This study was supported by a grant from the National Science Foundation to Pelin C. Volkan (DEB-1457690).

The following protocol is consistent with the ethics guidelines established by the Duke University Research Ethics Committee.
1. Tissue Preparation and Developmental Staging of Drosophila melanogaster Pupa
<ol>
	<li>First, identify how many flies will be necessary for the dissection. For RT-PCR and RNAseq, collect 100 - 200 antennal discs and antennae from individuals which are necessary at prepupal, 8 h APF, 40 h APF, and adult stages. For immunohistochemistry, dissect 10 - 20 individual.</li>
	<li>Clean all materials, including dissection pads and forceps, using wipes with 70% EtOH. If the dissected material is to be used for RNA extractions, clean everything with RNase neutralizers and make all solutions using either nuclease-free or diethyl pyrocarbonate (DEPC) treated water. 
	NOTE: This protocol uses silicone dissection pads instead of glass for the dissections. Silicone pads are friendly to ultra-fine forceps and promote fast and high-quality dissections.</li>
	<li>Collect pupa at the 0 h APF/prepupal stage.
	<ol>
		<li>To ensure the most precise staging, monitor the larvae at 30 min to 1 h intervals. 
		NOTE: Wandering third instar larvae in a moderately crowded bottle will likely pupate within a few hours.</li>
		<li>Once the larvae become immobile and are surrounded by a very light (almost white) colored pupal case, transfer them into a small 2-in Petri dish with a moist filter paper.</li>
		<li>Continue for 1 - 2 h, occasionally monitoring, identifying, and transferring prepupae. 
		NOTE: Alternatively, clear a bottle of all pupae and allow the larvae to develop for 2 h. All pupae collected after 2 h will be within a 0 - 2 h APF range.</li>
	</ol>
	</li>
	<li>Immediately move to step 3.1 to dissect the prepupal antennal disc for the 0 h APF stage. If the prepupa needs to be aged, collect them into a dish, cover the dish and place a paraffin film around the edges to inhibit dryness, and place the Petri dish at 25 &#176;C. 
	NOTE: The pupae can now be aged to eclosion.</li>
	<li>For pupae collected in a 2 h range, age the prepupae for 2 h less than the desired age in order to ensure that the pupae do not overage.</li>
	<li>Use ultra-fine forceps (Dumont 55) as the tissue is very small and fragile.</li>
</ol>
2. Tissue Preparation and Developmental Staging of Pupa from Other Drosophila Species
<ol>
	<li>To determine the length of the pupal development in other Drosophila species, place the samples at the optimum temperature, record the dates when prepupae are observed, sort them into a fresh vial, and record the number of days from prepupa to adulthood.</li>
	<li>Record the ratio of time for pupal development for non-melanogaster species and for melanogaster. Multiply the ratio of the developmental time by the number of hours used for staging melanogaster to obtain the number of hours to age the non-melanogaster species.</li>
</ol>
3. Dissection of D. melanogaster Pupal Antennal Disc
Note: All the aging times and dissection protocols are described for Drosophila melanogaster. For all other species, a modification of the aging protocol based on species-specific developmental time points will be required, as described above.
<ol>
	<li>For pupal antennal disc dissections, collect 50 - 100 0 - 2 h or 6 - 8 h old pupae using a spatula and place them on a dissection pad.</li>
	<li>Pipette 150 &#181;L of RNA isolation solution into an RNase free 1.5-mL microfuge tube using a 200-&#181;L pipette and place the tube on ice.</li>
	<li>Dissect the pupae in 150 - 200 &#181;L of 1x PBS (phosphate buffered saline, nuclease-free). Place multiple droplets of PBS (150 - 200 &#181;L per droplet) on the dissection pad.</li>
	<li>On the dissection pad, place the 0 - 2 h or 6 - 8 h aged pupae (one pupa per drop) to be dissected in one of the 1x PBS droplets. Use forceps in one hand to stabilize the body.</li>
	<li>For the 0 - 2 h aged pupae, using forceps in the other hand, hold on to the most anterior part (the mouth hooks) of the prepupa and pull it out to expose the brains and the imaginal discs attached to the anterior pupal case.</li>
	<li>For the 8 h APF pupae, first gently peel off the pupal case from the most anterior quarter of the pupa, exposing the head within the membrane sack that surrounds the body. 
	NOTE: The body, at this stage, looks like a degenerating larva.</li>
	<li>Remove the head at the neck joint. 
	NOTE: This ensures that the antennal discs will not be lost, which at this stage are connected primarily to the optic lobes of the brain.</li>
	<li>Transfer the tissue with the brains and the imaginal discs to another 1x PBS droplet using forceps or a 20-&#181;L pipette.</li>
	<li>Identify the eye-antennal disc connected to the brain at the optic lobes. Using forceps, disconnect the eye-antennal disc from the brain and the pupal case. Transfer it to a new 1x PBS droplet using forceps or a 20-&#181;L pipette. 
	NOTE: The prepupal eye-antennal disc is a flat tissue. However, by the 8 h pupae, the eye discs are rotated cupping the antennal discs, which sits anterior to the central brain.</li>
	<li>Using forceps, cut the tissue at the site of connection between the eye and the antennal disc. Use a 20-&#181;L pipette to gently transfer the dissected tissue into the RNA isolation solution reagent. Minimize the amount of liquid transferred by pipetting an amount as small as possible.</li>
	<li>Repeat until all pupae have been dissected.</li>
</ol>
4. Dissection of D. melanogaster Mid-pupal and Adult Antennae
Note: By 40 h APF, the majority of the metamorphosis is complete, and the adult structures are becoming apparent, but are still white and nondescript. At this developmental time point, the adult antenna has taken its final shape yet still is transparent and the majority of the olfactory receptors, except for a few, have not started expression.
<ol>
	<li>For pupal antennal dissections, collect 50 - 100 prepupae as described in step 1 and age them for 40 h at 25 &#176;C.</li>
	<li>Pipet 150 &#181;L of RNA isolation solution into an RNase free 1.5-mL microcentrifuge tube using a 200-&#181;L pipet and place the tube on ice.</li>
	<li>On the dissection pad, place the pupa to be dissected into one of the 1x PBS droplets. Use forceps in one hand to stabilize the body. Using forceps in the other hand, gently peel off the pupal case from the most anterior quarter of the pupa, exposing the head within the membrane sack that surrounds the body.</li>
	<li>Using forceps, carefully cut off the head from the rest of the pupal body by holding the body with one set of forceps and ripping the head off at the neck joint with another set of forceps. Gently transfer the head into another 1x PBS droplet using forceps. Pipette up and down to clean out the contents of the head (the brain, etc.) to obtain a clear membrane that used to surround the developing Drosophila head. 
	NOTE: At 40 - 50 h APF, the antennae are connected to the anterior-most section of the membrane. They will become apparent for dissection when the contents of the head are cleared with pipetting.</li>
	<li>Using forceps, disconnect the pupal antennae from the membrane. Disconnect the 2nd segment of the antenna from the 3rd using forceps to slice at the segmental joint, as only the 3rd segment will house the olfactory receptor neurons.</li>
	<li>Use a 20-&#181;L pipette to gently transfer the dissected tissue into the RNA isolation solution reagent. Minimize the amount of liquid transferred by pipetting an amount as small as possible. Repeat until all pupae have been dissected.</li>
	<li>For adult antennal dissections, collect approximately 50 adults and age them for a week post-eclosion. 
	NOTE: The expression of olfactory receptor genes and other genes peak a week after eclosion. The adults are aged for a week to ensure biologically relevant genes with low abundance transcripts to rise above the detection threshold.</li>
	<li>For RNA extractions, dissect flies while they are still alive on a CO2 pad. Treat the CO2 pad with RNase inhibitors. For confocal imaging, dissect the flies on a dissection pad in 1x PBS or PBS + 0.2% Triton.</li>
	<li>First, put the adults to sleep on the CO2 station pad under the dissection scope. On the CO2 station pad, using forceps in one hand to stabilize the body, use forceps in the other hand to gently pull/pinch out the third antennal segment from the second.</li>
	<li>Transfer the antennae into an RNA isolation solution, using forceps to place the antennae directly into the liquid. Repeat until all adults have been dissected. 
	NOTE: Ensure that the antennae are submerged in RNA isolation solution. The antennae may become stuck on the side of the tube. This will cause an increased degradation of the RNA, reducing RNA quality and quantity.</li>
	<li>Directly proceed to the RNA extraction or place the tube at -80 &#176;C for long-term storage.</li>
</ol>
5. RNA Isolation from Dissected Tissues
<ol>
	<li>Remove all samples from the -80 &#176;C storage and thaw them on ice.</li>
	<li>Briefly spin (5 - 6 s, ~6,000 x g) each sample to collect the material at the bottom of the tube.</li>
	<li>Grind each sample using an autoclaved plastic pestle and an electric motor for 10 s on ice.</li>
	<li>Repeat steps 5.2 and 5.3 4.</li>
	<li>Perform the RNA extraction using commercially available kits and following the manufacturer&#39;s protocols for an optimal yield.</li>
	<li>Perform qRT-PCR using commercially available reagents and specific primers against genes of interest and following the manufacturer&#39;s protocols.
	<ol>
		<li>Carry out all PCR reactions using the following conditions: 95 &#176;C denaturation for 10 min followed by 40 cycles of 95 &#176;C for 15 s, 55 &#176;C for 30 s, and 60 &#176;C for 30 s. 
		NOTE: Primer pairs for DIP and dpr genes are listed in Table 1, and primers for olfactory receptor genes are listed in Hueston CE et al.8.</li>
	</ol>
	</li>
</ol>
6. Fixation of the Pupal Antennal Discs and Antennae for Immunohistochemistry
NOTE: Fix the tissues in batches from 10 - 20 individuals to ensure the tissues are fixed for the same amount of time. Minimize the amount of time the samples stay in PBT (PBS with detergent) prior to transferring them to a fixative to maximize the integrity of the tissues.
<ol>
	<li>Collect the dissected antennal discs or pupal antennae in a 200-&#181;L PCR tube containing 200 &#181;L of 0.2% PBT on ice to maintain tissue integrity, and to avoid the sample from sticking to the wall of 200-&#181;L PCR tubes which will lead to an incomplete fixation. 
	Note: Pupal antennae and antennal discs can be difficult to see as they are quite translucent. It is advisable to use a dissection scope for all washing steps to prevent any loss of tissue. Alternatively, 96-well Terasaki plates may be used for the fixation and staining to best track the tissue.</li>
	<li>Fix the dissected antennal disc and antennal samples from pupae in approximately 200 &#181;L of 4% PFA (Paraformaldehyde) for 30 min at room temperature. For this and subsequent steps, keep the tubes with the samples on a nutator to properly mix the samples in the solution. Progress to step 6.7.</li>
	<li>For the adult antenna, dissect the entire head first and fix it in approximately 200 &#181;L of 4% PFA (paraformaldehyde) for 1 h at room temperature.</li>
	<li>Wash 3x with 200 &#181;L of 0.2% PBT for 10 min each. Keep the samples on the nutator during the incubation.</li>
	<li>Go back to the dissection microscope for a finer dissection of the second antennal segment from the fixed heads. Using forceps to stabilize the head, gently pull/pinch out the third antennal segment from the second.</li>
	<li>Transfer the dissected third antennal segments into approximately 200 &#181;L of 4% PFA (paraformaldehyde) and fix them for 30 min at room temperature.</li>
	<li>Wash 3x with 200 &#181;L of 0.2% PBT for 10 min each. Keep the samples on the nutator during the incubation.</li>
	<li>Store the samples at 4 &#176;C or continue directly with whole mount immunohistochemistry. 
	Note: The efficiency of staining might change when the antibody is being used. This method should be appropriate for less abundant protein tags or weaker antibodies. However, at times, it might require an optimization of the protocol (either the identity or amount of the fixative or the time of fixation).</li>
</ol>

<ol>
	<li>Barish, S., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+olfactory+receptor+neuron+specification+in+Drosophila.">Mechanisms of olfactory receptor neuron specification in Drosophila.</a> Wiley Interdisciplinary Reviews. Developmental Biology. 4 (6), 609-621 (2015).</li><li>Pan, J. W., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+development+and+evolution+of+the+insect+olfactory+system.">Mechanisms of development and evolution of the insect olfactory system.</a> Cell and Developmental Biology. 2, 130 (2013).</li><li>Ramdya, P., Benton, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolving+olfactory+systems+on+the+fly.">Evolving olfactory systems on the fly.</a> Trends in Genetics. 26 (7), 307-316 (2010).</li><li>Bellen, H. J., Tong, C., Tsuda, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=100+years+of+Drosophila+research+and+its+impact+on+vertebrate+neuroscience:+a+history+lesson+for+the+future.">100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future.</a> Nature Reviews Neuroscience. 11 (7), 514-522 (2010).</li><li>Knecht, Z. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+combinations+of+variant+ionotropic+glutamate+receptors+mediate+thermosensation+and+hygrosensation+in+Drosophila.">Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila.</a> eLife. 5, 44-60 (2016).</li><li>Enjin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humidity+sensing+in+Drosophila.">Humidity sensing in Drosophila.</a> Current Biology. 26 (10), 1352-1358 (2016).</li><li>Li, Q., Barish, S., Okuwa, S., Volkan, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Examination+of+endogenous+rotund+expression+and+function+in+developing+Drosophila.+olfactory+system+using+CRISPR-Cas9-mediated+protein+tagging.">Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging.</a> G3: Genes|Genomes|Genetics. 5 (12), 2809-2816 (2015).</li><li>Hueston, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modulatory+proteins+and+olfactory+receptor+signaling+in+the+refinement+and+maintenance+of+fruitless+expression+in+olfactory+receptor+neurons.">Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons.</a> PLoS Biology. 14 (4), 1002443 (2016).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+rules+of+precursor+specification+underlying+olfactory+neuron+diversity.">Combinatorial rules of precursor specification underlying olfactory neuron diversity.</a> Current Biology. 23 (24), 2481-2490 (2013).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functionally+conserved+gene+regulatory+network+module+governing+olfactory+neuron+diversity.">A functionally conserved gene regulatory network module governing olfactory neuron diversity.</a> PLoS Genetics. 12 (1), 1005780 (2016).</li><li>Pan, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patterns+of+transcriptional+parallelism+and+variation+in+the+developing+olfactory+system+of+Drosophila+species.">Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species.</a> Scientific Reports. 7 (1), 8804 (2017).</li><li>Pan, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+behavioral+and+transcriptional+variation+underlying+CO2+sensory+neuron+function+and+development+in+Drosophila.">Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila.</a> Fly. 11 (4), 239-252 (2017).</li><li>Stern, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+and+transgenic+reagents+for+Drosophila+simulans,+D.+mauritiana,+D.+yakuba,+D.+santomea,+and+D.+virilis.">Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis.</a> G3: Genes|Genomes|Genetics. 7 (4), 1339-1347 (2017).</li></ol>

The authors have nothing to disclose.

This protocol is a useful resource for labs interested in identifying the genetic and transcriptional programs operating in developing Drosophila olfactory tissue, as well as a comparative analysis of these programs across Drosophila species. It is especially useful if systems-level transcriptional profiles from different developmental stages are needed as a primer for future studies. The protocol described here demonstrates how to stage and isolate developing olfactory tissue from Drosophila to obtain samples from four key stages of olfactory system development from pre-patterning to terminal differentiation, to be used in molecular and immune-histological studies. Dissected Drosophila antennal discs and antennae at different pupal stages can be used to identify gene expression profiles during the olfactory system development at the systems level by RNA-seq, or at the level of individual genes by quantitative RT-PCR. Samples can also be used for immunohistochemistry and in situ hybridization to identify in vivo patterns of tissue-specific gene expression. An additional advantage of this protocol is that dissected samples can be further dissociated using standard methods, and FAC-sorted to obtain a purified cellular population (or single cells) for cell type-specific molecular analyses, such as quantitative RT-PCR or RNAseq.
Even though the protocol demonstrates dissections of antennal discs and antennae from pupal (at 0 h/prepupa, 8 h, and 40 h APF) and adult stages, it can be adapted to other pupal time points. It is also worth mentioning that learning these dissections takes time and practice. An expert should be able to dissect 50 samples an hour. It is important to not overage the pupae. Therefore, an hour before beginning dissection, ensure that no pupae are older than the desired age. Dissections can take time to learn, so a period of practice for each stage is required prior to starting experiments. Dissections become more difficult from 9 - 12 h APF due to morphological changes. It is possible to sort pupae by age when collecting prepupae (by body color, with darker colors being older). Initially sorting prepupae allows for dissection in order of age to prevent overaging.
The protocol described above can be applied to other Drosophila species. The timing for the pupal dissections of other species can be based both on the ratio of the pupal development of a given species at 25 &#176;C to the D. melanogaster and on comparative observations of antennae/antennal disc morphology during dissections, with a priority given to morphological considerations to be as identical as possible. For Drosophila melanogaster, the pupal stage takes approximately 4 days. D. sechellia and D. erecta pupal developmental staging is similar to D. melanogaster; however, D. virilis pupal development is 1.3x longer11,12. When other species are prepared for dissection, the staging should be based on both the timing of the pupal period and comparative observations of stage-specific antennae/antennal disc morphology, with the morphological similarity being the highest priority. First, identify the optimum handling temperature for the species you are interested in. Many species grow well at 25 &#176;C, but detailed information on maintenance conditions can be obtained from the UC San Diego Drosophila species stock center.
The most critical steps in the protocol are the correct staging and proper dissection of the tissue of interest in adequate numbers from different species. Once these are in place, the protocol provides an efficient method of tissue collection for such analyses and can be practically adapted to any developing imaginal disc tissue during the pupal stages in any Drosophila species.
One limitation of this protocol is that it does not provide cell type-specific samples. A more detailed understanding of cellular function and morphology requires cell type-specific profiling of transcription at a systems level, in addition to standard molecular procedures such as quantitative RT-PCR or immunohistochemistry. Cell type-specific profiling has been difficult, especially given the lack of cell type-specific reporter transgenics in non-melanogaster species. With the current advances in cellular profiling, transgenics, and CRISPR-Cas9 mediated genome editing in non-melanogaster species, it is now possible to label and sort out single cells of interest to profile transcription13.

The olfactory system of Drosophila is a widely used system in developmental neurobiology, systems neuroscience, as well as neurophysiology, behavior studies, and behavioral evolution1,2,3,4. Drosophila olfactory tissues house the olfactory receptor neurons (ORNs) that detect volatile chemical cues in addition to hydro- and thermo-sensory neurons1,5,6. The overall goal of this manuscript is to demonstrate how to stage and dissect developing pupal and adult olfactory tissue in Drosophila species. The rationale for this technique is to generate samples from different pupal stages for molecular and developmental analyses of the peripheral olfactory system, such as RNAseq and quantitative RT-PCR, in addition to in vivo tissue labeling techniques. This technique can be especially useful to identify dynamics of transcriptional profiles in the developing adult olfactory system from non-melanogaster Drosophila species, which do not have all the transgenic reagents for cell type specific labeling and analyses. In this manuscript, we demonstrate how to dissect antennal discs and antennae from pupal and adult Drosophila species. First, we show how to identify Drosophila 0 h of puparium formation (APF, white pupae or prepupae) for developmental staging and species-specific aging. Next, we show how to dissect antennal discs and the third antennal segment; specifically, how to dissociate them from the eye disc and second antennal segment for the tissue purity required for RNAseq or RT-PCRs. The stages in D. melanogaster described in this protocol roughly correspond to the pre-patterned antennal disc (prepupae), the selection of precursors from the antennal disc (8 h APF), the start of the terminal differentiation for ORNs (40 h APF), and adult antenna. Finally, we give examples for a quantitative RT-PCR from adult antennae isolated using the method, and for in vivo immunohistochemistry. This method can be used to generate samples for an RNA/DNA analysis and for immunohistochemistry on developing peripheral olfactory tissues from different Drosophila species.

<table border="0" cellpadding="0" cellspacing="0" style="width:1180px;" width="1180">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:271px;">10X Phosphate-buffered Saline</td>
			<td style="width:236px;">Gibco</td>
			<td style="width:241px;">70011-044</td>
			<td style="width:432px;">Dilute to 1X in RNase free water</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 tank</td>
			<td>Air Gas</td>
			<td>CD R200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Two sharp forceps (Dumont #55)</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol</td>
			<td>Invitrogen</td>
			<td>15596-026</td>
			<td>RNA isolation solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dissecting Microscope</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small bucket with ice</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P20 and P200 micropipettes and tips</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.7 mL Microfuge tubes</td>
			<td></td>
			<td></td>
			<td>Purchase nuclease free for best results</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.2 mL PCR tubes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde powder</td>
			<td>Polysciences</td>
			<td>380</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10% Triton X-100</td>
			<td>Teknova</td>
			<td>T1105</td>
			<td>Dilute to 0.2% v/v in 1X PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2&#34; petri dishes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">55mm filter paper</td>
			<td>Whatman</td>
			<td>1001-055</td>
			<td>Wet with water and place in a petri dish to keep pupae moist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">25 C incubator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">deionized H2O</td>
			<td></td>
			<td></td>
			<td>Purchase nuclease free or treat with DEPC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sylgard 184 Silicone Elastomer Kit</td>
			<td>Dow Corning</td>
			<td></td>
			<td>to be used for making dissection pads from Terizaki plate covers.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroWell Mini Trays with lids</td>
			<td>Nunc</td>
			<td>438733</td>
			<td>Lids can be used to make silicone dissection pads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-GFP antibody</td>
			<td>MBL international corpor</td>
			<td>PM005</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse anti RAT CD2</td>
			<td>AbD seroTec</td>
			<td>MCA154RHDL</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ADL195 (anti lamin, mouse)</td>
			<td>Dev studies hydoma ban</td>
			<td>ADL195-s</td>
			<td>primary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor&#174; 488 goat anti-rabbit IgG (H+L)</td>
			<td>invitrogen</td>
			<td>A11008</td>
			<td>Secondary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cy3 Goat Anti-Mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-166-003</td>
			<td>Secondary antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered</td>
			<td>CALBIOCHEM</td>
			<td>648463</td>
			<td>detergent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lab Rotator</td>
			<td>Thermo scientific</td>
			<td></td>
			<td>Rotator</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease Free Water</td>
			<td>Growcells.com</td>
			<td>NUPW-0125</td>
			<td>Water</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Light-Duty Tissue Wipers</td>
			<td>VWR</td>
			<td>82003-822</td>
			<td>For cleaning dissection supplies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript II</td>
			<td>invitrogen</td>
			<td>18064014</td>
			<td>Reverse Transcriptase&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAshredder (50)</td>
			<td>RNA extraction</td>
			<td>QIAGEN</td>
			<td>79654</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo(dT)12-18 Primer</td>
			<td>RT</td>
			<td>life technologies</td>
			<td>18418012</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNeasy MinElute Cleanup Kit (50)</td>
			<td>RNA extraction</td>
			<td>QIAGEN</td>
			<td>74204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FASTSTART UNIV SG MASTER (5 ML)(500 RXN)</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>04913850001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FASTSTART ESSENTIAL GREEN DNA MASTER&#160;</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>06402712001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LIGHTCYCLER 480 - MULTIWELL PLATE 96</td>
			<td>qPCR</td>
			<td>Roche</td>
			<td>04729692001</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NEBNext High-Fidelity 2X PCR Master Mix</td>
			<td>qPCR</td>
			<td>NEB</td>
			<td>M0541S</td>
		</tr>
	</tbody>
</table>

preparing developing peripheral olfactory tissue for molecular and immunohistochemical analysis in drosophila

The olfactory system of Drosophila is a widely used system in developmental neurobiology, systems neuroscience, as well as neurophysiology, behavior, and behavioral evolution. Drosophila olfactory tissues house the olfactory receptor neurons (ORNs) that detect volatile chemical cues in addition to hydro- and thermo-sensory neurons. In this protocol, we describe the dissection of developing peripheral olfactory tissue of the adult Drosophila species. We first describe how to stage and age Drosophila larvae, followed by the dissection of the antennal disc from early pupal stages, followed by the dissection of the antennae from mid-pupal stages and adults. We also show methods where preparations can be utilized in molecular techniques, such as the RNA extraction for qRT-PCR, RNAseq, or immunohistochemistry. These methods can also be applied to other Drosophila species after species-specific pupal development times are determined, and respective stages are calculated for appropriate aging.

The dissected developing olfactory tissue can be used for RNA extraction followed by RT-PCR to assess gene expression or can be taken through immunohistochemistry protocols to determine its expression pattern, and the sub-cellular localization of genes of interest. In this section, we present representative results from either protocol. Figure 1 is the representative quantitative RT-PCR showing the transcription of cell surface receptor and olfactory receptor genes in wild-type adult antennae. Figure 2 shows the 6 - 8 h and 12 h APF antennal disc stainings on Rn-EGFP transgenic flies using anti-GFP (1:1000) and anti-lamin antibodies (1:100) (Figure 2A and 2B). Rn-EGFP labels particular regions within the antennal disc during early pupal stages. We also show 40 h APF pupal antennal anti-GFP antibody staining of Or67d-GAL4 UAS-CD8GFP transgenic flies, and adult antennal anti-elav (1:100) antibody staining of ORNs (Figure 2). Other examples can also be found in the literature7,8,9,10.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57716/57716fig1v2.jpg" /> 
Figure 1. Quantitative RT-PCR from wild-type adult antennal RNA samples for different genes. These panels show quantitative RT-PCR results for (A) DIP-alpha, DIP-eta, dpr5, dpr8, kug, beatIIIb (for primer pairs see Table 1), and (B) olfactory and ionotropic receptor (Or/Ir) genes from adult antennal RNA samples. The error bars show a standard error of mean (SEM). Or/Ir genes are low abundance RNAs that can still be detected by qRT-PCR. The expression of each gene was analyzed in triplicate. Ct values were used to calculate the dilution factors for each gene based upon standard curves created for each gene. The dilution factors were then normalized for each gene to the average expression of all genes measured as described before8. <a href="/files/ftp_upload/57716/57716fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57716/57716fig2.jpg" /> 
Figure 2. Immunohistochemistry using different antibodies on developing olfactory tissues. These panels show anti-GFP (green) and anti-lamin (red) antibody stainings on (A) 6 h APF pupal antennal discs and&#160;(B) 12 h APF pupal antennal discs. (C) This panel shows a 40 h APF antenna from Or67d GAL4 UAS-CD8GFP transgenics stained with rabbit anti-GFP (green) antibodies. (D) This panel shows adult antennae stained with anti-CD2 antibodies, which label Or47b-CD2 positive ORNs (magenta). <a href="/files/ftp_upload/57716/57716fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Forward primer</td>
			<td>Reverse primer</td>
			<td>Length</td>
		</tr>
		<tr>
			<td>CGGAGAGGAGGTTATGAGCA</td>
			<td>GGAAGTGCACAACTAGCGTT</td>
			<td>143</td>
		</tr>
		<tr>
			<td>CGCGAATCGTTGTGTCAGTA</td>
			<td>TGTCGATAGCGTGAACCTGA</td>
			<td>129</td>
		</tr>
		<tr>
			<td>AGGAGTGGACGTTGAGTTACA</td>
			<td>CAATCATGTCCTCGTGACCG</td>
			<td>146</td>
		</tr>
		<tr>
			<td>TAGAGTCCGAGCAGCAGATG</td>
			<td>GTCAGAATTCGAGTTGTCCGC</td>
			<td>104</td>
		</tr>
		<tr>
			<td>GGCGCTAAGTAGCAGGACG</td>
			<td>GGCCAAGTCTGTTTGTGAGG</td>
			<td>215</td>
		</tr>
		<tr>
			<td>TAAGACCCTAGCGCCCTCTT</td>
			<td>AGGGAGATGCGCTTTGAGAC</td>
			<td>129</td>
		</tr>
	</tbody>
</table>
Table 1. List of PCR primers used in qRT-PCR.

Watch this Scientific Journal Video about Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila at JoVE.com

Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

Here, we present a protocol to stage and dissect developing olfactory tissue from Drosophila species. The dissected tissue can later be used for molecular analyses, such as quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) or RNA sequencing (RNAseq), as well as in vivo analyses such as immunohistochemistry or in situ hybridization.

Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

The olfactory system of Drosophila is a widely used system in developmental neurobiology, systems neuroscience, as well as neurophysiology, behavior, and ...

preparing-developing-peripheral-olfactory-tissue-for-molecular

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

5.7K Views.  Duke University. Here, we present a protocol to stage and dissect developing olfactory tissue from Drosophila species. The dissected tissue can later be used for molecular analyses, such as quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) or RNA sequencing (RNAseq), as well as in vivo analyses such as immunohistochemistry or in situ hybridization.

Video: Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila

Preparation of Mitochondrial Enriched Fractions for Metabolic Analysis in Drosophila

Since mitochondria play roles in amino acid metabolism, carbohydrate metabolism and fatty acid oxidation, defects in mitochondrial function often compromise the lives of those who suffer from these complex diseases. Detecting mitochondrial metabolic changes is vital to the understanding of mitochondrial disorders and mitochondrial responses to pharmacological agents. Although mitochondrial metabolism is at the core of metabolic regulation, the detection of subtle changes in mitochondrial metabolism may be hindered by the overrepresentation of other cytosolic metabolites obtained using whole organism or whole tissue extractions. 
Here we describe an isolation method that detected pronounced mitochondrial metabolic changes in Drosophila that were distinct between whole-fly and mitochondrial enriched preparations. To illustrate the sensitivity of this method, we used a set of Drosophila harboring genetically diverse mitochondrial DNAs (mtDNA) and exposed them to the drug rapamycin. Using this method we showed that rapamycin modifies mitochondrial metabolism in a mitochondrial-genotype-dependent manner. However, these changes are much more distinct in metabolomics studies when metabolites were extracted from mitochondrial enriched fractions. In contrast, whole tissue extracts only detected metabolic changes mediated by the drug rapamycin independently of mtDNAs.

Preparation of Mitochondrial Enriched Fractions for Metabolic Analysis in Drosophila

Mitochondria play central roles in the regulation of metabolism and homeostasis. Subtle changes in mitochondrial metabolism that affect organismal physiology could be difficult to detect in whole organism metabolomics studies. Here we describe an isolation method that enhances the detection of subtle metabolic shifts in Drosophila melanogaster.

Since mitochondria play roles in amino acid metabolism, carbohydrate metabolism and fatty acid oxidation, defects in mitochondrial function often ...

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

The zebrafish model is an emerging system for the study of neuromuscular disorders. In the study of neuromuscular diseases, the integrity of the muscle membrane is a critical disease determinant. To date, numerous neuromuscular conditions display degenerating muscle fibers with abnormal membrane integrity; this is most commonly observed in muscular dystrophies. Evans Blue Dye (EBD) is a vital, cell permeable dye that is rapidly taken into degenerating, damaged, or apoptotic cells; in contrast, it is not taken up by cells with an intact membrane. EBD injection is commonly employed to ascertain muscle integrity in mouse models of neuromuscular diseases. However, such EBD experiments require muscle dissection and/or sectioning prior to analysis. In contrast, EBD uptake in zebrafish is visualized in live, intact preparations. Here, we demonstrate a simple and straightforward methodology for performing EBD injections and analysis in live zebrafish. In addition, we demonstrate a co-injection strategy to increase efficacy of EBD analysis. Overall, this video article provides an outline to perform EBD injection and characterization in zebrafish models of neuromuscular disease.

In this study, we describe a straightforward method to perform Evans Blue Dye (EBD) analysis on zebrafish larvae. This technique is a powerful tool for the characterization of skeletal muscle integrity and delineation of zebrafish models of muscular dystrophy, and is a valuable method for the development of novel therapeutics.

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Live Imaging of Mouse Secondary Palate Fusion

The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to cleft secondary palate, a common congenital anomaly in humans. Secondary palate fusion has been extensively studied leading to several proposed cellular mechanisms that may mediate this process. However, these studies have been mostly performed on fixed embryonic tissues at progressive timepoints during development or in fixed explant cultures analyzed at static timepoints. Static analysis is limited for the analysis of dynamic morphogenetic processes such a palate fusion and what types of dynamic cellular behaviors mediate palatal fusion is incompletely understood. Here we describe a protocol for live imaging of ex vivo secondary palate fusion in mouse embryos. To examine cellular behaviors of palate fusion, epithelial-specific Keratin14-cre was used to label palate epithelial cells in ROSA26-mTmGflox reporter embryos. To visualize filamentous actin, Lifeact-mRFPruby reporter mice were used. Live imaging of secondary palate fusion was performed by dissecting recently-adhered secondary palatal shelves of embryonic day (E) 14.5 stage embryos and culturing in agarose-containing media on a glass bottom dish to enable imaging with an inverted confocal microscope. Using this method, we have detected a variety of novel cellular behaviors during secondary palate fusion. An appreciation of how distinct cell behaviors are coordinated in space and time greatly contributes to our understanding of this dynamic morphogenetic process. This protocol can be applied to mutant mouse lines, or cultures treated with pharmacological inhibitors to further advance understanding of how secondary palate fusion is controlled.

Here, we present a protocol for live imaging of mouse secondary palate fusion using confocal microscopy. This protocol can be used in combination with a variety of fluorescent reporter mouse lines, and with pathway inhibitors for mechanistic insight. This protocol can be adapted for live imaging in other developmental systems.

The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to ...

Correlative Super-resolution and Electron Microscopy to Resolve Protein Localization in Zebrafish Retina

We present a method to investigate the subcellular protein localization in the larval zebrafish retina by combining super-resolution light microscopy and scanning electron microscopy. The sub-diffraction limit resolution capabilities of super-resolution light microscopes allow improving the accuracy of the correlated data. Briefly, 110 nanometer thick cryo-sections are transferred to a silicon wafer and, after immunofluorescence staining, are imaged by super-resolution light microscopy. Subsequently, the sections are preserved in methylcellulose and platinum shadowed prior to imaging in a scanning electron microscope (SEM). The images from these two microscopy modalities are easily merged using tissue landmarks with open source software. Here we describe the adapted method for the larval zebrafish retina. However, this method is also applicable to other types of tissues and organisms. We demonstrate that the complementary information obtained by this correlation is able to resolve the expression of mitochondrial proteins in relation with the membranes and cristae of mitochondria as well as to other compartments of the cell.

This protocol describes the necessary steps to obtain subcellular protein localization results on zebrafish retina by correlating super-resolution light microscopy and scanning electron microscopy images.

We present a method to investigate the subcellular protein localization in the larval zebrafish retina by combining super-resolution light microscopy and ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

A Quantitative Measurement of Reactive Oxygen Species and Senescence-associated Secretory Phenotype in Normal Human Fibroblasts During Oncogene-induced Senescence

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. Recent studies have extended the role of cellular senescence to various physiological processes, including development, wound healing, immune surveillance, and age-related tissue dysfunction. Although cell cycle arrest is a critical hallmark of cellular senescence, an increased intracellular reactive oxygen species (ROS) production has also been demonstrated to play an important role in the induction of cellular senescence. In addition, recent studies revealed that senescent cells exhibit potent paracrine activities on neighboring cells and tissues through a senescence-associated secretory phenotype (SASP). The sharp increase in interest regarding therapeutic strategies against cellular senescence emphasizes the need for a precise understanding of senescence mechanisms, including intracellular ROS and the SASP. Here, we describe protocols for quantitatively assessing intracellular ROS levels during H-Ras-induced cellular senescence using ROS-sensitive fluorescent dye and flow cytometry. In addition, we introduce sensitive techniques for the analysis of the induction of mRNA expression and secretion of SASP factors. These protocols can be applied to various cellular senescence models.

Intracellular ROS has been shown to play an important role in the induction of cellular senescence. Here, we describe a sensitive assay for quantifying ROS levels during cellular senescence. We also provide protocols for assessing the senescence-associated secretory phenotype, which reportedly contributes to various age-related dysfunctions.

Cellular senescence has been considered a state of irreversible growth arrest upon exhaustion of proliferative capacity or exposure to various stresses. ...

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &#34;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&#34; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Here, we present a method for generating tissue-specific binary transcription systems in Drosophila by replacing the first coding exon of genes with transcription drivers. The CRISPR/Cas9-based method places a transactivator sequence under the endogenous regulation of a replaced gene, and consequently facilitates transctivator expression exclusively in gene-specific spatiotemporal patterns.

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of ...

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a variety of human retinal degenerative diseases and pinpoint new treatment approaches. The nuclear architecture of mouse retina is organized in two different patterns: conventional and inverted. Conventional pattern is universal where heterochromatin is localized to the periphery of the nucleus, while active euchromatin resides in the nuclear interior. In contrast, inverted nuclear pattern is unique to the adult rod photoreceptor cell nuclei where heterochromatin localizes to the nuclear center, and euchromatin resides in the nuclear periphery. DNA methylation is predominantly observed in chromocenters. DNA methylation is a dynamic covalent modification on the cytosine residues (5-methylcytosine, 5mC) of CpG dinucleotides that are enriched in the promoter regions of many genes. Three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) participate in methylation of DNA during development. Detecting 5mC with immunohistochemical techniques is very challenging, contributing to variability in results, as all DNA bases including 5mC modified bases are hidden within the double-stranded DNA helix. However, detailed delineation of 5mC distribution during development is very informative. Here, we describe a reproducible technique for robust immunohistochemical detection of 5mC and another epigenetic DNA marker 5-hydroxymethylcytosine (5hmC), which colocalizes with the &#34;open&#34;, transcriptionally active chromatin in developing and postmitotic mouse retina.

The objective of this report is to describe the protocol for robust immunohistochemical detection of epigenetic markers, 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in developing and postmitotic mouse retina.

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a ...

Analysis of Actomyosin Dynamics at Local Cellular and Tissue Scales Using Time-lapse Movies of Cultured Drosophila Egg Chambers

Drosophila immature eggs are called egg chambers, and their structure resembles primitive organs that undergo morphological changes from a round to an ellipsoid shape during development. This developmental process is called oogenesis and is crucial to generating functional mature eggs to secure the next fly generation. For these reasons, egg chambers have served as an ideal and relevant model to understand animal organ development.
Several in vitro culturing protocols have been developed, but there are several disadvantages to these protocols. One involves the application of various covers that exert an artificial pressure on the imaged egg chambers in order to immobilize them and to increase the imaged acquisition plane of the circumferential surface of the analyzed egg chambers. Such an approach may negatively influence the behavior of the thin actomyosin machinery that generates the power to rotate egg chambers around their longer axis.
Thus, to overcome this limitation, we culture Drosophila egg chambers freely in the media in order to reliably analyze actomyosin machinery along the circumference of egg chambers. In the first part of the protocol, we provide a manual detailing how to analyze the actomyosin machinery in a limited acquisition plane at the local cellular scale (up to 15 cells). In the second part of the protocol, we provide users with a new Fiji-based plugin that allows the simple extraction of a defined thin layer of the egg chambers&#8217; circumferential surface. The following protocol then describes how to analyze actomyosin signals at the tissue scale (&#62;50 cells). Finally, we pinpoint the limitations of these approaches at both the local cellular and tissue scales and discuss its potential future development and possible applications.

Analysis of Actomyosin Dynamics at Local Cellular and Tissue Scales Using Time-lapse Movies of Cultured Drosophila Egg Chambers

This protocol provides a Fiji-based, user-friendly methodology along with straightforward instructions explaining how to reliably analyze actomyosin behavior in individual cells and curved epithelial tissues. No programming skills are required to follow the tutorial; all steps are performed in a semi-interactive manner using the graphical user interface of Fiji and associated plugins.

Drosophila immature eggs are called egg chambers, and their structure resembles primitive organs that undergo morphological changes from a round to an ...

Thawing, Culturing, and Cryopreserving Drosophila Cell Lines

There are currently over 160 distinct Drosophila cell lines distributed by the Drosophila Genomics Resource Center (DGRC). With genome engineering, the number of novel cell lines is expected to increase. The DGRC aims to familiarize researchers with using Drosophila cell lines as an experimental tool to complement and drive their research agenda. Procedures for working with a variety of Drosophila cell lines with distinct characteristics are provided, including protocols for thawing, culturing, and cryopreserving cell lines. Importantly, this publication demonstrates the best practices required to work with Drosophila cell lines to minimize the risk of contaminations from adventitious microorganisms or from other cell lines. Researchers who become familiar with these procedures will be able to delve into the many applications that use Drosophila cultured cells including biochemistry, cell biology and functional genomics.

Thawing, Culturing, and Cryopreserving Drosophila Cell Lines

Drosophila cell lines are important reagents for both fundamental and biomedical research. This article provides protocols for thawing, subculturing, and the cryopreservation of commonly used Drosophila cell lines to assist researchers in incorporating the use of these reagents in their research.

There are currently over 160 distinct Drosophila cell lines distributed by the Drosophila Genomics Resource Center (DGRC). With genome engineering, the ...