipoaspirate and the creation of a 4 mm critical-sized calvarial defect to evaluate skeletal regeneration.

Riparazione di un critico di dimensioni modello Difetto cranica Usando derivate da tessuto adiposo cellule stromali raccolte da Lipoaspirate

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Differenziazione Isolamento, caratterizzazione e comparata delle cellule umane Dental Pulp staminali derivate da denti permanenti mediante due diversi metodi

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Improved Protocol For Laser Microdissection Of Human Pancreatic Islets From Surgical Specimens

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected cells can be used for a variety of investigations, such as transcriptomic or proteomic studies, DNA assessment or chromosomal analysis 2,3. An especially challenging application of LMD is transcriptome analysis, which, due to the lability of RNA 4, can be particularly prominent when cells are dissected from tissues that are rich of RNases, such as the pancreas. A microdissection protocol that enables fast identification and collection of target cells is essential in this setting in order to shorten the tissue handling time and, consequently, to ensure RNA preservation. 
Here we describe a protocol for acquiring human pancreatic beta cells from surgical specimens to be used for transcriptomic studies 5. Small pieces of pancreas of about 0.5-1 cm3 were cut from the healthy appearing margins of resected pancreas specimens, embedded in Tissue-Tek O.C.T. Compound, immediately frozen in chilled 2-Methylbutane, and stored at -80 &deg;C until sectioning. Forty serial sections of 10 &mu;m thickness were cut on a cryostat under a -20 &deg;C setting, transferred individually to glass slides, dried inside the cryostat for 1-2 min, and stored at -80 &deg;C. 
Immediately before the laser microdissection procedure, sections were fixed in ice cold, freshly prepared 70% ethanol for 30 sec, washed by 5-6 dips in ice cold DEPC-treated water, and dehydrated by two one-minute incubations in ice cold 100% ethanol followed by xylene (which is used for tissue dehydration) for 4 min; tissue sections were then air-dried afterwards for 3-5 min. Importantly, all steps, except the incubation in xylene, were performed using ice-cold reagents - a modification over a previously described protocol 6. utilization of ice cold reagents resulted in a pronounced increase of the intrinsic autofluorescence of beta cells, and facilitated their recognition. For microdissection, four sections were dehydrated each time: two were placed into a foil-wrapped 50 ml tube, to protect the tissue from moisture and bleaching; the remaining two were immediately microdissected. This procedure was performed using a PALM MicroBeam instrument (Zeiss) employing the Auto Laser Pressure Catapulting (AutoLPC) mode. The completion of beta cell/islet dissection from four cryosections required no longer than 40-60 min. Cells were collected into one AdhesiveCap and lysed with 10 &mu;l lysis buffer. Each single RNA specimen for transcriptomic analysis was obtained by combining 10 cell microdissected samples, followed by RNA extraction using the Pico Pure RNA Isolation Kit (Arcturus). This protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their rapid and accurate recognition and collection. Further improvement of this procedure could enable the dissection of phenotypically different beta cells, with possible implications for better understanding the changes associated with type 2 diabetes.

Laser microdissection is a technique that allows the recovery of selected cells from minute amounts of parenchyma. Here we describe a protocol for acquiring human pancreatic islets from surgical specimens to be used for transcriptomic studies. Our protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their collection.

Protocollo migliorato per microdissezione laser di isole pancreatiche umane da campioni chirurgici

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected ...

Transcriptomic Analysis of Human Retinal Surgical Specimens Using jouRNAl

Retinal detachment (RD) describes a separation of the neurosensory retina from the retinal pigmented epithelium (RPE). The RPE is essential for normal function of the light sensitive neurons, the photoreceptors. Detachment of the retina from the RPE creates a physical gap that is filled with extracellular fluid. RD initiates cellular and molecular adverse events that affect both the neurosensory retina and the RPE since the physiological exchange of ions and metabolites is severely perturbed. The consequence for vision is related to the duration of the detachment since a rapid reapposition of the two tissues results in the restoration of vision 1. The treatment of RD is exclusively surgical. Removal of vitreous gel (vitrectomy) is followed by the removal non essential part of the retina around the detached area to favor retinal detachment. The removed retinal specimens are res nullius (nothing) and consequently normally discarded. To recover RNA from these surgical specimens, we developed the procedure jouRNAl that allows RNA conservation during the transfer from the surgical block to the laboratory. We also standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for global gene expression analysis. The quality of the RNA was validated both by RT-PCR and microarray analysis. Analysis of the data shows a simultaneous involvement of inflammation and photoreceptor degeneration during RD.

We used retinal samples from retinectomy for a transcriptomic analysis of retinal detachment. We developed a procedure that allows RNA conservation between the surgical blocks and the laboratory. We standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for microarray analysis.

Analisi trascrittomica di campioni chirurgici retiniche umane Utilizzo ufficiale

Retinal detachment (RD) describes a separation of the neurosensory retina  from the retinal pigmented epithelium (RPE). The RPE is essential for normal  ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Metodo per ottenere primarie cellule tumorali ovariche da campioni solidi

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

Arricchimento per chemioresistente Ovarian Cancer Stem Cells da linee cellulari umane

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Studiare cancro del pancreas staminali caratteristiche cellulari per lo sviluppo di nuove strategie di trattamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

A Novel Clinical Grade Isolation Method for Human Kidney Perivascular Stromal Cells

Mesenchymal Stromal Cells (MSCs) are tissue homeostatic and immune modulatory cells that have shown beneficial effects in kidney diseases and transplantation. Perivascular Stromal Cells (PSCs) share characteristics with bone marrow MSCs (bmMSCs). However, they also possess, most likely due to local imprinting, tissue-specific properties and play a role in local tissue homeostasis. This tissue specificity may result in tissue specific repair, also within the human kidney. We previously showed that human kidney PSCs (kPSCs) have enhanced kidney epithelial wound healing whereas bmMSCs did not have this potential. Moreover, kPSCs can ameliorate kidney injury in vivo. Therefore, kPSCs constitute an interesting source for cell therapy, particularly for kidney diseases and renal transplantation. Here we show the detailed isolation and culture method for kPSCs from transplant-grade human kidneys based on whole-organ perfusion of digestive enzymes via the renal artery and enrichment for the perivascular marker NG2. In this way, large cell quantities can be obtained that are suitable for cellular therapy.

Here we present a novel clinical grade isolation and culture method for kidney Perivascular Stromal Cells (kPSCs) based on whole organ perfusion with digestive enzymes and NG2-cell enrichment. With this method, it is possible to acquire sufficient cell numbers for cellular therapy.