Yazarlar Gráinne Tierney Editör Yardım için teşekkür etmek istiyorum.

Protokol IRST insan araştırma Etik Komitesi kuralları izler.
Not: Bu yordam insan taze donmuş dokularda cDNA moleküllerinin düşük bir sayı tespiti için özel olarak tasarlanmıştır. Doku bölümleri hala donmuş, hasta kaynaklı önceden doğrulanmış Gastrik tümör ya da normal doku örnekleri ise kuru buza kesmiş olduk.
1. RNA izolasyon ve arıtma
<ol><li>
RNA çıkarma Not: RNA izolasyon belirli bir ürün kullanarak başlık altında gerçekleştirilir ( Tablo malzemelerigörmek). Ancak, yalıtım kitleri çeşitli ticari olarak kullanılabilir.<ol>
<li>Düzgün kesilmiş taze donmuş doku örneği 1,5 mL tüp içinde 50-100 mg 1 mL RNA izolasyon reaktif ve girdap ile şiddetle-gecede-80 ° C'de tüpler için 15 s. Incubate homojenize.</li>
		<li>Örnek 5 min ve mix için oda sıcaklığında vortexing 15 tarafından içeren tüp kuluçkaya s.</li>
		<li>Tüp buz üstünde tutmak, kloroform ve şiddetle 15 için girdap 200 µL ekleyin s.</li>
		<li>60 s için oda sıcaklığında tüpler ve 4 ° C'de 15 dakika 12.000 x g, santrifüj kuluçkaya</li>
		<li>1.5 mL tüp içinde sulu faz transfer ve glikojen 20 µg ekleyin. Not: Dikkatle Interphase veya organik katman kirliliği azaltmak için aktarılmasını önlemek önemlidir.</li>
		<li>İsopropanol, mix ve 10 min için buz üzerinde kuluçkaya tüpü ters çevirme 500 µL ekleyin.</li>
		<li>Tüp 4 ° C'de RNA çökelti 15dk için 12.000 x g, santrifüj kapasitesi. Not: RNA jel benzeri Pelet yan ve tüp, sık sık aralıklarla sonra görünmez altındaki mevcut olacaktır.</li>
		<li>Süpernatant çökelti bozmadan kaldırmak ve pipetting tarafından % 75 etanol 1 mL ile yıkayın.</li>
		<li>Tüp 7,500 x g 4 ° C'de 5 min için de santrifüj kapasitesi ve süpernatant Pelet bozmadan kaldırın.</li>
		<li>Çökelti saydam hale gelene kadar kuru ve su RNase free 50 µL içinde erimesi Pelet izin.</li>
		<li>Örnekleri miktar önce en az bir gecede-80 ° C'de dondurmak.</li>
	</ol>
</li>
	<li>
Genomik DNA eleme ve RNA arıtma Not: bir sütun tabanlı RNA saflaştırma tarafından takip bir Dnaz sindirim adım bulaşıcı DNA sindirmek için düşük-bereket hedefleri analizleri için önerilir.<ol>
<li>I (1500 Kunitz adet) 550 µL RNase free, kullanarak, karışımı yavaşça şişeyi, ters çevirme tarafından su ve Sulandırılan hisse senedi çözüm aliquots bölmek lyophilized Dnaz geçiyoruz.</li>
		<li>Bir 1,5 mL tüp içinde örnek hesaplanan hacmi RNA'ın 15 µg ile transfer için 10 µL Dnaz sindirim tampon seti (listelenen Tablo malzemeler), 2,5 µL Dnaz, ben hisse senedi çözüm ve RNase free su 100 µL. için Incubate, oda sıcaklığında 10 dakika için.</li>
		<li>Doku lizis arabelleği 350 µL ekleyin ( Malzemeleri masaseti, görmek) ve mix pipetting tarafından.</li>
		<li>Pipetting tarafından 250 µL % 100 etanol ve karışımı ekleyin.</li>
		<li>Tüm birimi (700 µL) yeni spin sütun ve 15 için 12.000 x g, santrifüj içine transfer s.</li>
		<li>Filtrenin yeni bir koleksiyon tüp içine aktarmak, sütun ve 2 min için 12.000 x g, santrifüj 500 µL % 80 etanol ekleyin.</li>
		<li>Spin sütun ve 5 min için 12.000 x g, santrifüj kapak filtre kuruması için yeni bir koleksiyon tüp ile açın; ardından filtreyi bir 1,5 mL tüp aktarın.</li>
		<li>14 µL RNase free su doğrudan filtre sütun ve 1 dk. için 12.000 x g, santrifüj ekleyin.</li>
		<li>Buz üzerinde örnekleri tutmak ve örnek 2 µL bir tezgah üstü Spektrofotometre kullanarak miktar geçin veya RNA-80 ° C'de kullanmak kadar saklamak.</li>
	</ol>
</li>
</ol>2. cDNA sentezi
<ol><li>RNA, ana Mix 4 µL, ters transkriptaz ve RNase free su steril bir PCR tüp 20 µL son hacmiyle 1 µL yer 1000 ng. Karışımı yavaşça ve spin aşağı.</li>
	<li>Aşağıdaki koşullar uygulayarak bir termal cycler tepki karışımda kuluçkaya: 25 ° C, 42 ° C, 85 ° C'de 5 dk, 30 dk, 5 dk</li>
	<li>Kısaca tüpler santrifüj kapasitesi ve dPCR analiz için devam etmek ya da -20 ° gerekinceye kadar C'de depolayın.</li>
</ol>3. dijital PCR reaksiyon kurmak
<ol><li>
dPCR reaksiyon mix ve hazırlık örnek
	<ol>
<li>Ana mix ve tahlil için en az 20 dakika oda sıcaklığında erimek.</li>
		<li>CDNA örnekleri için 300 bir konsantrasyon seyreltik su 6 µL ng.</li>
		<li>Yavaşça girdap master mix ve steril tüp 8.7 µL ana karışımı, CDH1a özel tasarlanmış tahlil astar 0,87 µL ve 1.83 µL nükleaz ücretsiz su karışımında 11,4 µL son bir hacim için hazırlamak. Not: CDH1a özel tasarlanmış tahlil astar Ayrıntılar için Malzemeler tablobakın.</li>
		<li>Hazırlanan karışımı 11,4 µL seyreltilmiş cDNA örneğe transfer karışımı yavaşça ve kısaca santrifüj kapasitesi. Not: Pipetting birim kaybı telafi etmek için % 20 fazla birimler içerir. Mix tüm örneklerini ve bir şablon kontrol (NTC) için hazırlayın.</li>
	</ol>
</li>
	<li>
Çip hazırlık Not: en iyi sonuçlar için en kısa zamanda fişleri yükleyin.<ol>
<li>Çip yükleyici takın ve gösterge ışığı yeşile kadar bekleyin.</li>
		<li>Daldırma sıvı şırınganın kapağını yavaşça pistonu geri çekerek çıkarın 1-2 mm ve serbest bırakmak o bu adımı kolaylaştırmak ve bir ucu ile değiştirmek için.</li>
		<li>Yeni bir çip ve örnek ile ilişkilendirmek için kapak üzerinde yazılı kodunu not al.</li>
		<li>Kapağı dikkatlice onun yanında tutun, koruyucu film peel away ve kapak ile yapışkan yüzü yukarı doğru yönde yerleştirin.</li>
		<li>Dikkatli bir şekilde iç kısmına dokunmamaya dikkat çekici bir yonga, almak ve kelepçe açmak için kolu aşağı basarak doğru pozisyonda çip yuvada üzerine yükleyin.</li>
		<li>Yeni bir yükleme bıçak üzerine yükleyici yüklemek ve yavaşça sıkıca yerinde olduğundan emin olmak için itin.</li>
		<li>14,5 µL üzerine yükleme bıçak dPCR reaksiyon karışımı hava kabarcıkları yapmadan aktarmak veya bıçak, hangi basın sonra çipi birimde dağıtmak için düğmesini yükleme siyah saptırma.</li>
		<li>Daldırma sıvı şırınga ucu ile yüzey dokunmak dikkat çekici küçük parça yüzeyine yaklaşık 20 damla aktarmak için kullanın. Not: Tüm yüzey üzerinde kenarları sıvı dökmeden karşılamak önemlidir.</li>
		<li>Çip temas gel de için 15 aşağı tuşuna basın kapak yapmak için yükleyici kol döndürmek s.</li>
		<li>Çip serbest bırakmak ve kol konumuna döndürmek için kapak düğmesine basın.</li>
		<li>Birleştirilmiş çip bir 45 ° açıyla tut ve dikkatle daldırma sıvı dolgu bağlantı noktası üzerinden şırınga dağıtmak, biraz hava hava kabarcığı yok olduğundan emin olmak için çip döndürün ve herhangi bir aşırı sıvı bir steril bezle çıkarın.</li>
		<li>Yavaşça uzakta etiket üstünde tepe-in belgili tanımlık küçük parça kapağı ve sıkıştırma için en az 5 dolgu bağlantı noktası üzerinden peeling tarafından çip durumda mühür s.</li>
		<li>Çip termal cycler yüklemek için hazır kadar karanlıkta saklamak. Not: Hazırlanan cips içinde 2 h kullanılmalıdır.</li>
	</ol>
</li>
	<li>
dPCR tepki
	<ol>
<li>Kapağı açın ve tek bir blok kullanıldığında bile bağdaştırıcıların her iki blok için yükleyin.</li>
		<li>Fişleri örnek blok doğru pozisyonda yerleştirin. Not: Dolgu bağlantı noktası termal cycler yükseltilmiş bir konumda float üst herhangi bir hava kabarcıkları çip pencere bozmadan izin vermek için önüne doğru odaklı olmalıdır. Boş cips iki blok dengelemek için kullanın.</li>
		<li>Termal pad tamamen fişleri kapsayacak şekilde örnek blok yatıyordu.</li>
		<li>Kapağı kapatın ve aşağıdaki koşullar uygulama çalıştırmak, PCR başlatın: 10 dk; 96 ° C'de tutun 60 ° C için 2 dk ve 98 ° C 45 devir için 30 s; 2 min için 60 ° C'de tutun; 4 ° C'de tutun Termal cycler açmak ve fiş en az 10 dakika oda sıcaklığında erimek. Not: Chip analiz bir saat içinde gerçekleştirilmesi gerekir.</li>
	</ol>
</li>
	<li>
Çipi analiz
	<ol>
<li>Araç kapağını açın ve termal yastıkları kaldırın, sonra fişleri bağdaştırıcıları kaldırın. Not: çipleri analiz kadar karanlık, temiz bir yerde saklayın.</li>
		<li>Çip yüzeyi isopropanol ve steril mendil ile temizleyin. Not: her küçük parça için sızıntıları veya olası sorunları inceleyin.</li>
		<li>USB verileri kaydetmek için Dedektör sistemi yerleştirin.</li>
		<li>Detektör sisteminin çip tepsisini açmak, çipi yukarı doğru pozisyonda yük ve tepsiyi kapatın.</li>
		<li>30 bekle s işleme, sonra yonga kaldırmak ve bir sonraki ekleyin.</li>
		<li>İşlenmiş yongaları için tamamlanması daha sonra bir bilgisayara dosya aktarmak için USB takın analizi için bekleyin. Not: Toplam analiz yaklaşık 2 3 dk/çip için zamanı.</li>
	</ol>
</li>
</ol>4. veri analizi ve yorumu
<ol><li>Aşağı akım analizleri yürütmek için gereken bulut tabanlı yazılım platformu bağlayın.</li>
	<li>Bir proje oluşturmak ve tüm veri dosyaları faiz fiş alın.</li>
	<li>Örnek adını girin; boya ve tahlil "Define Chips" sekmesinde kullanılan seçin.</li>
	<li>Çipi nasıl iyice örnek çip dolu olduğunu ve ne kadar çok sayıda veri noktası değerlendirilebilen denetleme "Gözden geçirme veri" sekmesinde görüntülenmesi tarafından kabul edilebilir olup olmadığını. Not: daha az 13.000 değerlendirilebilen veri noktaları ile fiş reddetmek.</li>
	<li>Ekranın sağ tarafındaki seçili çipin dağılım çizim için taşımak; 6000 floresein amidite (FAM) muhabir boya sinyalleri (y ekseni) için bir eşik için tüm fişleri geçerli. Not: kullanılan deneyleri temel alınarak ayarlanan eşik değişebilir.</li>
	<li>Kement aracını kullanarak ve "belli değil" tuşuna basarak dağılım göreli oracıkta seçerek yanlış pozitif sonuçlar önlemek için herhangi bir şüpheli olumlu sinyaller arsa kaldır. Tüm kalan olumlu noktalar analiz nadir hedef kopyalarını cDNA varlığını gösterir.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

Yazarlar bu iş için hiçbir çıkar çatışmaları rapor.

dPCR Aslında DNA moleküler ölçümleri10,11,12,13 ve miktar mikroRNA ve RNA transkript5için bu teknoloji uyarlanmıştır zamanında geliştirildi, 14,15. Bu protokol için taze donmuş Doku örneklerinden elde edilen nadir transkript tespiti dahil etmek için uygulamaların listesini genişletmi?...

CDH1 gen E-cadherin, önemli bir faktör normal Gastrik epitel hücre adezyon, hayatta kalma, yayılmasını önleme ve geçiş1düzenlenmesi aracılığıyla bakım dahil için kodlar. Zararlı germline sonucunda E-cadherin protein kaybı veya somatik değişikliklere CDH1 GC2,3gelişimi ile ilişkili olduğu düşünülmektedir. Sigara-kurallı transkript intron 2 gen / doğan da mide karsinojenezis4,5' te bir rol olan. Özellikle, bir tür transkript, CDH1a, GC hücre hatlarında ifade edilecek göstermiştir ama yok normal mide4. Son zamanlarda CDH1a GC doku örneklerinde dPCR çip tabanlı5kullanarak GC hastalardan tespit ettik. dPCR değerlendirmek, ilk kez, CDH1a gen transkript bağırsak GC ve normal doku varlığı için kullanıldı.
Gen ifadesinin belirlemek için altın standart yöntem gerçek zamanlı kantitatif PCR (qPCR) dir. Ancak, sonuçta elde edilen veriler bazen değişken olabilir ve kalitesiz, özellikle ne zaman hedef örnek düzeyi düşüktür. Bu değişkenlik polimeraz etkinlik ve astar tavlama, non-spesifik amplifikasyon ve rekabetçi yan reaksiyonlar6yol inhibe kirletici neden olabilir.
DPCR Temel biyokimyasal prensipleri qPCR benzer olmakla birlikte, dPCR genomik DNA (gDNA) çok hassas ölçümler için izin bazı avantajları gösterir / Tamamlayıcı DNA (cDNA) molekülleri. Gerçekten de, dPCR böylece her de sıfır veya bir tek hedef molekül içerir, kalibre edilmiş bir örnek wells, binlerce içine bölümleme üzerinde dayanan bir son nokta reaksiyondur. Amplifikasyon sonra yalnızca bir kopyasını hedef içeren kuyu içinde oluşur ve floresan bir sinyal ile belirtilir. Orijinal örnek hedef molekülleri kesin sayısı sonra binom Poisson istatistikleri7kullanarak toplam bölümler için olumlu oranını belirleyerek hesaplanabilir.
Buna ek olarak, dPCR teknik standart bir eğri çalıştırmak için gereksinimini ortadan kaldırır ve bu nedenle, ilişkili önyargı ve değişkenliği, hedefleri8,9; doğrudan bir miktar için izin kirletici ve verimliliği inhibitörleri10onun yüksek tolerans nedeniyle bağımsız olarak daha hassas ve tekrarlanabilir sonuçlar üretir; daha hassas ve qPCR daha belirli ve böylece nadir bir hedef tespiti için güvenilir bir yöntemdir. Son olarak, arka plan molekülleri ile rekabet azaltır örnek birden çok tepkiler bölümleme ve hedef tespit, amplifikasyon mümkün verme ve gDNA/cDNA6 tek molekülleri algılama kolaylaştırmak sınırı artırır . Algılama ve miktar Nükleik asitlerin çip tabanlı dPCR tarafından giderek uygulanmış sayı varyasyon kopyalamak için miktar DNA parçaları ve mutasyon analizleri verilen11,12,13, hassas ve düşük malzeme gereksinimi yönteminin girdi. Buna ek olarak, dPCR son zamanlarda her iki mikroRNA'lar14 ve gen transkript5,15analiz entegre edilmiştir.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, CDH1 gene, kanonik olmayan bir transkript bulundu bazı mide kanseri (GC) hücre hatlarında ifade edilecek yok ise normal mide mukozasında. Son zamanlarda, GC ile hastalardan elde edilen taze donmuş tümör dokularda CDH1a transkript varyantı tespit ettik. Bu varyant doku örneklerinde ifade burada sunulan çip tabanlı dijital PCR (dPCR) yaklaşım tarafından araştırılmıştır. dPCR Nükleik asitlerin doğru güçlü ve son derece hassas bir ölçüm için potansiyel sunmaktadır ve giderek farklı alanlardan birçok uygulama için kullanılmaktadır. dPCR nadir hedefleri tespit yeteneğine sahiptir; Buna ek olarak, dPCR Nükleik asitlerin KALİBRATÖRLER ve standart Eğriler için gerek kalmadan mutlak ve kesin miktar için imkanı sunuyor. Aslında, reaksiyon bölümleme amplifikasyon ve toleransı inhibitörleri ile artırır arka plan hedef zenginleştiriyor. Bu tür özellikleri dPCR CDH1a nadir transkript tespiti için optimum bir takım olun.

Burada sunulan yordamı kullanarak, Gastrik taze donmuş dokularda nadir transkript değişken CDH1a bir ifade için kontrol ettik. DPCR göre analiz 21 eşleştirilmiş normal ve kanser doku örnekleri ve 11 ek tümör örnekleri gerçekleştirildi. CDH1a 32 üzerinden 15 (% 47) tümör tespit iken bu nadir transkript5varlığı yok normal doku örneği gösterdi. Homojen olmayan yükleme çiplerle olduğu gibi bizim analizi, daha az 13.000 veri ...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Bir CDH1 nadir transkript değişken mide kanseri taze donmuş dokularda çip tabanlı dijital PCR tarafından algılanması

El yazması bir nadir CDH1 transkript değişken (CDH1a) taze donmuş normal ve mide kanseri olan hastalarda elde edilen tümör doku algılamak için bir çip tabanlı dijital PCR tahlil açıklar.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K Görüntüleme.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. El yazması bir nadir CDH1 transkript değişken (CDH1a) taze donmuş normal ve mide kanseri olan hastalarda elde edilen tümör doku algılamak için bir çip tabanlı dijital PCR tahlil açıklar.

Video: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

Osteoclastogenesis periferik kan monosit kültürlü meme kanseri hücre hatları ile birlikte gelen bir insan preklinik modelinin geliştirilmesi

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Kanser Araştırmaları

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

Sonraki nesil sıralama kullanarak CtDNA nadir mutasyonların tespiti

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

Serum ve plazma kopya sayı algılama gerçek zamanlı PCR kullanarak

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

Parafin üzerinde elastik boyama-pT3N0M0 gastrik kanser dokusu gömülü slaytlar

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image analysis. Digital scanning is a fast way to scan a stack of slides and produce digital images with high quality. It can produce concordant results with conventional light microscopy (CLM) by pathologists. Furthermore, the availability of digital images makes it possible that the same slide can be concurrently observed by multiple people. Moreover, digital images of slides can be stored in a database, which means the long-term deterioration of glass slides is avoided. The limitations of this technique are as follows. First, it needs high-quality prepared tissue and the original immunohistochemistry (IHC) slides without any damage or excess sealant residue. Second, tumor or nontumor areas should be specified by experienced pathologists before the analysis using software, in order to avoid any confusion about the tumor or nontumor areas during scoring. Third, the operator needs to control the color reproduction throughout the digitization process in whole-slide imaging.

ZW10 interacting protein (ZWINT) participates in the mitotic spindle checkpoint and the pathogenesis of carcinoma. Here, we introduce a methodology of the immunostaining of ZWINT in human lung cancer tissues, followed by the digital scanning of whole slides and image analysis. This methodology can provide high-quality digital images and reliable results.

Insan akciğer dokularında ZW10 etkileşim protein Immünoster dijital Analizi

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using electrophoresis through a resolving gel embedded with a degradable substrate. This method differs from traditional gel zymography in that a quenched fluorogenic peptide is covalently incorporated into the resolving gel instead of full length proteins, such as gelatin or casein. Use of the fluorogenic peptides enables direct detection of proteolytic activity without additional staining steps. Enzymes within the biological samples cleave the quenched fluorogenic peptide, resulting in an increase in fluorescence. The fluorescent signal in the gels is then imaged with a standard fluorescent gel scanner and quantified using densitometry. The use of peptides as the degradable substrate greatly expands the possible proteases detectable with zymographic techniques.

Here, we present a detailed protocol for a modified zymographic technique in which fluorescent peptides are used as the degradable substrate in place of native proteins. Electrophoresis of biological samples in fluorescent peptide zymograms enables detection of a wider range of proteases than previous zymographic techniques.

Floresan peptid Zymography tarafından proteaz aktivitesinin algılama

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

Mide kanseri hasta-türetilen xenograft modelleri ve primer hücre hatları kurulması

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Uzun mesafe ters PCR tarafından sıcak hat-1s Retrotransposition aktivitesinin tespiti

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic alterations in oncogenes such as the KRAS oncogene, which constitutes ~25% of lung cancer cases. The difficulty in therapeutically targeting KRAS-driven lung cancer partly stems from having poor models that can mimic the progression of the disease in the lab. We describe a method that permits the relative quantification of primary KRAS lung tumors in a Cre-inducible LSL-KRAS G12D mouse model via ultrasound imaging. This method relies on brightness (B)-mode acquisition of the lung parenchyma. Tumors that are initially formed in this model are visualized as B-lines and can be quantified by counting the number of B-lines present in the acquired images. These would represent the relative tumor number formed on the surface of the mouse lung. As the formed tumors develop with time, they are perceived as deep clefts within the lung parenchyma. Since the circumference of the formed tumor is well-defined, calculating the relative tumor volume is achieved by measuring the length and width of the tumor and applying them in the formula used for tumor caliper measurements. Ultrasound imaging is a non-invasive, fast and user-friendly technique that is often used for tumor quantifications in mice. Although artifacts may appear when obtaining ultrasound images, it has been shown that this imaging technique is more advantageous for tumor quantifications in mice compared to other imaging techniques such as computed tomography (CT) imaging and bioluminescence imaging (BLI). Researchers can investigate novel therapeutic targets using this technique by comparing lung tumor initiation and progression between different groups of mice.

This protocol describes the steps taken to induce KRAS lung tumors in mice as well as the quantification of formed tumors by ultrasound imaging. Small tumors are visualized in early timepoints as B-lines. At later timepoints, relative tumor volume measurements are achieved by the measurement tool in the ultrasound software.

Ultrason Görüntüleme ile Farelerde Akciğer Tümörü İlerlemesinin Saptanması

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Tümör Hücrelerinin Lateral Kuyruk-Damar Enjeksiyonu Sonrasında Akciğer Metastazının Patolojik Analizi

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...