Bu çalışmada, Ulusal Bilim Vakfı Hibe için Pelin C. Volkan (DEB-1457690) tarafından desteklenmiştir.

Aşağıdaki iletişim kuralı Duke Üniversitesi Araştırma Etik Komitesi tarafından kurulan etik kuralları ile tutarlıdır.
1. doku hazırlık ve Drosophila melanogaster Pupa gelişimsel evreleme
<ol><li>İlk olarak, ne kadar çok sinek diseksiyon için gerekli olacaktır tanımlamak. RT-PCR ve RNAseq için 100-200 antennal diskler ve anten prepupal, 8 h APF, 40 h APF ve yetişkin aşamalarında gerekli olan bireyler toplamak. İmmünhistokimya için 10-20 kişi incelemek.</li>
	<li>Diseksiyon yastıkları ve forseps, % 70 ile mendil kullanarak da dahil olmak üzere tüm malzemeler temiz alkol. Eğer disseke malzeme RNA çekimi için kullanılan, RNase NÖTRALLEŞTİRİCİLER ile her şeyi temizlemek ve tüm çözümler nükleaz ücretsiz kullanarak yapmak için veya dietil pyrocarbonate (DEPC) su tedavi. Not: Bu protokol gruptakiler için cam yerine silikon diseksiyon yastıkları kullanır. Silikon yastıkları için ultra-ince forseps dostu olan ve hızlı ve yüksek kaliteli diseksiyonlarının teşvik.</li>
	<li>Pupa 0 h APF/prepupal sahne toplamak.<ol>
<li>En doğru evreleme, monitör larva 30 dk 1 h aralıklar sağlamak için. Not: Göçebe üçüncü INSTAR larva orta derecede kalabalık bir şişe büyük olasılıkla birkaç saat içinde YavruIar.</li>
		<li>Bir kez larvaları hareketsiz hale ve bir çok hafif (neredeyse beyaz) renkli pupa dava ile çevrili, onları içine bir küçük 2 - inç nemli bir filtre kağıdı ile Petri kabına aktarın.</li>
		<li>1-2 h için zaman zaman izleme, belirlenmesi ve prepupae transfer etme, devam edin. Not: Alternatif olarak, tüm pupa bir şişe temizleyin ve larvalar için 2 h geliştirmek izin. 2 h 0 - 2 h APF Aralık içinde olacak sonra tüm pupa toplanan.</li>
	</ol>
</li>
	<li>Hemen 3.1 prepupal antennal disk 0 h APF sahne için incelemek için adımına. Prepupa yaşlı gerekiyorsa, onları bir tabak içine toplamak, çanak kapağı ve parafin film kuruluk etkisizleştirmek için kenarlarda yerleştirin ve 25 ° C'de Petri kabına yerleştirin Not: Pupa şimdi eclosion için yaşlı.</li>
	<li>Pupa değil emin olmak için prepupae 2 h istenen çağına için 2 h aralığında toplanan pupa için yaş fazlalığı.</li>
	<li>Çok küçük ve kırılgan doku olan Ultra-ince forseps (Dumont 55) kullanın.</li>
</ol>2. doku hazırlık ve Pupa diğer Drosophila tür gelişimsel evreleme
<ol><li>Diğer Drosophila türler pupa geliştirilmesinde uzunluğunu belirlemek için optimum sıcaklık örnekleri yer, kayıt tarihleri ne zaman prepupae gözlenir, taze bir şişe sıralamak ve prepupa gün yetişkinliğe kaydedin.</li>
	<li>Non -melanogaster türler ve melanogasterzaman pupa kalkınma oranı kaydedin. Melanogaster evreleme için non -melanogaster türler yaş için saat sayısı elde etmek için kullanılan saat sayısı gelişimsel zaman oranı ile çarpın.</li>
</ol>3. D. melanogaster pupa Antennal disk diseksiyon
Not: İçin açıklanan tüm yaşlanma kez ve diseksiyon protokolleri Drosophila melanogaster. Tüm diğer türler için yukarıda açıklandığı gibi bir değişiklik species-specific gelişimsel zaman puan dayalı yaşlanma Protokolü'nün gerekli, olacaktır.
<ol><li>Pupa antennal disk gruptakiler, 50-100 0 - 2 h veya 6-8 h eski pupa bir spatula kullanarak toplar ve bunları bir diseksiyon rampasında yer.</li>
	<li>RNA izolasyon çözüm 150 µL pipet bir RNase ücretsiz 1.5 mL microfuge 200-µL pipet kullanarak tüp ve tüp buza koyun içine.</li>
	<li>1 x PBS (fosfat tamponlu tuz, nükleaz içermeyen) 150-200 µL içinde pupa incelemek. PBS (damlacık başına 150-200 µL) birden fazla damlacıkları diseksiyon altlığında yerleştirin.</li>
	<li>Diseksiyon altlığında birinde 1 x PBS damlacıkları disseke için 0 - 2 h veya 6-8 yaş arası h Pupa (damla başına bir pupa) yerleştirin. Forseps bir elinde vücut stabilize etmek için kullanın.</li>
	<li>0 - 2 h pupa prepupa en ön bölümü (ağız kancalar) üzerinde öte yandan, tutun forseps kullanarak, Yaşlı ve hem zeki hem ön pupa gövdesine yapıştırılmış Imaginal diskler ortaya çıkarmak için çıkar.</li>
	<li>8 h APF pupa için ilk yavaşça kafa vücut çevreleyen zar çuval içinde teşhir pupa, pupa olgusu en ön çeyreğinden akasındaki. Not: Vücut, bu aşamada bir degenerating larva gibi görünüyor.</li>
	<li>Boyun eklemi başında kaldırın. Not: Bu antennal diskleri kayıp, olmayacaktır sağlar ki bu aşamada için öncelikle optik loblar beyni bağlı olan.</li>
	<li>Başka bir 1 x Forseps veya 20 µL pipet kullanarak PBS damlacık doku beyin ve Imaginal diskler ile aktarın.</li>
	<li>Optik loblar, beyin bağlı göz antennal disk tanımlayın. Forseps kullanarak, göz antennal disk beyin ve pupa durumda çekin. Yeni bir 1 x Forseps veya 20 µL pipet kullanarak PBS damlacık aktarmak. Not: Prepupal göz antennal disk düz bir dokudur. Ancak, 8 h pupa tarafından göz diskler antennal diskler, çukurluğu hangi anterior merkezi beyin oturur döndürülür.</li>
	<li>Forseps kullanarak, doku ve göz antennal disk arasında bağlantı yerinde kesti. 20 µL pipet yavaşça disseke doku RNA izolasyon çözüm reaktif aktarmak için kullanın. Mümkün olduğu kadar küçük bir miktar pipetting tarafından aktarılan sıvı miktarını en aza indirmek.</li>
	<li>Tüm pupa disseke kadar yineleyin.</li>
</ol>4. diseksiyon D. melanogaster orta-pupa ve yetişkin antenler
Not: APF 40 h tarafından metamorfoz çoğunluğu tamamlandıktan ve yetişkin yapıları belli oluyor ama hala beyaz ve tanımlanamaz. Bu gelişim zamanda noktada yetişkin anten son şeklini almıştır ama hala saydamdır ve birkaç dışında koku reseptörleri çoğunluğu ifade başlamış değil.
<ol><li>Pupa antennal gruptakiler, 1. adımda açıklandığı gibi 50-100 prepupae toplar ve onları 25 ° C'de 40 h için yaş</li>
	<li>Damlalıklı 150 µL RNA izolasyon çözüm içine bir RNase free 1.5 mL microcentrifuge 200-µL damlalıklı kullanarak tüp ve tüp buza koyun.</li>
	<li>Diseksiyon altlığında içine bir PBS damlacıkları x 1'in disseke pupa yerleştirin. Forseps bir elinde vücut stabilize etmek için kullanın. Forseps diğer elinde kullanarak, yavaşça kafa vücut çevreleyen zar çuval içinde teşhir pupa, pupa olgusu en ön çeyreğinden akasındaki.</li>
	<li>Forseps kullanarak, dikkatle pupa vücudun geri kalanından kafasını forseps kümesi ile vücut tutarak ve kapalı kafa boyun forseps başka bir set ile ortak ripping kesin. Yavaşça başından başka bir 1 x forseps kullanarak PBS damlacık içine aktarın. Yukarı ve aşağı pipet (beyin, vb) gelişmekte olan Drosophila kafa çevrelemek için kullanılan açık bir membran elde etmek için baş içeriğini temizlemek için. Not: 40-50 h APF, anten membran en ön bölümüne bağlanır. Pipetting ile baş içeriğini kaldırıldığında onlar diseksiyon için belirgin hale gelecektir.</li>
	<li>Forseps kullanarak, pupa anten membran bağlantısını kesin. 3 anten 2nd parçasını kesmek sadece 3rd segment koku reseptör nöronlar evi olacak gibi forseps dilim için gelen bir segmental ortak kullanarakrd .</li>
	<li>20 µL pipet yavaşça disseke doku RNA izolasyon çözüm reaktif aktarmak için kullanın. Mümkün olduğu kadar küçük bir miktar pipetting tarafından aktarılan sıvı miktarını en aza indirmek. Tüm pupa disseke kadar yineleyin.</li>
	<li>Yetişkin antennal gruptakiler, yaklaşık 50 Yetişkin toplar ve onları bir hafta sonrası eclosion için yaş. Not: Koku reseptör gen ifade ve diğer genler bir hafta eclosion sonra zirve. Yetişkinler algılama eşik yükselmeye düşük bereket tutanaklar ile biyolojik olarak ilgili gen emin olmak bir hafta boyunca büyükseniz.</li>
	<li>Onlar bir CO2 rampasında hala hayatta iken RNA çekimi için sinekler incelemek. CO2 yastık RNase inhibitörleri ile tedavi. Confocal görüntüleme için PBS veya PBS + % 0.2 x 1'deki bir diseksiyon yastık üzerinde sinekler teşrih Triton.</li>
	<li>İlk olarak, CO2 İstasyonu panelindeki diseksiyon kapsamı altında uyumak için yetişkin koymak. Vücut, stabilize etmek bir elinde forseps kullanarak CO2 istasyonu üzerinde forseps diğer elinde yavaşça çekin/ikinci üçüncü antennal segmentten dışarı çimdik için takımını kullanın.</li>
	<li>Antenler antenleri doğrudan sıvı içine yerleştirmek için forseps kullanarak bir RNA izolasyon çözüm içine aktarın. Tüm yetişkin disseke kadar yineleyin. Not: anten RNA izolasyon çözümde batık olun. Anten yan tarafındaki tüp kalmış olur. Bu artan bir bozulma, RNA, RNA kalite ve miktar azaltılması neden olur.</li>
	<li>Doğrudan RNA ayıklama devam etmek ya da uzun süreli depolama için-80 ° C'de tüpü yerleştirin.</li>
</ol>5. RNA izolasyonu disseke dokular
<ol><li>-80 ° C depolama biriminden tüm örneklerini kaldırmak ve onları buz çözme.</li>
	<li>Kısa bir süre (5-6 sn, ~ 6.000 x g) tüp alt malzeme toplamak için her örnek spin.</li>
	<li>Her örnek için 10 autoclaved bir plastik havaneli ve bir elektrik motoru kullanarak eziyet s buz üzerinde.</li>
	<li>5.2 ve 5.3 4 numaralı adımları yineleyin.</li>
	<li>Piyasada kitleri kullanarak ve bir en iyi verim için üreticinin iletişim kuralları takip RNA çıkarma gerçekleştirin.</li>
	<li>QRT-PCR genler ilgi ve üreticinin iletişim kuralları aşağıdaki karşı belirli astar ve piyasada bulunan reaktifler kullanarak gerçekleştirin.<ol>
<li>Aşağıdaki koşullar kullanarak tüm PCR reaksiyonları taşımak: 95 ° C denatürasyon 10 dk ardından 40 devredir 15 95 ° c s, 30 55 ° C s ve 60 ° C 30 s. Not: Astar çift daldırma ile dpr gen için Tablo 1' de listelenen ve astar koku reseptör genleri için Hueston CE ve ark. içinde yer almaktadır 8.</li>
	</ol>
</li>
</ol>6. Pupa Antennal diskler ve antenler immünhistokimya için fiksasyonu
Not: doku dokular için zaman aynı miktarda giderilen emin olmak için 10-20 kişilerden toplu olarak düzeltmek. Dokuların bütünlüğünü en üst düzeye çıkarmak için bir sabitleştirici aktarmadan önce PBT (PBS deterjan ile) örnekleri ikamet süresini en aza indirmek.
<ol><li>Toplamak disseke antennal diskler veya %0,2 200 µL içeren 200-µL PCR tüp içinde pupa anten PBT buz üzerinde doku bütünlüğünü korumak ve örnek--dan 200-µL PCR duvarına yapışmasını önlemek için hangi-ecek götürmek için eksik bir fiksasyon tüpleri. Not: Pupa anten ve antennal diskler oldukça şeffaf oldukları gibi görmek zor olabilir. Doku kaybı önlemek için tüm çamaşır adımları için bir diseksiyon kapsam kullanılması önerilir. Alternatif olarak, 96-de Terasaki plakaları fiksasyon için kullanılır ve boyama doku en iyi izlemek için olabilir.</li>
	<li>Saptamak disseke antennal disk ve antennal örnekleri üzerinden yaklaşık 200 µL % 4'lük içinde pupa PFA (Paraformaldehyde), oda sıcaklığında 30 dakika. Bu ve sonraki adımları, devam örnekleri tüplerini çözüm örneklerinde mix düzgün bir nutator. Adım 6,7 ilerleme.</li>
	<li>Yetişkin anten için tüm başından önce incelemek ve içinde yaklaşık 200 µL % 4'lük tamir PFA (paraformaldehyde) Oda sıcaklığında 1 h için.</li>
	<li>3 x 200 µL % 0,2 ile yıkayın PBT 10 dk için. Örnekleri üzerinde nutator kuluçka sırasında tutmak.</li>
	<li>Sabit başları diseksiyon mikroskop ikinci antennal segment bir ince diseksiyon için geri dön. Forseps kullanarak kafa dengelemek, yavaşça çekin/ikinci üçüncü antennal segmentten dışarı çimdik için.</li>
	<li>Disseke üçüncü antennal kesimleri yaklaşık 200 µL % 4'lük aktarım PFA (paraformaldehyde) ve oda sıcaklığında 30 dakika düzeltmek.</li>
	<li>3 x 200 µL % 0,2 ile yıkayın PBT 10 dk için. Örnekleri üzerinde nutator kuluçka sırasında tutmak.</li>
	<li>Örnekleri 4 ° C'de depolayın veya doğrudan bütün Dağı immünhistokimya ile devam edin. Not: antikor kullanılıyor, boyama verimliliğini değişebilir. Bu yöntem daha az bol protein Etiketler için uygun veya zayıf antikorlar olmalıdır. Ancak, zaman zaman, (kimlik veya sabitleştirici miktarı veya fiksasyon saat) protokolü bir duruma getirilmesi gerekebilir.</li>
</ol>

<ol>
	<li>Barish, S., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+olfactory+receptor+neuron+specification+in+Drosophila.">Mechanisms of olfactory receptor neuron specification in Drosophila.</a> Wiley Interdisciplinary Reviews. Developmental Biology. 4 (6), 609-621 (2015).</li><li>Pan, J. W., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+development+and+evolution+of+the+insect+olfactory+system.">Mechanisms of development and evolution of the insect olfactory system.</a> Cell and Developmental Biology. 2, 130 (2013).</li><li>Ramdya, P., Benton, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolving+olfactory+systems+on+the+fly.">Evolving olfactory systems on the fly.</a> Trends in Genetics. 26 (7), 307-316 (2010).</li><li>Bellen, H. J., Tong, C., Tsuda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=100+years+of+Drosophila+research+and+its+impact+on+vertebrate+neuroscience:+a+history+lesson+for+the+future.">100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future.</a> Nature Reviews Neuroscience. 11 (7), 514-522 (2010).</li><li>Knecht, Z. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+combinations+of+variant+ionotropic+glutamate+receptors+mediate+thermosensation+and+hygrosensation+in+Drosophila.">Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila.</a> eLife. 5, 44-60 (2016).</li><li>Enjin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humidity+sensing+in+Drosophila.">Humidity sensing in Drosophila.</a> Current Biology. 26 (10), 1352-1358 (2016).</li><li>Li, Q., Barish, S., Okuwa, S., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Examination+of+endogenous+rotund+expression+and+function+in+developing+Drosophila.+olfactory+system+using+CRISPR-Cas9-mediated+protein+tagging.">Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging.</a> G3: Genes|Genomes|Genetics. 5 (12), 2809-2816 (2015).</li><li>Hueston, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modulatory+proteins+and+olfactory+receptor+signaling+in+the+refinement+and+maintenance+of+fruitless+expression+in+olfactory+receptor+neurons.">Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons.</a> PLoS Biology. 14 (4), 1002443 (2016).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+rules+of+precursor+specification+underlying+olfactory+neuron+diversity.">Combinatorial rules of precursor specification underlying olfactory neuron diversity.</a> Current Biology. 23 (24), 2481-2490 (2013).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functionally+conserved+gene+regulatory+network+module+governing+olfactory+neuron+diversity.">A functionally conserved gene regulatory network module governing olfactory neuron diversity.</a> PLoS Genetics. 12 (1), 1005780 (2016).</li><li>Pan, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patterns+of+transcriptional+parallelism+and+variation+in+the+developing+olfactory+system+of+Drosophila+species.">Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species.</a> Scientific Reports. 7 (1), 8804 (2017).</li><li>Pan, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+behavioral+and+transcriptional+variation+underlying+CO2+sensory+neuron+function+and+development+in+Drosophila.">Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila.</a> Fly. 11 (4), 239-252 (2017).</li><li>Stern, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+and+transgenic+reagents+for+Drosophila+simulans,+D.+mauritiana,+D.+yakuba,+D.+santomea,+and+D.+virilis.">Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis.</a> G3: Genes|Genomes|Genetics. 7 (4), 1339-1347 (2017).</li></ol>

Yazarlar ifşa gerek yok.

Bu iletişim kuralı labs Drosophila Drosophila koku doku, hem de karşılaştırmalı analizi, bu programların geliştirilmesinde çalışma genetik ve transkripsiyon programları belirlenmesinde baktılar için yararlı bir kaynaktır bir tür. Gelecekteki çalışmaları için bir astar olarak farklı gelişim aşamalarında sistemleri düzeyi transkripsiyon profillerden gerekirse özellikle yararlıdır. Burada açıklanan protokol sahne ve dört anahtar gelişimin koku alma sistemi üzerinden ön desenlendirme için kullanılmak üzere terminal farklılaşma örnekler almak için Drosophila koku dokusundan gelişen izole etmek gösterilmiştir Moleküler ve bağışıklık histolojik çalışmalar. Drosophila disseke antennal diskler ve farklı pupa aşamalarında antenler RNA-seq tarafından sistemleri düzeyinde veya tek tek gen düzeyinde koku alma sistemi geliştirme sırasında gen ifade profilleri tanımlamak için kullanılabilir kantitatif RT-PCR tarafından. Örnekleri de immünhistokimya ve in situ hibridizasyon için doku özel gen ekspresyonu vivo tanımlamak için kullanılabilir. Bu protokol ek bir avantaj disseke örnekleri olmak daha fazla olduğunu Disosiye standart yöntemlerle ve saf bir hücresel grubun (veya tek hücre) hücre türüne özgü moleküler analizleri için gibi elde etmek için FAC sıralanmış olduğunu nicel RT-PCR ya da RNAseq.
Protokol diseksiyonu antennal diskler ve anten üzerinden (0 h/prepupa, 8 h ve 40 h APF), pupa ve yetişkin aşamaları gösterse diğer pupa zaman puan için adapte edilebilir. Ayrıca bu gruptakiler öğrenme zaman ve pratik aldığını kayda değer olduğunu. Bir uzman saatte 50 örnekleri incelemek gerekir. Değil için fazlalık önemlidir pupa. Bu nedenle, diseksiyon, başlamadan önce bir saat hiçbir pupa istenilen yaş daha büyük olduğundan emin olun. Pratik bir süre her aşaması için deneyler başlatmadan önce gereklidir bu yüzden diseksiyonlarının öğrenmek için zaman alabilir. Gruptakiler 9-12 h APF morfolojik değişiklikler nedeniyle daha zor olur. Pupa yaşına sıralamak mümkündür prepupae (tarafından gövde rengi, koyu renkli büyük varlık) toplarken. Başlangıçta prepupae sıralama diseksiyon sırasına göre yaş overaging önlemek için sağlar.
Yukarıda açıklanan protokol diğer Drosophila türler için uygulanabilir. Diğer türlerin pupa gruptakiler için zamanlama hem 25 ° c D. melanogaster ile belirli bir türün pupa geliştirme oranı ve anten/antennal disk morfoloji karşılaştırmalı gözlemleri diseksiyonu sırasında ile temel alabilir bir öncelikli olarak aynı olması için için morfolojik konuları göz önüne alındığında. Drosophila melanogasteriçin yaklaşık 4 gün pupa sahne alıyor. D. sechellia ve D. erecta pupa gelişimsel yerleştirme D. melanogaster; için benzer Ancak, D. virilis pupa 1.3 x daha uzun11,12gelişmedir. Ne zaman diğer türler diseksiyon için hazırlanmıştır, düzeylendirme pupa dönemi zamanlaması ve sahne-özel anten/antennal disk morfoloji, karşılaştırmalı gözlemleri ile en yüksek öncelik olan morfolojik benzerlik dayanmalıdır. İlk olarak, sıcaklık, ilgilendiğiniz türler için işleme optimum tanımlayın. Birçok canlı türünün de 25 ° C'de büyümek ama bakım koşulları hakkında detaylı bilgi UC San Diego Drosophila tür stok Merkezi'nden temin edilebilir.
İletişim kuralı en kritik adım doğru evreleme ve ilgi yeterli sayıda farklı türlerden dokusunun uygun diseksiyon vardır. Bir kez bunlar yerde, protokol böyle analizler için doku koleksiyonunun verimli bir yöntem sağlar ve herhangi bir Drosophila türler içinde pupa aşamaları sırasında herhangi bir gelişmekte olan Imaginal disk dokusu ile hemen hemen adapte edilebilir.
Bu iletişim kuralı bir sınırlama hücre türüne özgü örnekleri sağlamaz var. Hücresel fonksiyon ve morfoloji daha ayrıntılı bir anlayış hücre türüne özgü transkripsiyon kantitatif RT-PCR veya immünhistokimya gibi standart moleküler yordamlar yanı sıra bir sistem düzeyinde profilleme gerektirir. Hücre türüne özgü profil oluşturma özellikle non -melanogaster türler hücre türüne özgü muhabir transgenics eksikliği göz önüne alındığında, zordu. Hücresel profil oluşturma güncel gelişmeler, genom içinde non -melanogaster tür düzenleme transgenics ve CRISPR-Cas9 aracılı, şimdi etiket ve transkripsiyon13profil ilgi tek hücreleri sıralamak mümkündür.

Gelişimsel Nörobiyoloji, sistemleri neuroscience, yanı sıra Nörofizyoloji, davranış çalışmalar ve davranışsal evrim1,2,3 Drosophila koku alma sistemi yaygın olarak kullanılan bir sistemdir, 4. Drosophila koku dokulara ek olarak hidro ve termo duyusal sinir hücreleri1,5,6uçucu kimyasal ipuçlarını bulmak koku reseptör nöronlar (ORNs) ev. Bu makale genel amacı nasıl sahne ve pupa ve yetişkin koku doku Drosophila türlerin geliştirme incelemek için göstermektir. Örnekleri farklı pupa aşamaları moleküler ve gelişimsel analizleri gibi RNAseq ve kantitatif RT-PCR, periferik koku sistem ayrıca teknikleri etiketleme vivo içinde doku oluşturmak için bu tekniği için mantığı olduğunu . Bu teknik özellikle gelişmekte olan yetişkin koku alma sistemi belirli hücre türünün tüm transgenik reaktifler var mı non -Drosophila melanogaster türlerden transkripsiyon profilleri dinamikleri tanımlamak yararlı olabilir etiketleme ve analizler. Bu makale, antennal diskler ve antenler pupa ve yetişkin Drosophila türlerden incelemek nasıl gösterir. İlk olarak, Drosophila puparium oluşumu (APF, beyaz pupa veya prepupae) gelişimsel evreleme ve species-specific yaşlanma için 0 h tanımlamak nasıl gösterir. Ardından, antennal diskler ve üçüncü antennal segment incelemek nasıl gösterir; Özellikle, nasıl onları göz disk ve ikinci antennal segment RNAseq veya RT-PCR için gereken doku saflık için ayırmak için. Bu protokol için kabaca açıklanan D. melanogaster aşamada önceden desenli antennal disk (prepupae) karşılık, öncüleri antennal üzerinden yelpazesi disk (8 h APF), ORNs (40 h APF), için terminal farklılaşma başlangıcı ve Yetişkin anten. Son olarak, örnek bir kantitatif RT-PCR için yetişkin anten istimal belgili tanımlık yöntem izole ve in vivo immünhistokimya için veriyoruz. Bu yöntem örnekleri bir RNA/DNA analizi ve koku dokulardan periferik Drosophila tür geliştirme immünhistokimya oluşturmak için kullanılabilir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1180px;" width="1180">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:271px;">10X Phosphate-buffered Saline</td>
			<td style="width:236px;">Gibco</td>
			<td style="width:241px;">70011-044</td>
			<td style="width:432px;">Dilute to 1X in RNase free water</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 tank</td>
			<td>Air Gas</td>
			<td>CD R200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Two sharp forceps (Dumont #55)</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol</td>
			<td>Invitrogen</td>
			<td>15596-026</td>
			<td>RNA isolation solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dissecting Microscope</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small bucket with ice</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P20 and P200 micropipettes and tips</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.7 mL Microfuge tubes</td>
			<td></td>
			<td></td>
			<td>Purchase nuclease free for best results</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.2 mL PCR tubes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde powder</td>
			<td>Polysciences</td>
			<td>380</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10% Triton X-100</td>
			<td>Teknova</td>
			<td>T1105</td>
			<td>Dilute to 0.2% v/v in 1X PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2&#34; petri dishes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">55mm filter paper</td>
			<td>Whatman</td>
			<td>1001-055</td>
			<td>Wet with water and place in a petri dish to keep pupae moist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">25 C incubator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">deionized H2O</td>
			<td></td>
			<td></td>
			<td>Purchase nuclease free or treat with DEPC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sylgard 184 Silicone Elastomer Kit</td>
			<td>Dow Corning</td>
			<td></td>
			<td>to be used for making dissection pads from Terizaki plate covers.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroWell Mini Trays with lids</td>
			<td>Nunc</td>
			<td>438733</td>
			<td>Lids can be used to make silicone dissection pads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-GFP antibody</td>
			<td>MBL international corpor</td>
			<td>PM005</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse anti RAT CD2</td>
			<td>AbD seroTec</td>
			<td>MCA154RHDL</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ADL195 (anti lamin, mouse)</td>
			<td>Dev studies hydoma ban</td>
			<td>ADL195-s</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor&#174; 488 goat anti-rabbit IgG (H+L)</td>
			<td>invitrogen</td>
			<td>A11008</td>
			<td>Secondary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cy3 Goat Anti-Mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-166-003</td>
			<td>Secondary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered</td>
			<td>CALBIOCHEM</td>
			<td>648463</td>
			<td>detergent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lab Rotator</td>
			<td>Thermo scientific</td>
			<td></td>
			<td>Rotator</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease Free Water</td>
			<td>Growcells.com</td>
			<td>NUPW-0125</td>
			<td>Water</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Light-Duty Tissue Wipers</td>
			<td>VWR</td>
			<td>82003-822</td>
			<td>For cleaning dissection supplies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript II</td>
			<td>invitrogen</td>
			<td>18064014</td>
			<td>Reverse Transcriptase&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAshredder (50)</td>
			<td>RNA extraction</td>
			<td>QIAGEN</td>
			<td>79654</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo(dT)12-18 Primer</td>
			<td>RT</td>
			<td>life technologies</td>
			<td>18418012</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNeasy MinElute Cleanup Kit (50)</td>
			<td>RNA extraction</td>
			<td>QIAGEN</td>
			<td>74204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FASTSTART UNIV SG MASTER (5 ML)(500 RXN)</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>04913850001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FASTSTART ESSENTIAL GREEN DNA MASTER&#160;</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>06402712001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LIGHTCYCLER 480 - MULTIWELL PLATE 96</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>04729692001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NEBNext High-Fidelity 2X PCR Master Mix</td>
			<td>qPCR</td>
			<td>NEB</td>
			<td>M0541S</td>
		</tr>
	</tbody>
</table>

preparing developing peripheral olfactory tissue for molecular and immunohistochemical analysis in drosophila

Gelişimsel Nörobiyoloji, sistemleri neuroscience, yanı sıra Nörofizyoloji, davranış ve davranışsal evrim Drosophila koku alma sistemi yaygın olarak kullanılan bir sistemdir. Drosophila koku doku uçucu kimyasal cues hidro ve termo duyusal sinir hücreleri ek olarak algılayan koku reseptör nöronlar (ORNs) ev. Bu protokol için yetişkin Drosophila türlerin periferik koku doku geliştirme diseksiyon açıklar. İlk aşama ve Drosophila larva, antennal disk diseksiyon tarafından erken pupa aşamaları, orta-pupa aşamaları ve yetişkin anten diseksiyon tarafından takip ardından yaş nasıl açıklar. Ayrıca nerede hazırlıklar qRT-PCR, RNAseq veya immünhistokimya RNA ayıklama gibi moleküler teknikleri kullanılabilir yöntemleri gösterir. Bu yöntemler aynı zamanda diğer Drosophila türler species-specific pupa geliştirme sürelerinin ve ilgili aşamaları için uygun yaşlanma hesaplanır sonra uygulanabilir.

Disseke gelişmekte olan koku doku RT-PCR tarafından takip RNA çıkarılması için gen ekspresyonu değerlendirmek için kullanılabilir veya onun ifade deseni ve genler alt hücrede yerleşimi belirlemek için immünhistokimya iletişim kuralları üzerinden alınan faiz. Bu bölümde, her iki protokolden temsilcisi sonuçları sunmak. Şekil 1 temsilcisi kantitatif RT-yüzey hücre reseptörü ve koku reseptör Gen transkripsiyonu vahşi-türü yetişkin anten gösterilen PCR var. Şekil 2 6-8 h gösterir ve 12 h APF antennal disk stainings Rn EGFP transgenik üzerinde uçar kullanarak anti-GFP (1: 1000) ve anti-okan antikorlar (1: 100) (Şekil 2A ve 2B). RN-EGFP antennal disk içindeki belirli bölgeleri pupa erken evrelerinde Etiketler. 40 h APF pupa antennal anti-GFP antikor Or67d-GAL4 UAS-CD8GFP transgenik uçar boyama ve yetişkin antennal anti-elav (1: 100) ORNs (Şekil 2) antikor boyama de gösterilir. Diğer örnekler edebiyat7,8,9,10' da bulunabilir.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57716/57716fig1v2.jpg"> Resim 1 . Kantitatif RT-PCR vahşi-türü yetişkin antennal RNA örneklerinden farklı genler için. Bu paneller (Aiçin) kantitatif RT-PCR sonuçları göster DIP-Alfa, DIP-eta, dpr5, dpr8, kug, beatIIIb (astar için ikili bkz. Tablo 1) ve (B) koku ve ionotropic reseptör (veya / IR) yetişkin genler antennal RNA örnekleri. Hata çubukları demek (SEM) bir standart hatasını gösterir. Veya / IR genler bulunmaktadır düşük bereket RNA'ların hala qRT-PCR tarafından tespit edilebilir. Her Gen ifadesinin nüsha analiz edildi. CT değerleri her gen için oluşturulan standart eğrileri dayalı her gen için seyreltme Etkenler hesaplamak için kullanılmıştır. Seyreltme faktörler sonra tüm genler8daha önce açıklandığı gibi ölçülen ortalama ifade için her gen için normalleştirilmiş. <a href="/files/ftp_upload/57716/57716fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57716/57716fig2.jpg"> Resim 2 . Koku doku geliştirilmesi üzerinde farklı antikorları kullanarak immünhistokimya. Bu paneller anti-GFP (yeşil) ve anti-okan (kırmızı) göstermek antikor stainings (A) 6 h APF pupa antennal diskler ve ()B) 12 h APF pupa antennal diskler. (C) Bu panel anten Or67d GAL4 UAS-CD8GFP transgenics tavşan ile anti-GFP (yeşil) antikorları lekeli 40 h APF gösterir. (D) Bu panel yetişkin anten anti-CD2 antikorlar ile hangi etiket Or47b-CD2 olumlu ORNs (macenta) lekeli gösterir. <a href="/files/ftp_upload/57716/57716fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>İleri astar</td>
			<td>Ters astar</td>
			<td>Uzunluğu</td>
		</tr>
<tr>
<td>CGGAGAGGAGGTTATGAGCA</td>
			<td>GGAAGTGCACAACTAGCGTT</td>
			<td>143</td>
		</tr>
<tr>
<td>CGCGAATCGTTGTGTCAGTA</td>
			<td>TGTCGATAGCGTGAACCTGA</td>
			<td>129</td>
		</tr>
<tr>
<td>AGGAGTGGACGTTGAGTTACA</td>
			<td>CAATCATGTCCTCGTGACCG</td>
			<td>146</td>
		</tr>
<tr>
<td>TAGAGTCCGAGCAGCAGATG</td>
			<td>GTCAGAATTCGAGTTGTCCGC</td>
			<td>104</td>
		</tr>
<tr>
<td>GGCGCTAAGTAGCAGGACG</td>
			<td>GGCCAAGTCTGTTTGTGAGG</td>
			<td>215</td>
		</tr>
<tr>
<td>TAAGACCCTAGCGCCCTCTT</td>
			<td>AGGGAGATGCGCTTTGAGAC</td>
			<td>129</td>
		</tr>
</tbody></table>Tablo 1. PCR astar qRT-PCR içinde kullanılan listesi.

Watch this Scientific Journal Video about Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila at JoVE.com

Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

Burada, sahne ve koku doku Drosophila türlerden geliştirme incelemek için bir protokol mevcut. Disseke doku daha sonra kantitatif RT-PCR (Ters transkripsiyon-polimeraz zincir reaksiyonu) veya (RNAseq), sıralama RNA gibi moleküler analizleri için in vivo analizleri immünhistokimya veya in situ gibi yanı sıra kullanılabilir hibridizasyon.

Periferik koku doku için geliştirme hazırlanıyor moleküler ve immunohistokimyasal Drosophila analizde

The olfactory system of Drosophila is a widely used system in developmental neurobiology, systems neuroscience, as well as neurophysiology, behavior, and ...

preparing-developing-peripheral-olfactory-tissue-for-molecular

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

5.7K Görüntüleme.  Duke University. Burada, sahne ve koku doku Drosophila türlerden geliştirme incelemek için bir protokol mevcut. Disseke doku daha sonra kantitatif RT-PCR (Ters transkripsiyon-polimeraz zincir reaksiyonu) veya (RNAseq), sıralama RNA gibi moleküler analizleri için in vivo analizleri immünhistokimya veya in situ gibi yanı sıra kullanılabilir hibridizasyon.

Video: Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

Preparation of Mitochondrial Enriched Fractions for Metabolic Analysis in Drosophila

Since mitochondria play roles in amino acid metabolism, carbohydrate metabolism and fatty acid oxidation, defects in mitochondrial function often compromise the lives of those who suffer from these complex diseases. Detecting mitochondrial metabolic changes is vital to the understanding of mitochondrial disorders and mitochondrial responses to pharmacological agents. Although mitochondrial metabolism is at the core of metabolic regulation, the detection of subtle changes in mitochondrial metabolism may be hindered by the overrepresentation of other cytosolic metabolites obtained using whole organism or whole tissue extractions. 
Here we describe an isolation method that detected pronounced mitochondrial metabolic changes in Drosophila that were distinct between whole-fly and mitochondrial enriched preparations. To illustrate the sensitivity of this method, we used a set of Drosophila harboring genetically diverse mitochondrial DNAs (mtDNA) and exposed them to the drug rapamycin. Using this method we showed that rapamycin modifies mitochondrial metabolism in a mitochondrial-genotype-dependent manner. However, these changes are much more distinct in metabolomics studies when metabolites were extracted from mitochondrial enriched fractions. In contrast, whole tissue extracts only detected metabolic changes mediated by the drug rapamycin independently of mtDNAs.

Preparation of Mitochondrial Enriched Fractions for Metabolic Analysis in Drosophila

Mitochondria play central roles in the regulation of metabolism and homeostasis. Subtle changes in mitochondrial metabolism that affect organismal physiology could be difficult to detect in whole organism metabolomics studies. Here we describe an isolation method that enhances the detection of subtle metabolic shifts in Drosophila melanogaster.

Metabolik Analiz Mitokondriyal Zenginleştirilmiş Kesirler Hazırlanması<em&gt; Drosophila</em

Since mitochondria play roles in amino acid metabolism, carbohydrate metabolism and fatty acid oxidation, defects in mitochondrial function often ...

Gelişim Biyolojisi

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

The zebrafish model is an emerging system for the study of neuromuscular disorders. In the study of neuromuscular diseases, the integrity of the muscle membrane is a critical disease determinant. To date, numerous neuromuscular conditions display degenerating muscle fibers with abnormal membrane integrity; this is most commonly observed in muscular dystrophies. Evans Blue Dye (EBD) is a vital, cell permeable dye that is rapidly taken into degenerating, damaged, or apoptotic cells; in contrast, it is not taken up by cells with an intact membrane. EBD injection is commonly employed to ascertain muscle integrity in mouse models of neuromuscular diseases. However, such EBD experiments require muscle dissection and/or sectioning prior to analysis. In contrast, EBD uptake in zebrafish is visualized in live, intact preparations. Here, we demonstrate a simple and straightforward methodology for performing EBD injections and analysis in live zebrafish. In addition, we demonstrate a co-injection strategy to increase efficacy of EBD analysis. Overall, this video article provides an outline to perform EBD injection and characterization in zebrafish models of neuromuscular disease.

In this study, we describe a straightforward method to perform Evans Blue Dye (EBD) analysis on zebrafish larvae. This technique is a powerful tool for the characterization of skeletal muscle integrity and delineation of zebrafish models of muscular dystrophy, and is a valuable method for the development of novel therapeutics.

Evans Blue Dye ile Zebra balığı Larva İskelet Kası Bütünlüğü Analizi

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Live Imaging of Mouse Secondary Palate Fusion

The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to cleft secondary palate, a common congenital anomaly in humans. Secondary palate fusion has been extensively studied leading to several proposed cellular mechanisms that may mediate this process. However, these studies have been mostly performed on fixed embryonic tissues at progressive timepoints during development or in fixed explant cultures analyzed at static timepoints. Static analysis is limited for the analysis of dynamic morphogenetic processes such a palate fusion and what types of dynamic cellular behaviors mediate palatal fusion is incompletely understood. Here we describe a protocol for live imaging of ex vivo secondary palate fusion in mouse embryos. To examine cellular behaviors of palate fusion, epithelial-specific Keratin14-cre was used to label palate epithelial cells in ROSA26-mTmGflox reporter embryos. To visualize filamentous actin, Lifeact-mRFPruby reporter mice were used. Live imaging of secondary palate fusion was performed by dissecting recently-adhered secondary palatal shelves of embryonic day (E) 14.5 stage embryos and culturing in agarose-containing media on a glass bottom dish to enable imaging with an inverted confocal microscope. Using this method, we have detected a variety of novel cellular behaviors during secondary palate fusion. An appreciation of how distinct cell behaviors are coordinated in space and time greatly contributes to our understanding of this dynamic morphogenetic process. This protocol can be applied to mutant mouse lines, or cultures treated with pharmacological inhibitors to further advance understanding of how secondary palate fusion is controlled.

Here, we present a protocol for live imaging of mouse secondary palate fusion using confocal microscopy. This protocol can be used in combination with a variety of fluorescent reporter mouse lines, and with pathway inhibitors for mechanistic insight. This protocol can be adapted for live imaging in other developmental systems.

Fare İkincil Palin Füzyonunun Canlı Görüntüsü

The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to ...

Correlative Super-resolution and Electron Microscopy to Resolve Protein Localization in Zebrafish Retina

We present a method to investigate the subcellular protein localization in the larval zebrafish retina by combining super-resolution light microscopy and scanning electron microscopy. The sub-diffraction limit resolution capabilities of super-resolution light microscopes allow improving the accuracy of the correlated data. Briefly, 110 nanometer thick cryo-sections are transferred to a silicon wafer and, after immunofluorescence staining, are imaged by super-resolution light microscopy. Subsequently, the sections are preserved in methylcellulose and platinum shadowed prior to imaging in a scanning electron microscope (SEM). The images from these two microscopy modalities are easily merged using tissue landmarks with open source software. Here we describe the adapted method for the larval zebrafish retina. However, this method is also applicable to other types of tissues and organisms. We demonstrate that the complementary information obtained by this correlation is able to resolve the expression of mitochondrial proteins in relation with the membranes and cristae of mitochondria as well as to other compartments of the cell.

This protocol describes the necessary steps to obtain subcellular protein localization results on zebrafish retina by correlating super-resolution light microscopy and scanning electron microscopy images.

Bağdaşık süper çözünürlük ve elektron mikroskobu Zebra balığı Retina Protein yerelleşme gidermek için

We present a method to investigate the subcellular protein localization in the larval zebrafish retina by combining super-resolution light microscopy and ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Diseksiyon ve mantar vücut immünfloresan boyama ve yetişkin Drosophila melanogaster beynindeki nöronlar Photoreceptor

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

A Quantitative Measurement of Reactive Oxygen Species and Senescence-associated Secretory Phenotype in Normal Human Fibroblasts During Oncogene-induced Senescence

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. Recent studies have extended the role of cellular senescence to various physiological processes, including development, wound healing, immune surveillance, and age-related tissue dysfunction. Although cell cycle arrest is a critical hallmark of cellular senescence, an increased intracellular reactive oxygen species (ROS) production has also been demonstrated to play an important role in the induction of cellular senescence. In addition, recent studies revealed that senescent cells exhibit potent paracrine activities on neighboring cells and tissues through a senescence-associated secretory phenotype (SASP). The sharp increase in interest regarding therapeutic strategies against cellular senescence emphasizes the need for a precise understanding of senescence mechanisms, including intracellular ROS and the SASP. Here, we describe protocols for quantitatively assessing intracellular ROS levels during H-Ras-induced cellular senescence using ROS-sensitive fluorescent dye and flow cytometry. In addition, we introduce sensitive techniques for the analysis of the induction of mRNA expression and secretion of SASP factors. These protocols can be applied to various cellular senescence models.

Intracellular ROS has been shown to play an important role in the induction of cellular senescence. Here, we describe a sensitive assay for quantifying ROS levels during cellular senescence. We also provide protocols for assessing the senescence-associated secretory phenotype, which reportedly contributes to various age-related dysfunctions.

Reaktif oksijen türleri ve yaşlanma ilişkili salgı fenotip Normal insan fibroblast içinde bir nicel ölçüm onkogen kaynaklı yaşlanma sırasında

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. ...

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &#34;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&#34; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Here, we present a method for generating tissue-specific binary transcription systems in Drosophila by replacing the first coding exon of genes with transcription drivers. The CRISPR/Cas9-based method places a transactivator sequence under the endogenous regulation of a replaced gene, and consequently facilitates transctivator expression exclusively in gene-specific spatiotemporal patterns.

Genom düzenleyerek Drosophila içinde doku özel ikili transkripsiyon sistemleri oluşturmak için etkili bir strateji

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of ...

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a variety of human retinal degenerative diseases and pinpoint new treatment approaches. The nuclear architecture of mouse retina is organized in two different patterns: conventional and inverted. Conventional pattern is universal where heterochromatin is localized to the periphery of the nucleus, while active euchromatin resides in the nuclear interior. In contrast, inverted nuclear pattern is unique to the adult rod photoreceptor cell nuclei where heterochromatin localizes to the nuclear center, and euchromatin resides in the nuclear periphery. DNA methylation is predominantly observed in chromocenters. DNA methylation is a dynamic covalent modification on the cytosine residues (5-methylcytosine, 5mC) of CpG dinucleotides that are enriched in the promoter regions of many genes. Three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) participate in methylation of DNA during development. Detecting 5mC with immunohistochemical techniques is very challenging, contributing to variability in results, as all DNA bases including 5mC modified bases are hidden within the double-stranded DNA helix. However, detailed delineation of 5mC distribution during development is very informative. Here, we describe a reproducible technique for robust immunohistochemical detection of 5mC and another epigenetic DNA marker 5-hydroxymethylcytosine (5hmC), which colocalizes with the &#34;open&#34;, transcriptionally active chromatin in developing and postmitotic mouse retina.

The objective of this report is to describe the protocol for robust immunohistochemical detection of epigenetic markers, 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in developing and postmitotic mouse retina.

5-metilsitozin ve gelişmekte olan 5-arasında bakterilerde görülen immunohistokimyasal tespiti ve Postmitotic fare Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a ...

Analysis of Actomyosin Dynamics at Local Cellular and Tissue Scales Using Time-lapse Movies of Cultured Drosophila Egg Chambers

Drosophila immature eggs are called egg chambers, and their structure resembles primitive organs that undergo morphological changes from a round to an ellipsoid shape during development. This developmental process is called oogenesis and is crucial to generating functional mature eggs to secure the next fly generation. For these reasons, egg chambers have served as an ideal and relevant model to understand animal organ development.
Several in vitro culturing protocols have been developed, but there are several disadvantages to these protocols. One involves the application of various covers that exert an artificial pressure on the imaged egg chambers in order to immobilize them and to increase the imaged acquisition plane of the circumferential surface of the analyzed egg chambers. Such an approach may negatively influence the behavior of the thin actomyosin machinery that generates the power to rotate egg chambers around their longer axis.
Thus, to overcome this limitation, we culture Drosophila egg chambers freely in the media in order to reliably analyze actomyosin machinery along the circumference of egg chambers. In the first part of the protocol, we provide a manual detailing how to analyze the actomyosin machinery in a limited acquisition plane at the local cellular scale (up to 15 cells). In the second part of the protocol, we provide users with a new Fiji-based plugin that allows the simple extraction of a defined thin layer of the egg chambers&#8217; circumferential surface. The following protocol then describes how to analyze actomyosin signals at the tissue scale (&#62;50 cells). Finally, we pinpoint the limitations of these approaches at both the local cellular and tissue scales and discuss its potential future development and possible applications.

Analysis of Actomyosin Dynamics at Local Cellular and Tissue Scales Using Time-lapse Movies of Cultured Drosophila Egg Chambers

This protocol provides a Fiji-based, user-friendly methodology along with straightforward instructions explaining how to reliably analyze actomyosin behavior in individual cells and curved epithelial tissues. No programming skills are required to follow the tutorial; all steps are performed in a semi-interactive manner using the graphical user interface of Fiji and associated plugins.

Kültür Drosophila Egg Chambers Time-Lapse filmler kullanarak yerel hücresel ve doku ölçeklerde Actomyosin dinamikleri Analizi

Drosophila immature eggs are called egg chambers, and their structure resembles primitive organs that undergo morphological changes from a round to an ...

Thawing, Culturing, and Cryopreserving Drosophila Cell Lines

There are currently over 160 distinct Drosophila cell lines distributed by the Drosophila Genomics Resource Center (DGRC). With genome engineering, the number of novel cell lines is expected to increase. The DGRC aims to familiarize researchers with using Drosophila cell lines as an experimental tool to complement and drive their research agenda. Procedures for working with a variety of Drosophila cell lines with distinct characteristics are provided, including protocols for thawing, culturing, and cryopreserving cell lines. Importantly, this publication demonstrates the best practices required to work with Drosophila cell lines to minimize the risk of contaminations from adventitious microorganisms or from other cell lines. Researchers who become familiar with these procedures will be able to delve into the many applications that use Drosophila cultured cells including biochemistry, cell biology and functional genomics.

Thawing, Culturing, and Cryopreserving Drosophila Cell Lines

Drosophila cell lines are important reagents for both fundamental and biomedical research. This article provides protocols for thawing, subculturing, and the cryopreservation of commonly used Drosophila cell lines to assist researchers in incorporating the use of these reagents in their research.

Çözdürme, kültür ve Drosophila hücre hatları Cryopreserving

There are currently over 160 distinct Drosophila cell lines distributed by the Drosophila Genomics Resource Center (DGRC). With genome engineering, the ...