Biz onların görüntüleme ve mikroskop ekipman kullanımı için Dr Thao&#39;nun Dang ve onun laboratuar üyelerinin ortak çabaları teşekkür ederim. Biz de rahim dokusu ile bize sağlamak için Biorepository ve Doku Araştırma Tesisi (BTRF) çekirdek, Jeff Harper ve Virginia Üniversitesi sakinlerine teşekkür ederim. Biz Şematik Bakış ile yardım için Karol szlachta teşekkür ederim.

Bu yazıda kullanılan histerektomi örnekleri IRB-HSR # 14424 sayılı Üniversite IRB-onaylı etik protokolü ile uyum içinde toplanmıştır. Klinik Kaynak 1. Örnek Edinme <ol><li> Başlamadan önce hükümeti ve kurum-temelli etik kuralları ve onay belgeleri edinmek. </li><li> Steril şartlarda tüm adımları Davranış. </li><li> Numune hemen kültüründe işlenemez 4 ° C de, 50 ml bir tüp içinde ortam (RPMI ya da DMEM / yüksek glukozlu) hasta türetilen dokuları korur. Numuneler, 24 saat bir süre için bu halde saklanabilir. </li><li> 1X steril fosfat tamponlu tuzlu su (PBS) ile bir doku örneği, üç kez yıkanır ve yıkamalar arasında solüsyonu atın. </li></ol> Kazıma Yöntemi kullanılarak Primer Hücre Hatları 2. Hazırlanması <ol><li> Büyüme ortamı (RPMI veya% 10 Fetal Sığır Serumu ve% 1 Penisilin-streptomy ile takviye edilmiş DMEM / Yüksek Glikoz 4-10 ml ekleyincin) dokuya ve 30 dakika boyunca fungizon (0.25 ug / ml nihai konsantrasyon) ekleyin. </li><li> Büyüme ortamı atın. </li><li> 1X PBS ile iki kez doku yıkayın. </li><li> Miyometriyum ve endometriyum katmanları (Şekil daha fazla bilgi için bakınız Şekil 2A-2C) ayırt etmek için 6 cm hücre kültür plakası üzerine doku yerleştirin. Endometrium ayırın. </li><li> 6 cm hücre kültürü çanak üzerine çizilmemesi ise bir neşter veya jilet kullanarak, küçük parçalar halinde doku transect. Bu çizikler çıkan birincil endometrial hücrelerin bağlanmasını kolaylaştırır. Tripsin yöntem ile karşılaştırıldığında, daha fazla doku (bir yaklaşım Şekil 2D bakınız) gereklidir. </li><li> Yavaşça, çizik tabak (doku parçaları görünür ve ideal tırmalama hareketinden hareketsiz olacak) büyüme ortamı 2 ml ekleyin. </li><li> Belirli bir hücre kültürü inkübatöründe için plaka (lar) aktarın (37 ° C ve% 5 CO2). Uzak oth, primer hücre hatları için bir yer tayinHücre kültür tabakları er. Primer kültürler enfeksiyon ve kontaminasyon daha duyarlıdır. </li><li> Günlük ışık mikroskobu altında hücreleri inceleyin. Küçük hücre popülasyonları (Şekil 3B) dilimlenmiş dokuların etrafında güne iki veya üç tarafından ortaya olmalıdır. </li><li> , Kültürleri korumak 1X PBS ile hafifçe yıkayın ve her üç günde bir, taze büyüme ortamı (2 ml) ekleyin. Proliferasyon hızı artar, daha fazla büyüme ortamı (3-4 mi) 6 cm kültür plakasına (lar) ilave edilebilir olduğunda. Not: yıkama ve ortam değişiklikleri sırasında, doku parçaları büyük olasılıkla aspire edilecektir. Bu yapışık hücre büyümesini etkilemez. Yeni koloniler bir hafta sonra ortaya vermemektedirler gibi doku parçaları bir sonraki aşamada (2.10) tarafından aspire edilmelidir. </li><li> % 0.05 tripsin kullanılarak% 80 birleşmiş (Şekil 3B), pasaj - 6 cm plaka yaklaşık 75 olduğunda. Birincil hücreler süresiz pasajlandığında edilemez - iki ya da üç tabak ma kısa sürede hücrelerin bir tabak aşağı dondurmakintained. Daha fazla geçit gerekiyorsa, (Ref 3 gözden) bir ölümsüzleşme protokolünü uygulayın. </li></ol> Tripsin Yöntemi kullanılarak Primer Hücre Hatları 3. Hazırlanması <ol><li> Kanamisin (0.03 mg / ml son konsantrasyon) ile takviye edilmiş% 0.25 tripsin ve 2 ml endometrial doku küçük bir parça (bir yaklaşım Şekil 2D bakınız) yerleştirin. </li><li> 30 dakika süreyle dönen bir platform 37 ° C&#39;de doku inkübe edin. </li><li> Kısaca doku girdap. </li><li> 2 dakika boyunca 200-400 xg&#39;de örnek santrifüj ve süpernatant atın. </li><li> Taze tripsin ve Kanamisini ekleyin. </li><li> Bir saat boyunca dönerken 37 ° C&#39;de doku inkübe edin. </li><li> 5-10 saniye için doku vorteksleyin. </li><li> Tripsin devre dışı bırakmak için (% 10 Fetal Sığır Serumu ve% 1 penisilin-streptomisin ile takviye edilmiş) 2 ml büyüme ortamı ekleyin. </li><li> 2-3 dakika boyunca 200-400 xg&#39;de Santrifüj hücreleri. </li><li> Süpernatantı atın ve büyümeye 2 ml ekleyintopak hücrelere th ortam. </li><li> 6 cm hücre kültürü çanak üzerine Plate. Kazıma Yöntemi kullanılarak primer hücre hatları hazırlanması Aşama 2.5 ile plaka kazınması gerekli değildir, ancak primer kültürlerin eki ve büyümesini artırır. </li><li> Günlük ışık mikroskobunda hücreyi izleyin. Hücreler (Şekil 3C), 24-48 saat sonra, bir ışık mikroskobu altında genellikle görebilir. </li><li> Kültürleri korumak için, hücreleri izlemek ve Aşama 2.9 &#39;da olduğu gibi her 2-3 günde bir ortam değiştirin. </li><li> Hücreler% 75-80 konfluense (Şekil 3C) ulaştıklarında geçişi için hücreler,% 0.05 ya da% 0.25 tripsin kullanın. </li></ol> 4. Ekstra Analiz Doku (Yapış Dondurma ve Formalin Fixation) Tasarruf <ol><li> 1X PBS ile iki kez numune yıkayın. </li><li> Mümkün olduğu kadar sıvı aspire. </li><li> Yapış Donma için, (Şekil 2F ve 2G bakınız) 1.7 santrifüj tüpüne endometriyal doku örneği yerleştirin. 1,7 yerleştirinSantrifüj tüpü 10 saniye boyunca sıvı azot ya da kadar donmuş doku aşağı olduğu görülmektedir. Not: örnekleri hazırlarken doğrudan sıvı azot dokunmamaya özen gösterin. Numuneler, daha ileri işleme veya analiz edilinceye kadar -80 ° C&#39;de muhafaza edilebilir. </li><li> Formalin fiksasyonu için, endometriyal doku (Şekil 2H bakınız) küçük bir parça kesip, ve% 10 tamponlu formalin çinko daldırın. 24 saat sonra, formalin atmak ve tekrar işlenene kadar doku numunelerini,% 70 etanol ekleme. </li></ol> 5. İmmünofloresan (IF) <ol><li> Hücre sabitleme <ol><li> Bir kültür slayt veya tabakta hücreleri hazırlayın. </li><li> Yavaşça, 1X PBS ile hücreleri yıkayın. </li><li> 5 dakika boyunca (bir 1:1 oranında karıştırılmış) önceden soğutulmuş (4 ° C) bir metanol ve aseton ekleyin. </li><li> Hava geçmeden önce slayt kurulayın. Gerekirse Slide 1-2 hafta boyunca 4 ° C&#39;de saklanabilir. </li></ol></li><li> İşlem IF <ol><li> 10 dakika boyunca 1X PBS ile hücreler rehidrate. FO içinllowing dönen bir platform üzerinde tüm yıkar ve inkubasyon yapmak, 1-6 adımları. </li><li> 1X PBS kullanılarak blok,% 1 Sığır Serum Albümini (BSA) ile takviye edilmiş ve oda sıcaklığında (RT) 30 dakika boyunca% 1 türe özel serum (2. antikor kaynağı). </li><li> (Antikor dilüsyonları için üreticilerin tavsiyelerine bakın) primer antikor inkübe. Özel antikorlar için malzemeler bakınız. Aşama 5.2.2 &#39;de olduğu gibi, taze bloke edici tampon birincil antikor seyreltin. Bu inkübasyon, oda sıcaklığında ya da gece boyunca 4 ° C&#39;de en az 2 saat boyunca yapılabilir </li><li> 5 dakika her biri için 1X PBS ile 3 kez yıka. </li><li> (Antikor dilüsyonları için üreticilerin tavsiyelerine bakın) ikincil antikor inkübe edin. Adım 5.2.2 gibi taze engelleme tamponda ikincil antikor sulandırmak. Foto-ağartma önlemek için, ışık yokluğunda bu ve daha sonraki adımlar yapmak için önemlidir. </li><li> 5 dakika her biri için 1X PBS ile 3 kez yıka. </li><li> Thoroughly slaytlar kurulayın. </li><li> Montaj ortamı ve DAPI karşı boyama solüsyonu ekleyin. </li><li> Lamel uygulayın ve yapıştırıcı (ler) kullanarak kenarları mühür. Slaytlar kadar 2 hafta boyunca karanlıkta 4 ° C&#39;de saklanabilir. </li></ol></li></ol> 6.. RNA Ekstraksiyon <ol><li> Santrifüj ile x 1 10 7 hücrelerinin Pelet. Bu protokol tüm malzemeler ve reaktifler ücretsiz RNAz edilmelidir. </li><li> 1 ml Trizol reaktifi ve nükleoprotein kompleksleri ayrılmasını tamamlamak için oda sıcaklığında 10 dakika boyunca homojenize örnekleri inkübe olarak Hücreleri,. </li><li> Trizol 1 ml kloroform başına 200 ul ekle. 15 saniye boyunca elle kuvvetli bir şekilde çalkalanır ve oda sıcaklığında 2-3 dakika inkübe edilir. </li><li> 4 ° C&#39;de 15 dakika süreyle maksimum hızda (15,000 xg) santrifüje Üç katmanları neden olacaktır. </li><li> Yeni bir mikrosantrifüj tüpü içine üst sulu faz transfer. RNA verimi artırmak için 1 ul glikojen ekleyin; Ancak bu adım sadece gerekli olduğunda, küçük birRNA miktarı tahmin edilmektedir. </li><li> Sulu tabakaya, izopropil alkol, 0.5 ml ilave edilir, ve örnekler 3-5 kez ters çevirin. 10 dakika boyunca oda sıcaklığında inkübe edin. Verimini artırmak için, numuneler, 30 dakika boyunca -20 ° C veya -80 ° C de yerleştirilebilir. </li><li> 4 ° C&#39;de 10 dakika maksimum hızda santrifüje </li><li> Bu noktada, RNA küçük topak görünür olmalıdır. Süpernatant atın. </li><li> % 75 etanol içinde 1 ml RNA yıkayın. </li><li> 5 dakika boyunca maksimum hızda santrifüj ve süpernatant atın. Numuneler, bir kez inorganik kirletici maddeleri kurtulmak için daha yıkanabilir, fakat bu adım gerekli değildir. </li><li> RNA pelet kuru kadar kısa bir süre (genellikle 7-10 dakika sürer) RNA pelet kurulayın. Not: Bir ek adım inorganik maddeler azalır ve kurutma süresini azaltmak için kullanılabilir. Ek bir dakika ve aspirat kalıntı sıvı için maksimum hızda etanol yıkaması, spin örneklerinden süpernatant atılmasından sonra. Pelet aspire etmemeye dikkat edin. </li><li> RNA pelet boyutuna bağlı olarak, RNase-içermeyen su içinde RNA çözülür. Hacimleri 10-50 ul arasında değişir. </li><li> 10 dakika boyunca 55 ° C&#39;de inkübe edin ve RNA konsantrasyonları ölçülür. </li><li> Daha sonra işlenene kadar -20 ° C&#39;de saklayın örnekleri. </li></ol> 7. Ters Transkripsiyon <ol><li> H2O ile 9 ul bir hacme örnek RNA (1-3 ug) getirin </li><li> 10 dakika boyunca 70 ° C&#39;ye kadar ısı RNA. </li><li> DNTP 5 ul (50 uM çalışma konsantrasyonu), N6 DNA oligo 5 ul (80 uM çalışma konsantrasyonu), 5X AMV tampon çözeltiden 5 ul ve AMV 1 ul: Bir AMV ana karışımı oluşturmak için, aşağıdaki reaktifler kombine . Bu ana karışımı çözelti bir numune başına tasarlanmıştır. </li><li> Isıtmalı RNA&#39;ya ana karışımı 16 ul ekleyin. Nihai reaksiyon hacmi 25 ul reaksiyon olacaktır. </li><li> (Aşama 1), 90 dakika boyunca 42 ° C, (Sta: ters transkripsiyon için, aşağıdaki koşulları kullanarak PCR5 dakika ve daha sonra işlenene kadar (Aşama 3), 4 ° C ge 2) 95 ° C. </li></ol> 8. Real Time PCR <ol><li> Tablo 1 &#39;de bulunan primerler, tavlama sıcaklıkları, devir sayıları ve reaktif maddeler kullanılarak PCR reaksiyonları yürütmek için. Not: (Malzeme şirket ve katalog numaraları bakınız) PCR bileşenlerini kullanırken üretici talimatları takip etmek için idealdir. </li></ol> 9. (Ref. 4 ve 5&#39;te elde edilir) In vitro desidualizasyon Protokol <ol><li> Endometrial hücreler Plate. </li><li> % 75-85 bir konfluansa kadar büyür. </li><li> Hücreler konfluent hale sonra, 1X bir kez PBS ile yıkayın. </li><li> Çabuk, (Fenol RPMI% 5 kömür şerit FBS ve% 1 penisilin-streptomisin ile takviye edilmiş) hormonsuz ortam ekleyin. </li><li> 24 saat sonra, 1 uM 8-3 Bromoadenosine bir son konsantrasyonda medroksiprogesteron asetat (MPA) ile desteklenmiş Hormonsuz ortam &#39;, 5&#39; ekleme0.5 mM&#39;lik bir son konsantrasyonda-siklik monofosfat (cAMP). </li><li> En az 48 saat sonra, reaksiyonu durdurmak ve daha ileri işleme için plaka (lar) kaydedin. </li></ol>

<ol>
	<li>Heller, D., Heller, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> in The endometrium: a clinicopathologic approach. , 56-75 (1994).</li><li>Emera, D., Romero, R., Wagner, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+menstruation:+a+new+model+for+genetic+assimilation:+explaining+molecular+origins+of+maternal+responses+to+fetal+invasiveness.">The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness.</a> Bioessays. 34, 26-35 (2011).</li><li>Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+protocols+used+in+cell+culture+models+of+human+breast+morphogenesis.">Immortalization protocols used in cell culture models of human breast morphogenesis.</a> Cell Mol Life Sci. 61, 2523-2534 (2004).</li><li>Brosens, J. J., Hayashi, N., White, J. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progesterone+receptor+regulates+decidual+prolactin+expression+in+differentiating+human+endometrial+stromal+cells.">Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells.</a> Endocrinology. 140, 4809-4820 (1999).</li><li>Jones, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+SUMO+pathway+sensitizes+differentiating+human+endometrial+stromal+cells+to+progesterone.">Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone.</a> Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).</li><li>Salamonsen, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+the+human+endometrium+and+uterine+fluid:+a+pathway+to+biomarker+discovery.">Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery.</a> Fertil Steril. 99, 1086-1092 (2013).</li><li>Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+human+endometrial+receptivity+from+transcriptomic+and+proteomic+data.">Insights into human endometrial receptivity from transcriptomic and proteomic data.</a> Reprod Biomed Online. 24, 23-34 (2012).</li><li>Chen, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+characterization+of+midproliferative+and+midsecretory+human+endometrium.">Proteomic characterization of midproliferative and midsecretory human endometrium.</a> J Proteome Res. 8, 2032-2044 (2009).</li><li>Talbi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+phenotyping+of+human+endometrium+distinguishes+menstrual+cycle+phases+and+underlying+biological+processes+in+normo-ovulatory+women.">Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women.</a> Endocrinology. 147, 1097-1121 (2006).</li><li>Punyadeera, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oestrogen-modulated+gene+expression+in+the+human+endometrium.">Oestrogen-modulated gene expression in the human endometrium.</a> Cell Mol Life Sci. 62, 239-250 (2005).</li><li>Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+human+endometrium+during+the+menstrual+cycle.">Molecular profiling of human endometrium during the menstrual cycle.</a> Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).</li><li>Zhang, L., Rees, M. C., Bicknell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+isolation+and+long-term+culture+of+normal+human+endometrial+epithelium+and+stroma.+Expression+of+mRNAs+for+angiogenic+polypeptides+basally+and+on+oestrogen+and+progesterone+challenges.">The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges.</a> J Cell Sci. 108 (1), 323-331 (1995).</li><li>Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblast+cells+from+term+human+decidua+closely+resemble+endometrial+stromal+cells:+induction+of+prolactin+and+insulin-like+growth+factor+binding+protein-1+expression).">Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression).</a> Biol Reprod. 52, 609-615 (1995).</li><li>Gellersen, B., Brosens, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+AMP+and+progesterone+receptor+cross-talk+in+human+endometrium:+a+decidualizing+affair.">Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair.</a> J Endocrinol. 178, 357-372 (2003).</li><li>Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+characterization+of+endothelin+released+by+human+endometrial+epithelial+cells+in+culture.">Production and characterization of endothelin released by human endometrial epithelial cells in culture.</a> J Clin Endocrinol Metab. 79, 1625-1631 (1994).</li><li>Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histochemical+identification+of+cultured+cells+from+human+endometrium.">Histochemical identification of cultured cells from human endometrium.</a> In Vitro. 20, 25-32 (1984).</li><li>Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase+production+by+cultured+human+endometrial+stromal+cells:+identification+of+interstitial+collagenase,+gelatinase-A,+gelatinase-B,+and+stromelysin-1+and+their+differential+regulation+by+interleukin-1+alpha+and+tumor+necrosis+factor-alpha.">Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha.</a> J Clin Endocrinol Metab. 79, 530-536 (1994).</li><li>Dimitriadis, E., Robb, L., Salamonsen, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin+11+advances+progesterone-induced+decidualization+of+human+endometrial+stromal+cells.">Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 8, 636-643 (2002).</li><li>Sakai, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+histone+acetylation+in+ovarian+steroid-induced+decidualization+of+human+endometrial+stromal+cells.">Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells.</a> J Biol Chem. 278, 16675-16682 (2003).</li><li>Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cyclic+AMP+and+estrogen/progesterone+on+the+transcription+of+DNA+methyltransferases+during+the+decidualization+of+human+endometrial+stromal+cells.">Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells.</a> Mol Hum Reprod. 19, 302-312 (2013).</li><li>Tamura, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+IGFBP-1+expression+by+cAMP+is+associated+with+histone+acetylation+status+of+the+promoter+region+in+human+endometrial+stromal+cells.">Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells.</a> Endocrinology. 153, 5612-5621 (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> American Society for Reproductive Medicine: Quick facts about infertility. , (2013).</li><li>Salker, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+selection+of+human+embryos:+impaired+decidualization+of+endometrium+disables+embryo-maternal+interactions+and+causes+recurrent+pregnancy+loss.">Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss.</a> PLoS One. 5, (2010).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Diğer gruplar kolajenaz 4,12,13,15-18 kullanan çoğu endometriyal stromal kültürleri, hazırlanması için bir yöntem tarif adapte edilmiştir. Bu yazıda, ekonomik nedenler ve tripsin ve / veya jilet uygun kullanılabilirliği için bizim laboratuvarda tarafından kullanılan her ikisi de iki basitleştirilmiş temel endometrial stromal kültür yöntemleri için metodoloji ve kanıt sağladı. Bizim iki yöntem kıyaslarken, hem başarıyla uygulanabilir birincil kültürleri üretmek. Daha küçük bir numune boyutu şartı ile, tipik olarak yüksek bir verim saptandığı gibi tercih edilen bir yöntem olup, tripsin yöntemdir. Hazırlık süresi sınırlı ise tripsin yöntemini kullanarak hücreleri kaplama bir saat bir buçuk daha alır oysa Ancak, kazıma yöntemi 30 dakika gerektirir. Dikkat çekici endometrial biyopsi karşıt olarak biz histerektomi örnekler bu yöntemleri göstermek olmasıdır. Endometrial biopsies önemli saldırı olmadan alınan ve daha küçük örnekleri üretmek için eğilimindedir. Yine de, bu yazının (özellikle tripsin yöntemi) &#39;de tarif edilen yöntemler, endometrial biyopsi ikinci kültürleri verim gerekir. Birincil endometrial stromal hücreler için çok sayıda uygulama vardır. Diğer memeliler karşı insan endometriyal stromal kültürlerini karşılaştıran insanlar regl neden hakkında yüzyıllardır tartışılan edilmiştir sorulara ipuçları sağlayabilir. In vitro kültür gerektiren diğer keşfedilmemiş fizyolojisi çalışmalar vardır. Özel ilgi gibi üreme döngüsü 19,20, 21 fonksiyonel olaylara epigenetik moleküler olayları bağlantılı ve Ref 11 inceledik bulguları olarak üreme döngüsü olaylar içgörü sağlamak keşifler. Klinisyenler endometrial stromal kültür, eğitim ve biyogöstergesini belirlenmesi büyük ölçüde yararlanacaküreme bozuklukları ve kanser malignitelerin durumlarda s. 2006 ve 2010 yılları arasında, bu 7,4 milyon kadın ve eşleri Amerika Birleşik Devletleri&#39;nde 22 kısırlık hizmetlerini kullandıkları bildirildi. Kısırlığın önemli bir yüzde desidualizasyon 23 yetmezliği kaynaklanmaktadır. Ayrıca, bu tür kısırlığa hiperplazi ve endometrioz gibi endometrial hastalıklar arasındaki ilişki yakın zamanda değerlendirilmektedir. Gelişmiş endometrial sarkom nadir bile olsa, bu ölümcül olabilir çünkü in vitro modelleme yoluyla rahim jinekolojik kanserlerin çalışma kapasitesi de ölçülemez. Vitro primer kültürlerinde kurarak, biz hastalıkları ile ilişkili moleküler olayların etkisini incelemek ve farazi klinik uygulamaları oluşturabilirsiniz. Sonuç olarak, bu uygulamaların çoğu için temsili ve in vivo modellerde etkili üretilmesi zordur. Bu, içinde geliştirme yaparçeşitli in vivo işlevler kritik incelemek için birincil endometrial kültürleri vitro. Bu iki endometrial izolasyon yöntemleri, &quot;kazıma yöntemi&quot; ve &quot;tripsin yöntemi,&quot; endometrial fizyolojisi ve patolojisi anlayışımız için dayanak sağlamaya yardımcı olacaktır.

Insan uterus gövdesi üç tabakadan, perimetrium (ya da salgılı zarı), myometrium ve endometrium oluşur. Bu tabakaların her biri ayırt endometrial hücre serilerini kurmak için önemli bir adımdır. Perimetrium rahim en dış tabaka ve ince, seröz hücrelerden oluşur. Myometrium kalın, orta rahim tabakası ve yumuşak kas hücrelerinin oluşur. Endometrium rahim iç tabaka olarak tanımlanmıştır ve epitel ve stromal hücre popülasyonları içerir. Endometrium ayrıca olan kök hücre popülasyonunun yaklaşık olarak her 28 günde bir 1 functionalis tabaka yeniden doldurmak için hipotezi basalis tabaka halinde bölünmüştür. İnsan endometrium tabakası functionalis hormonları dolaşan yanıt önemli biyokimyasal ve morfolojik değişikliklere uğrar. Bu hormonlar hipofiz bezi ve yumurtalıklar türetilir. bir üreme döngüsü koordine üretim ve hormonlar sonuçların serbest. Üreme döngüsü potansiyel embriyo implantasyon olaylar için endometrium hazırlamak için tasarlanmıştır. İnsanlarda, üreme döngüsü &quot;adet döngüsü&quot; olarak bilinen ve üç evreye ayrılır - çoğalma, salgı ve adet. Salgı faz functionalis olgunlaşması ile işaretlenmiş ise çoğalma fazı functionalis endometrial tabakanın proliferasyonunu içerir. Spesifik olarak, hücre dışı değişiklikler, salgılar ve hücresel farklılaşma potansiyel implantasyonu işaret etmektedir. Implantasyon salgı aşamasının bitiminden önce oluşmazsa, functionalis endometrium tabakası adet aşamasında dökülüyor. Âdet ve functionalis tabakasının dökülmesini tetikleyen olayların önemi hala tartışılmaktadır. İnsanlarda, bu adet bilinen özel bir orta salgı faz farklılaşması olayın sonucu olduğunu ortaya edilmiştir&quot;spontane sidualizasyonu&quot; 2 olarak. Bu yazıda, iki endometrial stromal hücre izolasyon yöntemleri için detaylı metodoloji sağlamak ve bu yaklaşımların etkinliğini göstermek için immünofloresans ve dijital görüntülerin bir arada kullanın. Ayrıca, yaygın olarak uygulanır endometriyal stromal hücre izolasyonu teyit etmek için kendiliğinden desidualizasyon in vitro modelde kullanılan a.

<table border="0" cellpadding="0" cellspacing="0" width="713">
	<tbody>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">0.25 Trypsin or 0.05% Trypsin&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH3023602 or SH30004202&#160;&#160;</td>
			<td style="width:63px;"></td>
		</tr>
		<tr height="27">
			<td dir="LTR" height="27" style="height:27px;width:235px;">1.7 micro Centrifuge Tube&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">22-272A&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">1&#181;l,20&#181;l, 200ml and 1000&#181;l Pipette&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Genesee Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">24-401,24-402, 24-412, 24-430&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">15ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339650</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">50ml Conical Tube&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">339652</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">6cm Cell Culture Dish&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-556-002&#160;</td>
			<td></td>
		</tr>
		<tr height="22">
			<td dir="LTR" height="22" style="height:22px;width:235px;">8 well Chambers&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Acetate&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher scientific&#160;</td>
			<td dir="LTR" style="width:216px;">C4-100&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">AMV RT Enzyme/Buffer&#160;</td>
			<td dir="LTR" style="width:201px;">Bio Labs&#160;</td>
			<td dir="LTR" style="width:216px;">M077L&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Bovine Serum Albumin (BSA)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-1605-100&#160;</td>
			<td></td>
		</tr>
		<tr height="23">
			<td dir="LTR" height="23" style="height:23px;width:235px;">Buffered Zinc Formalin&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">59201ZF&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Charcoal strip FBS&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher&#160;</td>
			<td dir="LTR" style="width:216px;">NC9019735&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Chloroform&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP1145-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cover slip&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Brand&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">12-544D&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">Cyclic AMP (cAMP)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">B7880</td>
			<td></td>
		</tr>
		<tr height="24">
			<td dir="LTR" height="24" style="height:24px;width:235px;">DMEM/High Glucose&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;</td>
			<td dir="LTR" style="width:216px;">SH30243FS&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:235px;">dNTP&#160;</td>
			<td dir="LTR" style="width:201px;">Bioline&#160;</td>
			<td dir="LTR" style="width:216px;">BIO-39025&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Anti Goat -TRITC&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-3855&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Donkey Serum&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s lab&#160;</td>
			<td dir="LTR" style="width:216px;">&#160;017-000-002&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">E Cadherin Antibody&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">1702-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Ethanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">BP2818-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific</td>
			<td dir="LTR" style="width:216px;">03-600-511&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Fungizone Amphotericin B&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">15290-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">GAPDH Probe&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">HS99999905&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Glycogen&#160;</td>
			<td dir="LTR" style="width:201px;">5Prime&#160;</td>
			<td dir="LTR" style="width:216px;">2301440</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Goat Anti Mouse -FITC&#160;</td>
			<td dir="LTR" style="width:201px;">Jackson&#8217;s Lab&#160;</td>
			<td dir="LTR" style="width:216px;">115-096-003&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Isopropanol&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP2618-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Kanamycin&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP906-5&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Medroxyprogesterone acetate (MPA)&#160;</td>
			<td dir="LTR" style="width:201px;">Sigma&#160;</td>
			<td dir="LTR" style="width:216px;">M1629</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">MeOH (Methanol)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">A4-08-1&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Mounting Media (w/DAPI)&#160;</td>
			<td dir="LTR" style="width:201px;">Vector Labratories&#160;</td>
			<td dir="LTR" style="width:216px;">H-1500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">N6 DNA Oligos&#160;</td>
			<td dir="LTR" style="width:201px;">Invitrogen&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Number 15 Scraper&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">BD&#160;</td>
			<td dir="LTR" style="width:216px;">371615</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Pan Cytokeratin&#160; Mouse mAB&#160;</td>
			<td dir="LTR" style="width:201px;">Cell Signaling&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">4545</td>
			<td></td>
		</tr>
		<tr height="29">
			<td dir="LTR" height="29" style="height:29px;width:235px;">PBS (phosphate buffered saline)&#160;</td>
			<td dir="LTR" style="width:201px;">Fisher Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">BP-399-4&#160;</td>
			<td></td>
		</tr>
		<tr height="41">
			<td dir="LTR" height="41" style="height:41px;width:235px;">Penicillin-Streptomycin Glutamine Solution 100X&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SV30082.01&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">PML Anti Goat Anti body&#160;</td>
			<td dir="LTR" style="width:201px;">Santa Cruz&#160;</td>
			<td dir="LTR" style="width:216px;">SC-9862&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Primer(s)&#160;</td>
			<td dir="LTR" style="width:201px;">Eurofins&#160;</td>
			<td dir="LTR" style="width:216px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI&#160;</td>
			<td dir="LTR" style="width:201px;">Hyclone&#160;&#160;</td>
			<td dir="LTR" style="width:216px;">SH30027FS&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">RPMI (Phenol free)&#160;</td>
			<td dir="LTR" style="width:201px;">Gibco&#160;</td>
			<td dir="LTR" style="width:216px;">11835</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Sybr Green&#160;&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo Scientific&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4162&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Taqman&#160;</td>
			<td dir="LTR" style="width:201px;">Thermo&#160;</td>
			<td dir="LTR" style="width:216px;">AB-4138</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Trizol&#160;</td>
			<td dir="LTR" style="width:201px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:216px;">15596018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:235px;">Vimentin Antibody&#160;</td>
			<td dir="LTR" style="width:201px;">Epitomics&#160;</td>
			<td dir="LTR" style="width:216px;">4211-1</td>
			<td></td>
		</tr>
	</tbody>
</table>

two methods for establishing primary human endometrial stromal cells from hysterectomy specimens

Pek çok çabalar vitro hücre kültür sistemleri kurmak için tahsis edilmiştir. Bu sistemler, in vivo işlemler geniş bir model numarası tasarlanmıştır. İnsan endometriyal örnekleri kaynaklanan hücre kültürü sistemleri bir istisna vardır. Uygulamalar normal siklik fizyolojik süreçler böyle jinekolojik kanserler, bulaşıcı hastalıklar ve üreme eksiklikleri gibi endometrial patolojilerin değişir. Burada, biz, cerrahi rezeksiyon, endometrial histerektomi örneklerden birincil endometrial stromal hücreler kurmak için iki yöntem sağlar. İlk yöntem, &quot;kazıma yöntemi&quot; olarak adlandırılır ve ikinci yöntem adlandırılır ise, cerrahi ya da tıraş bıçakları kullanılarak, mekanik kazıma içeren bir &quot;tripsin yöntemi.&quot; Bu ikinci yöntem, hücrelerin ayrılmasını teşvik etmek için birincil ve tripsin enzimatik aktivitesini kullanır hücre akıbet. Biz dijital görüntü ve mikroskobu ile adım-adım yöntemi açıklamak. Ayrıca providkantitatif gerçek zamanlı polimeraz zincir reaksiyonları (qPCR) ve immünfloresansta (IF) üzerinden endometrial stromal hücre hatları doğrulamak için e örnekleri.

Protokol bölümünde vurgulandığı gibi, insan doku kullanımı ve hazırlarken tüm kurumsal hükümet altında yöntemleri ve etik kurallara yapmak için emin olun. &quot;Kazıma yöntemi&quot; genel iş akışı bir örnek (Şekil 1A) ve primer endometrial kültürleri kurmak için kullanılan &quot;tripsin metodu&quot; (Şekil 1B) bu yazının da dahildir. Bu yöntemler Protokol bölümünde ayrıntılı olarak tarif edilmiştir (parça 1 e bakınız -. 3..). Her iki yöntem de, birincil endometrial kültürlerin büyümesinin başarılı kanıtlamaktadır. Avantaj &quot;kazıma yöntemi&quot; kısaltılmış hazırlık zamanı için; göre 4 kat daha uzun - ancak, bu canlı hücreleri gözlemlemek için gereken zamanı 2 genellikle &quot;tripsin yöntemi.&quot; Doku tedarik alınan ilk insan dokusunda dijital görüntüler sağladı. Rahim tabakaları ile ayırt edilebilirTabakanın irilik, myometrium yani kalın ve kas ve endometrium ince ve daha verimli olduğunu. Biz beyaz kalın, düz kas tabakası (myometrium) vurgulanmış ve iki farklı histerektomi numuneler (Şekil 2A ve 2B) siyah ilgi endometrium tabakası hatlarıyla. Şekil 2C, dokular endometrium aşağı konumlandırılmış iken miyometriyum yukarı bakacak şekilde yönlendirilmiştir. İnce, perimetrial tabaka cerrahi rezeksiyon ve bu görüntüleri vurgulanan değildi. Bu dijital 2 boyutlu görüntüler endometrial tabakanın boyutu gerçek 3 boyutlu tabaka myometrium kıyasla çok ince olduğu gibi yanlış olduğuna dikkat etmek de önemlidir. Uygun doku boyutunu Kesme &quot;kazıma yöntemi&quot; ve her ikisi için önemli olan &quot;tripsin yöntemi.&quot; Şekil 2B, uygun boyutlarda ayrı ayrı numunenin üstüne, her yöntem için belirlenir. Bir 0.5x0 kullanma&quot;Tripsin yöntemi&quot; [left] .5 x0.5 cm parça kültürünün yerleşmesi için yeterlidir. &quot;Kazıma yöntemi&quot; [sağ] için temsili başlangıç ​​dokusu tüm rahim katmanları içerir. &quot;Kazıma yöntemi&quot; için nihai ürün, Şekil 2E&#39;de temsil edilir, ve endometriyal dokunun en az 1x1x1 cm uygun bir kültürleri oluşturmak için kullanılması önerilir. Bu çok doku numunesi için gereksinim bir dezavantaj &quot;kazıma yöntemi.&quot; Kalan doku çoğunlukla proteini içeren ve RNA analizleri çeşitli şekillerde kullanılmaktadır. Doku kalitesinin korunmasını sağlamak için, (4&#39;e bakın.) Protokol bölümünde olduğu gibi bir &quot;ani dondurularak&quot; yöntemini kullanmak önemlidir. Bu yöntem aynı zamanda Şekil 2F ve 2G Şekil &#39;de gösterilmiştir. Formalin fiksasyonu ekstra doku tasarrufu da patologlar ve araştırmacıların yaygın bir uygulamadır. Formalin fiksasyonu için hazırlanıyor doku Protokolü anlatılan </stRong&gt; bölüm (. 4) ve Şekil 2H&#39;de resimli. Işık mikroskopisi birincil endometrial kültürleri izlenmesi için gereklidir. Bağımsız endometriyal stromal fibroblast hücrelerin morfolojisi (Şekil 3A) göstermelidir. &quot;Kazıma yöntemi&quot;, tipik olarak esas olarak bisturi kaynaklı çizik (Şekil 3B, Gün 2) boyunca, erken ortaya çıkan hücre kümeleri oluşturur. &quot;Tripsin yöntemi&quot; küme ve dağınık hücre büyüme modelleri (Şekil 3C, Gün 4) hem de üretir. Her yöntemiyle (Şekil 3B ve 3C) ilk geçişi için ilk kaplama (gün 0) itibaren bir kaç temsili görüntü dahil ettik. Geni ve protein ekspresyon deneyleri endometriyum 6-11, en-için yapılmıştır da birçok dokular vs bağışıklık kök hücreleri, düz kas, CD34 için düz kas aktin (SMA), gibi dokuya özel belirteçler onların ifadesi ile tanımlanmaktadırdometrial stromal hücre özel markör henüz tespit edilmesi gerekir. Bunun yerine, araştırmacılar genellikle potansiyel hücre kirliliklerden belirteçleri ölçülerek endometrial stroma saflığı değerlendirmek. Örneğin, sitokeratin belirteçler epitel popülasyonları göstermek için kullanılır. Kurulması ve endometrial epitelyum zor ve genelde (Ref 12 ve Şekil 4A), karşı seçilir muhafaza Ancak, bu, bir endişe daha azdır. Numuneler hamilelik, HLA-A pozitif ekspresyonu sırasında elde edilecek olursa,-B,-C germ, trofoblast hücrelerin 13 göstermektedir. Öte yandan, diğer mezenşimal fibroblastlar gibi, endometriyal stromal hücreleri vimentin (CDH1) ifade eder. Biz immünofloresans, vimentin ifadesi ve bizim kurulan endometrial stromal hücreleri (Şekil 4B) sitokeratin ve E kadherin (CDH1) yokluğu ile göstermek. Son olarak, bir i ile birincil endometrial kültür fonksiyonel kanıtn spontan sidualizasyonu deneyi vitro. Bu yöntem, Referans 4 ve 5 uyarlanmıştır ve medroksiprogesteron asetat (MPA) ve 8 bir kombinasyonu ile kültürlerin muamele edilmesini içerir edilmiş - Bromoadenosine 3 &#39;, 5&#39;-siklik monofosfat 9&#39;da tarif edildiği gibi (cAMP) (In vitro desidualizasyon protokol ve model. Şekil 5A). MPA ve cAMP varlığında, endometriyal stromal hücreler (Ref 14 gözden) önemli ölçüde değiştirilmiş gen ekspresyon profillerini gösterir. Sık sık yayınlanan spontan sidualizasyonu belirteçleri prolaktin (PRL) ve Protein 1 (IGFBP1) Cilt İnsülin benzeri Büyüme Faktörü (Ref 14 gözden). MPA ve cAMP için bu iki genin yanıt kendiliğinden desidualizasyon ve endometriyal stromal kültürünün başarılı kurulması hem de güçlü bir göstergesidir. Biz, Şekil 5B&#39;de bu göstermektedir. Şekil 1. İki birincil endometrial izolasyon yöntemleri şematik. (A) (B). Bir organizasyon şemasında gösterilen kazıma yöntemi 2,1-2,10 adımları bir organizasyon şemasında gösterilen tripsin yöntemi 3,1-3,14 adımları. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig1highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın.</a> <img alt="Şekil 2," fo:content-width="2.75in" src="/files/ftp_upload/51513/51513fig2highres.jpg" width="500" /> Şekil 2.. Rahim dokusu işleniyor. Iki kadın hastaların (AC) Clinical rahim örnekleri. Hasta A &amp; C 1 &#39;den türetilen ve oda Hasta 2 elde edilir. Cerrahi olarak kesilmiş rahim dokusu (sol) ve highlighted rahim katmanları (sağda). (A &amp; B) miyometriyum siyah beyaz ve endometrium daire içinde. (C) miyometriyum kamera karşı karşıya. (D) hem de izolasyon yöntemleri için ilk temsili endometrial örnek boyutları gösterilir. Kazıma yöntemi, tüm rahim örnekleri de kullanır ise tripsin yöntem olup, tripsin ilave edilmeden önce saf endometrium gerektirir. Kazıma yöntemin işleme endometrial numunesinin (E) Örnek. (F ve G) Snap hazırlanan kalan rahim dokusu görüntü Dondurucu. Gösterilen bu yöntem için kullanılan bir laboratuvar yapımı metal kaptır. (H) endometriyal numune formalin fiksasyonu. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig2highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın.</a> <img alt="Şekil 3," fo:content-width="3in" src=&quot;/ Files/ftp_upload/51513/51513fig3highres.jpg&quot; width = &quot;400&quot; /&gt; Şekil 3.. Primer endometrial kültürlerin Işık mikroskobu görüntüleri. . (A) çeşitli güçlerde ve confluency alınan endometrial stromal hücre kültürlerinin Temsilcisi görüntüleri (B) kazıma yöntemi (Gün 0 - 16) Temsilcisi görüntüleri 10x güç aynı kültür çanak, alınan Not:. Görsel çizgiler çizikleri gösteriyor cerrahi bıçak tripsin yöntemi (C) Temsilcisi görüntüler.. (Gün 0 - 16) 10x güç aynı kültür çanak, alınan <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig3highres.jpg" target="_blank">büyük resmi görebilmek için buraya tıklayın.</a> <img alt="Şekil 4," fo:content-width="4in" src="/files/ftp_upload/51513/51513fig4highres.jpg" width="400" /> Şekil 4. Endometriyal stromal hücrelerin İmmünofloresan görüntüler. (A) İmmünofloresanbirincil endometrial kültürlerin kazıma yöntemi ile izole edilmiştir. Görüntü kanalı 2 (P2) ve geçiş 5 (P5) arasında sitokeratin kaybını göstermektedir. Promiyelositik lösemi protein (PML), nükleer protein ve DAPI boyama kontrol olarak kullanılmıştır. (B) Görüntüler, mezenkimal işaretleyici Vimentin için pozitif lekeleme göstermiştir. Görüntüler ayrıca E kadherin (CDH1) ve Sitokeratin için negatif boyanma gösterir. DAPI ve Promiyelositik lösemi protein (PML) için boyama kontrol olarak verilmiştir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig4highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın.</a> <img alt="Şekil 5," fo:content-width="5in" src="/files/ftp_upload/51513/51513fig5highres.jpg" width="500" /> Şekil 5. Başlıca iki endometrial stromal hücrelerin spontan sidualizasyonu. Deneysel işlemin (A) hatlarıdır. (B) Prolaktin upregülasyonu (PRL) veMPA ve cAMP tepki olarak protein 1 (IGFBP1) gen ekspresyon Bağlama İnsülin benzeri büyüme faktörü. Sonuçlar RT-QPCR ile ölçüldü, ve ifade GAPDH normalize edildi. Önemi öğrenciler t-testi (p &lt;0.001 *** ve P &lt;0.0001 ****) kullanılarak hesaplanmıştır. Her iki hücre çizgileri kazıma yöntemi kullanılarak izole edilmiştir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51513/51513fig5highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Astar boya </td><td> Sekans </td><td> Tavlama Sıcaklığı (° C) </td><td> Döngüleri </td><td> Tahlil </td></tr><tr><td> Prolaktin (PRL) Forward </td><td> CATATTGCGATCCTGGAATGAGC </td><td> 60 </td><td> 40 </td><td> SYBR @ Green </td></tr><tr><td> Prolaktin (PRL) Ters </td><td> TCCTCAATCTCTACAGCTTTGGA </td><td> 60 </td><td> 40 </td><td> SYBR @ Green </td></tr><tr><td> İnsülin benzeri büyüme faktörü bağlayıcı protein 1 (IGFBP1)Ileri </td><td> TCCTTTGGGACGCCATCAGTAC </td><td> 60 </td><td> 40 </td><td> SYBR @ Green </td></tr><tr><td> İnsülin benzeri büyüme faktörü bağlayıcı protein 1 (IGFBP1) Ters </td><td> GATGTCTCCTGTGCCTTGGCTA </td><td> 60 </td><td> 40 </td><td> SYBR @ Green </td></tr><tr><td> GAPDH </td><td> Tanımlanmamış (reaktif listesine bakınız) </td><td> 60 </td><td> 40 </td><td> Taqman </td></tr></tbody></table> Sidualizasyonu belirteçleri Tablo 1. PCR koşulları.

Watch this Scientific Journal Video about Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens at JoVE.com

Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Histerektomi örneklerden primer endometrial stromal hücre kültürü sistemlerinin kurulması, önceki araştırma amaçlayan geniş bir dizi takip için değerli bir biyolojik teknik ve çok önemli bir adımdır. Burada, insan hasta cerrahi olarak kesilmiş dokuları endometriyal stromal kültürleri oluşturmak için kullanılan iki yöntem tarif eder.

Histerektomi Örneklerden İlköğretim İnsan endometrial stroma hücrelerinde Kurulması İçin İki Yöntem

Many efforts have been devoted to establish in vitro cell culture systems. These systems are designed to model a vast number of in vivo processes. Cell ...

two-methods-for-establishing-primary-human-endometrial-stromal-cells

Nanyang Technological University

Research

JoVE Journal

Medicine

22.6K Görüntüleme.  University of Virginia.  Histerektomi örneklerden primer endometrial stromal hücre kültürü sistemlerinin kurulması, önceki araştırma amaçlayan geniş bir dizi takip için değerli bir biyolojik teknik ve çok önemli bir adımdır. Burada, insan hasta cerrahi olarak kesilmiş dokuları endometriyal stromal kültürleri oluşturmak için kullanılan iki yöntem tarif eder. 

Video: Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens

Mammary Transplantation of Stromal Cells and Carcinoma Cells in C57BL/6J Mice

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular through transplantation of stromal cells and epithelial cells in the mammary gland of mice. Current transplantation models often involve the use of immunocompromised mice due to the different genetic backgrounds of stromal cells and epithelial cells. Extracellular matrices are often used to embed the two different cell types for consistent cell-cell interactions, but involve the use of Matrigel or rat tail collagen, which are immunogenic substrates. The lack of functional T cells from immunocompromised mice prevents accurate assessment of stromal cells on mammary tumor progression in vivo, with important implications on drug development and efficacy. Moreover, immunocompromised mice are costly, hard to breed and require special care conditions. To overcome these obstacles, we have developed an approach to orthotopically transplant stromal cell and epithelial cells into mice from the same genetic background to induce consistent tumor formation. This system involves harvesting normal, carcinoma associated fibroblasts, PyVmT mammary carcinoma cells and collagen from donor C57BL/6J mice. The cells are then embedded in collagen and transplanted in the inguinal mammary glands of female C57BL/6J mice. Transplantation of PyVmT cells alone form palpable tumors 30-40 days post transplantation. Endpoint analysis at 60 days indicates that co-transplantation with fibroblasts enhances mammary tumor growth compared to PyVmT cells transplanted alone. While cells and matrix from C57BL/6J mice were used in these studies, the isolation of cells and matrix and transplantation approach may be applied towards mice from different genetic backgrounds demonstrating versatility. In summary, this system may be used to investigate molecular interactions between stromal cells and epithelial cells, and overcomes critical limitations in immunocompromised mouse models.

In this report, we demonstrate a system to isolate and culture donor cells from the mouse mammary gland, and orthotopically transplant these cells in recipient mice to analyze stromal: epithelial interactions during mammary tumor development.

C57BL/6J Fare Stromal Cells ve Karsinomu Hücreler Meme Nakli

The influence of stromal cells, including fibroblasts on mammary tumor progression has been well documented through the use of mouse models, in particular ...

Tıp

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of extracellular matrix (ECM) and a variety of mesenchymal cells, including fibroblasts, myofibroblasts, endothelial cells, pericytes and leukocytes 1-3.
The tumour-associated stroma is responsive to substantial paracrine signals released by neighbouring carcinoma cells. During the disease process, the stroma often becomes populated by carcinoma-associated fibroblasts (CAFs) including large numbers of myofibroblasts. These cells have previously been extracted from many different types of human carcinomas for their in vitro culture. A subpopulation of CAFs is distinguishable through their up-regulation of &alpha;-smooth muscle actin (&alpha;-SMA) expression4,5. These cells are a hallmark of 'activated fibroblasts' that share similar properties with myofibroblasts commonly observed in injured and fibrotic tissues 6. The presence of this myofibroblastic CAF subset is highly related to high-grade malignancies and associated with poor prognoses in patients.
Many laboratories, including our own, have shown that CAFs, when injected with carcinoma cells into immunodeficient mice, are capable of substantially promoting tumourigenesis 7-10. CAFs prepared from carcinoma patients, however, frequently undergo senescence during propagation in culture limiting the extensiveness of their use throughout ongoing experimentation. To overcome this difficulty, we developed a novel technique to experimentally generate immortalised human mammary CAF cell lines (exp-CAFs) from human mammary fibroblasts, using a coimplantation breast tumour xenograft model.
In order to generate exp-CAFs, parental human mammary fibroblasts, obtained from the reduction mammoplasty tissue, were first immortalised with hTERT, the catalytic subunit of the telomerase holoenzyme, and engineered to express GFP and a puromycin resistance gene. These cells were coimplanted with MCF-7 human breast carcinoma cells expressing an activated ras oncogene (MCF-7-ras cells) into a mouse xenograft. After a period of incubation in vivo, the initially injected human mammary fibroblasts were extracted from the tumour xenografts on the basis of their puromycin resistance 11.
We observed that the resident human mammary fibroblasts have differentiated, adopting a myofibroblastic phenotype and acquired tumour-promoting properties during the course of tumour progression. Importantly, these cells, defined as exp-CAFs, closely mimic the tumour-promoting myofibroblastic phenotype of CAFs isolated from breast carcinomas dissected from patients. Our tumour xenograft-derived exp-CAFs therefore provide an effective model to study the biology of CAFs in human breast carcinomas. The described protocol may also be extended for generating and characterising various CAF populations derived from other types of human carcinomas.

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Carcinoma-associated fibroblasts (CAFs) rich in myofibroblasts present within the tumour stroma, play a major role in driving tumour progression. We developed a coimplantation tumour xengraft model for experimentally generating CAFs from human mammary fibroblasts. The protocol describes how to establish CAF myofibroblasts that acquire an ability to promote tumourigenesis.

İnsan Meme Fibroblastlar Karsinom İlişkili Fibroblastlar Deneysel Nesil (CAFs)

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Repair of a Critical-sized Calvarial Defect Model Using Adipose-derived Stromal Cells Harvested from Lipoaspirate

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. Adipose-derived stromal cells (ASCs) have proven to be an abundant source of multipotent stem cells capable of undergoing osteogenic, chondrogenic, adipogenic, and myogenic differentiation. Many studies have explored the osteogenic potential of these cells in vivo with the use of various scaffolding biomaterials for cellular delivery. It has been demonstrated that by utilizing an osteoconductive, hydroxyapatite-coated poly(lactic-co-glycolic acid) (HA-PLGA) scaffold seeded with ASCs, a critical-sized calvarial defect, a defect that is defined by its inability to undergo spontaneous healing over the lifetime of the animal, can be effectively show robust osseous regeneration. This in vivo model demonstrates the basis of translational approaches aimed to regenerate the bone tissue - the cellular component and biological matrix. This method serves as a model for the ultimate clinical application of a progenitor cell towards the repair of a specific tissue defect.

This protocol describes the isolation of adipose-derived stromal cells from lipoaspirate and the creation of a 4 mm critical-sized calvarial defect to evaluate skeletal regeneration.

Lipoaspirate itibaren hasat Yağ kaynaklı stromal hücreler kullanarak Kritik ölçekli Kalvaryum Defekt Model tamiri

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

İnsan Diş Pulp Kök Hücre İzolasyonu, Karakterizasyonu ve Karşılaştırmalı Farklılaşma İki Farklı Yöntemler Kullanılarak Daimi Dişler türetilen

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Improved Protocol For Laser Microdissection Of Human Pancreatic Islets From Surgical Specimens

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected cells can be used for a variety of investigations, such as transcriptomic or proteomic studies, DNA assessment or chromosomal analysis 2,3. An especially challenging application of LMD is transcriptome analysis, which, due to the lability of RNA 4, can be particularly prominent when cells are dissected from tissues that are rich of RNases, such as the pancreas. A microdissection protocol that enables fast identification and collection of target cells is essential in this setting in order to shorten the tissue handling time and, consequently, to ensure RNA preservation. 
Here we describe a protocol for acquiring human pancreatic beta cells from surgical specimens to be used for transcriptomic studies 5. Small pieces of pancreas of about 0.5-1 cm3 were cut from the healthy appearing margins of resected pancreas specimens, embedded in Tissue-Tek O.C.T. Compound, immediately frozen in chilled 2-Methylbutane, and stored at -80 &deg;C until sectioning. Forty serial sections of 10 &mu;m thickness were cut on a cryostat under a -20 &deg;C setting, transferred individually to glass slides, dried inside the cryostat for 1-2 min, and stored at -80 &deg;C. 
Immediately before the laser microdissection procedure, sections were fixed in ice cold, freshly prepared 70% ethanol for 30 sec, washed by 5-6 dips in ice cold DEPC-treated water, and dehydrated by two one-minute incubations in ice cold 100% ethanol followed by xylene (which is used for tissue dehydration) for 4 min; tissue sections were then air-dried afterwards for 3-5 min. Importantly, all steps, except the incubation in xylene, were performed using ice-cold reagents - a modification over a previously described protocol 6. utilization of ice cold reagents resulted in a pronounced increase of the intrinsic autofluorescence of beta cells, and facilitated their recognition. For microdissection, four sections were dehydrated each time: two were placed into a foil-wrapped 50 ml tube, to protect the tissue from moisture and bleaching; the remaining two were immediately microdissected. This procedure was performed using a PALM MicroBeam instrument (Zeiss) employing the Auto Laser Pressure Catapulting (AutoLPC) mode. The completion of beta cell/islet dissection from four cryosections required no longer than 40-60 min. Cells were collected into one AdhesiveCap and lysed with 10 &mu;l lysis buffer. Each single RNA specimen for transcriptomic analysis was obtained by combining 10 cell microdissected samples, followed by RNA extraction using the Pico Pure RNA Isolation Kit (Arcturus). This protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their rapid and accurate recognition and collection. Further improvement of this procedure could enable the dissection of phenotypically different beta cells, with possible implications for better understanding the changes associated with type 2 diabetes.

Laser microdissection is a technique that allows the recovery of selected cells from minute amounts of parenchyma. Here we describe a protocol for acquiring human pancreatic islets from surgical specimens to be used for transcriptomic studies. Our protocol improves the intrinsic autofluorescence of human beta cells, thus facilitating their collection.

Cerrahi Örnekler kaynaktan İnsan pankreas adacıklarının Lazer Diseksiyon için Geliştirilmiş Protokolü

Laser microdissection (LMD) is a technique that allows the recovery of selected cells and tissues from minute amounts of parenchyma 1,2. The dissected ...

Transcriptomic Analysis of Human Retinal Surgical Specimens Using jouRNAl

Retinal detachment (RD) describes a separation of the neurosensory retina from the retinal pigmented epithelium (RPE). The RPE is essential for normal function of the light sensitive neurons, the photoreceptors. Detachment of the retina from the RPE creates a physical gap that is filled with extracellular fluid. RD initiates cellular and molecular adverse events that affect both the neurosensory retina and the RPE since the physiological exchange of ions and metabolites is severely perturbed. The consequence for vision is related to the duration of the detachment since a rapid reapposition of the two tissues results in the restoration of vision 1. The treatment of RD is exclusively surgical. Removal of vitreous gel (vitrectomy) is followed by the removal non essential part of the retina around the detached area to favor retinal detachment. The removed retinal specimens are res nullius (nothing) and consequently normally discarded. To recover RNA from these surgical specimens, we developed the procedure jouRNAl that allows RNA conservation during the transfer from the surgical block to the laboratory. We also standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for global gene expression analysis. The quality of the RNA was validated both by RT-PCR and microarray analysis. Analysis of the data shows a simultaneous involvement of inflammation and photoreceptor degeneration during RD.

We used retinal samples from retinectomy for a transcriptomic analysis of retinal detachment. We developed a procedure that allows RNA conservation between the surgical blocks and the laboratory. We standardized a protocol to purify RNA by cesium chloride ultracentrifugation to assure that the purified RNAs are suitable for microarray analysis.

Journal kullanarak İnsan Retina Cerrahi Örneklerinin transkriptomik Analizi

Retinal detachment (RD) describes a separation of the neurosensory retina  from the retinal pigmented epithelium (RPE). The RPE is essential for normal  ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Katı Örneklerinin From İlköğretim Yumurtalık Kanseri Hücreleri alma için yöntem

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

İnsan Hücre Lines Kemorezistans Yumurtalık Kanser Kök Hücreleri Zenginleştirme

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pankreas Kanseri Yeni Tedavi Stratejileri Geliştirme Hücre Özellikleri Kök incelenmesi

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

A Novel Clinical Grade Isolation Method for Human Kidney Perivascular Stromal Cells

Mesenchymal Stromal Cells (MSCs) are tissue homeostatic and immune modulatory cells that have shown beneficial effects in kidney diseases and transplantation. Perivascular Stromal Cells (PSCs) share characteristics with bone marrow MSCs (bmMSCs). However, they also possess, most likely due to local imprinting, tissue-specific properties and play a role in local tissue homeostasis. This tissue specificity may result in tissue specific repair, also within the human kidney. We previously showed that human kidney PSCs (kPSCs) have enhanced kidney epithelial wound healing whereas bmMSCs did not have this potential. Moreover, kPSCs can ameliorate kidney injury in vivo. Therefore, kPSCs constitute an interesting source for cell therapy, particularly for kidney diseases and renal transplantation. Here we show the detailed isolation and culture method for kPSCs from transplant-grade human kidneys based on whole-organ perfusion of digestive enzymes via the renal artery and enrichment for the perivascular marker NG2. In this way, large cell quantities can be obtained that are suitable for cellular therapy.

Here we present a novel clinical grade isolation and culture method for kidney Perivascular Stromal Cells (kPSCs) based on whole organ perfusion with digestive enzymes and NG2-cell enrichment. With this method, it is possible to acquire sufficient cell numbers for cellular therapy.