저자 편집 지원 Gráinne Tierney를 감사 하 고 싶습니다.

프로토콜은 IRST 인간의 연구 윤리 위원회의 지침을 따릅니다.
참고:이 절차는 신선한 냉동 인간의 조직에 cDNA 분자의 낮은 수의 탐지를 위해 특별히 설계 되었습니다. 조직 섹션 동안 여전히 동결, 이전 검증된 환자 파생 위 종양 또는 정상적인 조직 샘플에서 드라이 아이스에 잘라 왔다.
1. RNA 분리 및 정화
<ol><li>
RNA 추출 참고: 특정 제품을 사용 하 여 후드 RNA 격리 수행 ( 재료의 표참조). 그러나, 격리 키트의 다양 한 상업적으로 사용할 수 있습니다.<ol>
<li>균질 RNA 격리 시 약 및 소용돌이의 1 mL와 함께 1.5 mL 튜브에 잘게 잘린된 신선한 냉동 조직 샘플의 50-100 mg 적극적으로 15 미 품에 대 한 튜브-80 ° C에서 하룻밤.</li>
		<li>15 vortexing에 의해 5 분 및 혼합에 대 한 실 온에서 샘플을 포함 하는 튜브를 품 어 s.</li>
		<li>얼음에 튜브를 유지, 클로 프롬, 및 15에 대 한 적극적으로 소용돌이의 200 µ L 추가 s.</li>
		<li>60 s에 대 한 실 온에서 튜브와 4 ° c.에 15 분 동안 12000 x g에서 원심 분리기를 품 어</li>
		<li>1.5 mL 튜브에 수성 단계를 전송 하 고 glycogen의 20 µ g을 추가 합니다. 참고: 그것은 신중 하 게 오염을 줄이기 위해 interphase 또는 유기 층을 전송 하지 않도록 하는 것이 중요입니다.</li>
		<li>소 프로 파 놀, 혼합, 및 10 분 동안 얼음에 품 어 튜브 반전의 500 µ L를 추가 합니다.</li>
		<li>12000 x g RNA 침전 하 4 ° C에서 15 분 동안에 튜브 원심 참고: RNA 사이드와 원심 분리 후 자주 보이지 않는 튜브의 하단에 젤 같은 펠 릿에 표시 됩니다.</li>
		<li>침전을 방해 하지 않고는 상쾌한을 제거 하 고 pipetting으로 75% 에탄올의 1 mL와 함께 그것을 씻어.</li>
		<li>4 ° C에서 5 분 동안 7500 x g에서 튜브 원심 고는 펠 렛을 방해 하지 않고는 상쾌한을 제거 합니다.</li>
		<li>펠 릿 침전 투명 하 게 될 때까지 건조 하 고 50 µ L RNase 무료 물에 용 해 보자.</li>
		<li>부 량 전에 적어도 하룻밤-80 ° C에서 샘플을 동결.</li>
	</ol>
</li>
	<li>
게놈 DNA 제거 및 RNA 정화 참고: 열 기반 RNA 정화 뒤 DNase 소화 단계는 오염 DNA를 소화 하기 위해 낮은 풍부 목표의 분석에 대 한 권장.<ol>
<li>동결 건조 된 DNase (1500 Kunitz 단위) RNase 무료의 550 µ L에 주사기, 유리병, 반전으로 부드럽게 혼합을 사용 하 여 물 어 aliquots로 재구성된 재고 솔루션 분할 해산.</li>
		<li>15 µ g의 RNA 샘플의 계산된 볼륨 1.5 mL 튜브에 전송, DNase 소화의 10 µ L 버퍼 키트 ( 재료의 테이블에나열 된), DNase의 2.5 µ L에서에서 나 재고 솔루션 및 100 µ L. 물 RNase 무료 10 분 동안 실 온에서 품 어.</li>
		<li>조직 세포의 용 해 버퍼의 350 µ L 추가 (장비, 재료의 표참조) pipetting으로 혼합.</li>
		<li>Pipetting으로 100% 에탄올과 혼합의 250 µ L를 추가 합니다.</li>
		<li>새로운 스핀 열 및 15 12000 x g에서 원심 분리기로 전체 볼륨 (700 µ L) 전송 s.</li>
		<li>새로운 컬렉션 튜브로 필터를 전송, 열 및 2 분 12000 x g에서 원심 분리기를 80% 에탄올 500 µ L를 추가 합니다.</li>
		<li>새로운 컬렉션 튜브 필터; 건조 스핀 열 및 5 분 동안 12000 x g에서 원심 분리기의 뚜껑을 열으십시오 다음 1.5 mL 튜브에 필터를 전송.</li>
		<li>필터 십 분 12000 x g에서 원심 분리기에 직접 RNase 무료 물 14 µ L를 추가 합니다.</li>
		<li>얼음에 샘플을 계속 벤치 정상 분 광 광도 계에는 샘플의 2 µ L를 사용 하 여 정량화를 진행 하거나 사용까지-80 ° C에서 RNA를 저장할.</li>
	</ol>
</li>
</ol>2입니다. cDNA 합성
<ol><li>RNA, 믹스 마스터의 4 µ L, 역전사, 및 살 균 PCR 튜브에서 20 µ L의 최종 볼륨을 RNase 무료 물 1 µ L의 장소 1000 ng. 부드럽게 혼합 하 고 아래로 회전.</li>
	<li>다음과 같은 조건 적용 열 cycler에 반응 혼합 품 어: 25 ° C, 42 ° C, 85 ° c.에 5 분에서 30 분에서 5 분</li>
	<li>튜브를 짧게 원심 dPCR 분석을 진행 하거나 필요할 때까지-20 ° C에서 저장.</li>
</ol>3. 디지털 PCR 반응 설정
<ol><li>
dPCR 반응 혼합 및 준비 샘플
	<ol>
<li>적어도 20 분 동안 실 온에서 시험 하 고 마스터 믹스 해 동.</li>
		<li>300의 농도에 cDNA 샘플 희석 물 6 µ L에서 ng.</li>
		<li>부드럽게 소용돌이 마스터 믹스와 믹스 마스터 믹스의 8.7 µ L, CDH1a 사용자 정의 설계 분석 결과 뇌관의 0.87 µ L과 nuclease 무료 물 1.83 µ L 무 균 튜브에 11.4 µ L의 최종 볼륨에 대 한 준비. 주: CDH1a 사용자 정의 설계 분석 결과 뇌관 세부 정보에 대 한 테이블의 자료를 참조 하십시오.</li>
		<li>준비 된 믹스의 11.4 µ L 희석된 cDNA 샘플을 전송, 부드럽게, 혼합 하 고 짧게 원심. 참고: 볼륨 20% 초과를 pipetting 볼륨 손실에 대 한 보상을 포함 됩니다. 모든 샘플 및 아무 템플릿 컨트롤 (NTC)에 대 한 믹스를 준비 합니다.</li>
	</ol>
</li>
	<li>
칩 준비 참고: 최적의 결과 대 한 로드 칩 최대한 빨리.<ol>
<li>칩 로더에 연결 하 고는 표시등이 녹색 밝혀 졌 때까지 기다립니다.</li>
		<li>살짝 다시 플런저를 당겨 침수 액체 주사기의 뚜껑을 제거 1-2 mm이 고이 단계를 촉진 하 고 팁을 공개.</li>
		<li>새로운 칩을 받아 고 샘플 연관 뚜껑에 작성 된 코드의 숙지 합니다.</li>
		<li>뚜껑 신중 하 게 그것의 측면에 의해, 보호 필름 벗 겨 누른 올바른 방향에서 위로 끈 적 얼굴 뚜껑을 배치.</li>
		<li>신중 하 게 칩을 내부 부분을 건드리지 않도록 돌을 선택 하 고 열 클램프 레버를 눌러 올바른 위치에 있는 칩 둥지에 그것을 로드.</li>
		<li>로더에 새로운 로드 블레이드를 로드 하 고 부드럽게 되도록 그것 확고 하 게 자리에 밀어.</li>
		<li>기포 없이 로드 블레이드에 dPCR 반응 혼합의 14.5 µ L을 전송 배포는 칩에 볼륨 버튼을 로드 블랙은 보도 후 블레이드, 왜곡 또는.</li>
		<li>침수 액체 주사기를 사용 하 여 전송 팁과 표면 접촉 하지 않도록 주의 복용 칩 표면에 약 20 방울. 참고: 그것은 가장자리에 액체를 흘리 고 하지 않고 전체 표면을 커버 하는 것이 중요입니다.</li>
		<li>칩을 접촉 하 고 15 눌러 뚜껑을 로더 팔 회전 s.</li>
		<li>칩을 놓고 팔의 위치에 반환을 뚜껑 단추를 누릅니다.</li>
		<li>조립된 칩 45 ° 각도로 하 고 신중 하 게 채우기 포트를 통해 주사기로 침수 액체 분배, 칩 없는 기포 확인을 약간 회전 누른 살 균 삭제 기능으로 어떤 과잉 액체를 제거.</li>
		<li>부드럽게 필 링 멀리 칩 뚜껑과 보도 위에 레이블 적어도 5에 대 한 채우기 포트를 통해 하 여 칩 케이스를 밀봉 s.</li>
		<li>열 cycler에서 로드할 준비가 될 때까지 어둠 속에 칩을 저장 합니다. 참고: 준비 된 칩 2 시간 이내 사용 해야 합니다.</li>
	</ol>
</li>
	<li>
dPCR 반응
	<ol>
<li>뚜껑 열고 단일 블록을 사용 하는 경우에 두 블록에 어댑터를 설치 합니다.</li>
		<li>올바른 위치에 샘플 블록에 칩을 놓습니다. 참고: 채우기 포트 칩의 윈도우를 방해 하지 않고 상단에 떠 있는 공기 방울을 허용 하는 높은 위치에서 열 cycler의 앞 쪽으로 지향 되어야 합니다. 빈 칩을 사용 하 여 두 개의 블록을 균형.</li>
		<li>칩을 완전히 커버 샘플 블록에 열 패드를 하다.</li>
		<li>뚜껑을 닫고 PCR 실행, 다음과 같은 조건 적용 시작: 10 분; 96 ° C에서 개최 30 60 ° C 2 분 및 98 ° C의 45 주기 s; 2 분;에 대 한 60 ° C에서 개최 4 ° c.에서 개최 열 cycler 끄고 칩 적어도 10 분 동안 실 온에서 해 동. 참고: 칩 분석 1 시간 내에서 수행 되어야 합니다.</li>
	</ol>
</li>
	<li>
칩 분석
	<ol>
<li>악기의 뚜껑을 열고 열 패드를 제거 다음 어댑터에서 칩을 제거 합니다. 참고: 분석까지, 깨끗 한 위치에 칩을 저장 합니다.</li>
		<li>소 프로 파 놀과 살 균 지우기 칩 표면 청소. 참고: 누수 또는 잠재적인 문제에 대 한 각 칩을 검사 합니다.</li>
		<li>데이터를 저장 하는 검출기 시스템에 USB를 삽입 합니다.</li>
		<li>검출기 시스템의 칩 트레이 열고, 올바른 위치에 있는 칩 보여지는 로드 한 다음 트레이 닫습니다.</li>
		<li>30 대기 처리용, s 다음 칩을 제거 하 고 다음 중 하나를 삽입.</li>
		<li>모든 처리 칩에 대 한 완료 후 파일을 전송 하는 컴퓨터에 USB를 삽입 분석을 기다립니다. 참고: 분석에 대 한 총 시간은 약 3 분/칩 2 이다.</li>
	</ol>
</li>
</ol>4. 데이터 분석 및 해석
<ol><li>모든 다운스트림 분석을 수행 하는 데 필요한 클라우드 기반 소프트웨어 플랫폼에 연결 합니다.</li>
	<li>프로젝트를 만들고 관심의 칩의 모든 데이터 파일을 가져올.</li>
	<li>샘플 이름;을 입력합니다 염료 및 분석 결과 "정의 칩" 탭에서 사용을 선택 합니다.</li>
	<li>얼마나 철저 하 게 샘플 칩에 로드 된 및 얼마나 많은 데이터 요소는 evaluable 검사 "검토 데이터" 탭에 그것을 시각화 하 여 칩 허용 인지 확인 합니다. 참고: 보다 13000 evaluable 데이터 요소에 대 한 칩을 거부 합니다.</li>
	<li>화면;의 오른쪽에 선택한 칩의 점도로 이동 모든 칩에 6000 fluorescein amidite (FAM) 기자 염료 신호 (y 축)에 대 한 임계값을 적용 합니다. 참고: 설정 임계값 사용 분석에 근거 하 여 달라질 수 있습니다.</li>
	<li>제거는 분산형에 상대적인 자리를 선택 하 여 거짓 긍정적인 결과 방지 하기 위해 어떤 모호한 긍정적인 신호 플롯 올가미 도구를 사용 하 고 "미정"에서. 모든 나머지 긍정적인 명소 드문 대상 분석의 cDNA 복사본의 존재를 나타냅니다.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

저자는이 작품에 대 한 관심의 없습니다 충돌을 보고합니다.

dPCR는 원래 위해 개발 DNA 분자 측정10,11,,1213 시간 microRNAs 및 RNA 사본5의 정량화에이 기술을 적응 했다 , 1415. 이 프로토콜에서 우리는 신선한 냉동 조직 샘플에서 파생 된 희귀 증명서의 탐지를 포함 하는 응용 프로그램의 목록을 확대 했습니다. 그 목적에 활용 하는 cDNA의 다소 높은 금액 (300 ng). 이 금액은 아니지만 dPCR에서 사용할 수 있는 최대, 그것은 우리의 모든 샘플 비교 표준화 조건 설정에 대 한 충분 한 했다. 6000에서 개화 신호 임계값을 설정 하 고 칩 및 분산형 플롯에 긍정적인 증폭 신호의 위치를 걱정 하며, 우리는 성공적으로 위 종양 조직 샘플에서이 드문 대상 감지.
DPCR, 우리가 절대적으로 CDH1a, 대상의 매우 낮은 금액으로 인해 계량 하지 수 있습니다. 있지만 우리는이 희소 한 대 본의 존재/부재 평가 안정적으로 수 있습니다. 실제로,이 기술은의 정량적 특성 분석된 샘플7에 대상의 초기 수에 의해 제한 됩니다. 관련성, 자체 기술을 상당히 비싸고 시간이 많이 소모 될 남아 있습니다. 따라서, 수많은 샘플 또는 여러 목표의 분석에 필요한 경우 대체 기법7,8고려 한다.
즉, dPCR 의심할 여 지 없이 제공 합니다 궁극적인 플랫폼을 민감한 측정 및 핵 산의 정량화에 대 한 정밀도 정량7,8에 대해 재현성을 향상 시킵니다. 또한, 그것은 낮은 풍부한 핵 산의 유전자 발현을 분석 하는 데 사용할 수 있는 유일한 방법으로 간주 될 수 있는 근처의 정량 감도6제한.
여기 설명 된 프로토콜 우리의 연구에서 희소 한 목표의 탐지를 사용 하는 어떤 조직에서 RNAs에 적응 될 수 있다. 또한, 분석 결과 성적 절대 정량화에 연장 될 수 있습니다. 이러한 경우, 복사본 / µ L 주어진된 샘플에 대 한 악기에 의해 보고 된 수 고 해야 합니다 단순히 로드 반응 볼륨을 곱한 cDNA의 초기 금액으로 나눈 값. 반전 전사에 의해 생산 하는 다양성을 극복 하기 위해 유전자 특정 교정기 포함 되어야 합니다, 가능 하면6. 미래를 찾고, dPCR 뿐만 아니라 희귀 시퀀스 검출 하지만 또한 드문 돌연변이 탐지 및 정확한 복사본 번호 정량화7황금 표준 플랫폼에 상당한 잠재력을 보유 하고있다. 이것은 암 연구에서 유전 mosaicism에서 특히 관련 영향 종양이 환자의 임상 결과 치료에 대 한 응답을 줄 수 있는.
실용적인 포인트 보기의 강조 해야 하는 여러 중요 한 단계는 dPCR 프로토콜을 설정할 때. 우선, cDNA 예상 대상 식 수준에 따라 적절 한 금액을 포함 하는 반응 혼합 한다 전송 샘플 동질성을 방해할 수 있는 공기 거품을 만들 수 없습니다 로드 블레이드에 큰 관심과 함께. 또한, 자체 블레이드 먼저 위치 해야 적절 하 게; 그렇지 않으면 그것은 고르지 샘플 배포 될 수 있습니다. 또한, 충분 한 침수 액체 및 정확한 뚜껑의 씰링 코팅 항상 수행 되어야 합니다. 칩 처리 및 분석, 축적 칩;에 응축의 가능성을 인식 하는 것이 중요 하다 이러한 시나리오에서는 칩 다시 소 프로 파 놀으로 닦아와 있어야 다시 분석 합니다. 또한, dPCR 포아송 통계를 바탕으로 최소한 evaluable 데이터의 포인트 (> 10000)에 있어야 칩, 그렇지 않으면 샘플을 다시 실행 해야 합니다. 마지막으로, 낮은 대상 복사 검출 실험, 중요 한 혼란 요소 수 신호 대 잡음 비율, 하지만 진짜 긍정적인 신호를 식별에 도움이 신뢰할 수 있는 임계값 위치.

CDH1 유전자 세포 접착, 생존, 확산, 및 마이그레이션1의 규제를 통해 정상적인 위 상피의 유지에 관여 하는 핵심 요소 E cadherin 위한 인코딩합니다. 해로운 생식의 결과로 전자 cadherin 단백질의 손실 또는 CDH1 의 체세포 변경 GC2,3의 개발과 관련 된 되었습니다. Intron의 유전자 2에서 발생 하는 비 정식 성적 증명서 또한 위 발암4,5에 역할을 가설 되어 있다. 특히, 이러한 한 사본, CDH1a, GC 셀 라인에 표현 될 표시 되었습니다 하지만 결 석 정상 위4에서. 우리는 최근 칩 기반 dPCR5를 사용 하 여 GC 환자에서 GC 조직 샘플에서 CDH1a 를 감지. dPCR CDH1a 유전자 사본 장 GC에 정상 조직에의 존재를 처음으로 평가 하는 데 사용 되었다.
유전자 발현을 확인 하기 위해 표준 방법은 실시간 양이 많은 PCR (정량)입니다. 그러나, 결과 데이터 때로는 변수 수 이며 가난한 품질, 특히 때 샘플에는 대상의 수준 낮은. 이 변화는 일반적인 증폭 및 경쟁 측 반응6뇌관 어 닐 링, 및 중 합 효소 활동을 억제 하는 오염 물질에 의해 발생할 수 있습니다.
DPCR의 기본적인 생 화 확 적인 원리는 정량의 그들과 유사 하, dPCR genomic DNA (gDNA)의 매우 정확한 측정을 위해 수 있도록 하는 몇 가지 장점을 보여줍니다 / 보완 DNA (cDNA) 분자. 실제로, dPCR 각각 잘 0 또는 단일 대상 분자 포함 되도록 수천 웰 스, 샘플의 보정 분할에 의존 하는 끝점 반응입니다. 증폭 대상의 복사본을 포함 하는 우물에만 발생 합니다 그리고 형광 신호에 의해 표시 됩니다. 원래 샘플에서 대상 분자의 절대 수 다음 이항 포아송 통계7를 사용 하 여 전체 파티션을 긍정적인의 비율을 결정 하 여 계산할 수 있습니다.
DPCR 기술 표준 곡선을 실행 하기 위한 필요성을 제거 하는 또한, 및, 따라서, 연결 된 바이어스 및 다양성, 대상8,9;의 직접 정량화에 대 한 허용 그것은 오염 물질과 효율성 억제제10; 높은 관용 때문에 독립적으로 더 정확 하 고 재현 가능한 결과 생산 하 그것 더 과민 하 고 정량, 보다 구체적 이며 따라서 드문 대상의 검출에 대 한 신뢰할 수 있는 방법입니다. 마지막으로, 여러 반응으로 샘플의 분할 배경 분자와 경쟁 줄어들고 대상 검출, 증폭을 가능 하 게 하 고 gDNA/cDNA6의 단일 분자의 검출 한계 향상 . 검색 및 칩 기반 dPCR에 의해 핵 산의 정량화 점점에 적용 된 복사 번호 유사, DNA의 정량화는 파편, 그리고 돌연변이 분석11,,1213, 주어진는 정밀도 낮은 자료 입력 방법의 요구 사항. 또한, dPCR는 최근 두 microRNAs14 그리고 유전자 사본5,15의 분석에 통합 되었습니다.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

반면 결 석 CDH1a, CDH1 유전자의 정식이 아닌 대 본 일부 위 암 (GC) 셀 라인에 표현 될 발견 되었습니다 정상 위 점 막에서. 최근에, 우리는 GC 가진 환자에서 얻은 신선한 냉동 종양 조직에 CDH1a 사본 이체를 감지. 조직 샘플에서이 이체의 식 칩 기반 디지털 PCR (dPCR) 접근 방식에 의해 여기에 제시 된 조사 했다. dPCR 핵 산의 정확한, 강력한, 그리고 매우 중요 한 측정에 대 한 잠재력을 제공 하 고 점점 더 다양 한 분야에 많은 응용 프로그램에 대 한 활용. dPCR는 감지 드문 목표; 또한, dPCR는 교정기 및 표준 곡선에 대 한 필요 없이 핵 산의 완전 하 고 정확한 정량화에 대 한 가능성을 제공합니다. 사실, 증폭 효율과 억제제에 내성 향상 배경에서 대상을 풍요롭게 반응 분할. 이러한 특성 dPCR CDH1a 희소 한 대 본의 검출을 위한 최적의 도구를 확인합니다.

여기에 제시 된 절차를 사용 하 여, 우리는 위 신선한 냉동 조직에 드문 사본 이체 CDH1a 의 표현에 대 한 확인 합니다. DPCR에 의해 분석 및 11 추가 종양 샘플 21 쌍 정상 및 암 조직 샘플에서 수행 되었다. 아니 정상적인 조직 샘플 보여이 희소 한 대 본5의 존재 하는 반면 CDH1a 15 중 32 (47%) 종양에서 감지 했다. 우리의 분석으로 비 균질 로드 칩 미만 13000 데이터 요소에 대 한 칩 거부 했다. 그림 1 보여줍니다 칩 evaluable (그림 1A)와 비 evaluable (그림 1B, C)에 대 한 샘플 보기. 후자의 경우는 칩 또는 임계값 (그림 1B) 위의 데이터 요소 개수가 부족 결과로 여러 거품 (그림 1B), 하나의 큰 거품 (그림 1C)의 존재로 인해 폐기 해야 합니다. 이 샘플은 해석할 결과를 다시 실행 해야 합니다. 소프트웨어 (그림 2)에서 제공 하는 점도에 관해서는 그것은 일반적으로 빅 (제조 업체의 독점) 기자 염료 (x 축)에서 신호에 대 한 팸 기자 염료 (y 축)에서 신호 묘사. 점도에 제시 하는 데이터 요소는 색상으로 구분, 그리고 여기, 우리만 시각 파란색 (그림 2A), 팸 기자 염료 신호 나타내는 대상 증폭 되었다 우물. 이러한 신호는 y 축 및 작의의 근원에서 더 가까이 있습니다. 줄거리에서 볼 두 번째 색 노란색 이며 아무 증폭 발생 한 우물의 지표입니다. 긍정적인 신호에 대 한 신뢰할 수 있는 임계값 설정 하 고 전화 바이어스를 방지 하기 위해 모든 칩에 적용 했다. 여기에서, 선택 된 임계값 6000 신호가이 실험에서 다양 한 칩에 대 한 관찰의 범위에 따라 했다. CDH1a cDNA 복사본 (푸른 신호) 종양 샘플, 부정적인 신호 (그림 2A)에서 진폭에서 명확한 차이 보여주는 수에서 발견 됐다. 반대로, 선택 된 임계값 위에 아무 신호 CDH1a 사본, 즉, 모든 정상적인 조직 샘플 및 일부 종양 샘플 (그림 2B)에 대 한 부정적인 샘플에서 발견 되었다. 마찬가지로, 아니 긍정적인 신호 dPCR 반응 (그림 2C)에 대 한 부정적인 컨트롤로 제공 따라서 물 cDNA, 대신 추가 된 NTC에 감지 했다.
정밀한 칩 분석 필터 낮은 품질 데이터 요소에 적용 해야 합니다 하 고 모호한 결과의 위험을 제거 합니다. 이것은 해당 긍정적인 신호의 정확한 위치를 결정 하는 칩을 확인 하 여 이루어졌다: 신호 분석에서 기 각 파란색 신호가 매우 테두리 칩 (그림 3A) 또는 거품 (그림 1B) 주위에 경우 . 더 잘못 된 반응의 위험을 방지 하기 위해, 신호 6000 이상 팸 채널에 대 한 음모의 맨 오른쪽에 아마 특정 고려 되었다 고도 불구 하 고 그들은 (그림 3B) 칩 내 현지 했다, 따라서 필터링 된. 이 방법에서는, 샘플은 그 신호는 상기 조건을 준수으로 단일 증폭 신호를 표시 하는 경우에 드문 사본, CDH1a의 표현에 대 한 긍정적인 것으로 간주 됩니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57066/57066fig1.jpg"> 그림 1 . 대표 evaluable 및 비 evaluable 칩. 파란색 점들은 웰 스는 CDH1a 사본 증폭 되었다; 노란색 점 들은 우물 없이 증폭 발생; 하얀 점들은 빈 우물입니다. 임계값 이상 데이터 요소는 각 칩 아래 표시 됩니다. (A) 파랑 evaluable 칩 신호 칩의 테두리 내에서 잘 지역화. (B) A 임계값 미만 13000 데이터 요소와 비 evaluable 칩 했다. 큰 거품 (C) 비 evaluable 칩 했다. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57066/57066fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57066/57066fig2.jpg"> 그림 2 . 대표적인 디지털 PCR 점도의 CDH1a 식. 플롯 빅 기자 염료 (x 축)에서 신호에 대 한 팸 기자 염료 (y 축)에서 신호를 묘사. 파란색 점들은 CDH1a 긍정적인 식 신호, 노란색 점들은 "증폭" 신호 하는 동안입니다. (A) CDH1a-긍정적인 샘플. (B) CDH1a-부정적인 샘플. (C) 0 CDH1a 식을 보여주는 템플릿 제어 (NTC). <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57066/57066fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57066/57066fig3.jpg"> 그림 3 . 디지털 PCR 분산형의 대표적인 미세 칩 분석 플롯합니다. 왼쪽에는 관심의 신호 칩 보기 확대-블랙 사각, 오른쪽에는 해당 점도. (A) 작의의 하지만 칩의 테두리에서 정확한 분수에 지역화 파란색 신호. (B) 3 블루 신호 회색 맨 오른쪽에 작의의 하지만 칩 안에 지역화 강조. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57066/57066fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

칩 기반 디지털 PCR에 의해 신선한 냉동 위 암 조직에서 CDH1 드문 사본 이체의 탐지

원고는 칩 기반 디지털 PCR 분석 결과를 신선한 냉동 정상에 드문 CDH1 사본 이체 (CDH1a) 및 위 암 환자에서 얻은 종양 조직 검출을 설명 합니다.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Nanyang Technological University

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K 조회수.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. 원고는 칩 기반 디지털 PCR 분석 결과를 신선한 냉동 정상에 드문 CDH1 사본 이체 (CDH1a) 및 위 암 환자에서 얻은 종양 조직 검출을 설명 합니다.

비디오: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

말 초 혈액 Monocytes 유 방 암 세포 라인 공동 경작에서 Osteoclastogenesis의 인간의 전 임상 모델의 개발

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

연구

암 연구학

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

다음 세대 시퀀싱을 사용 하 여 CtDNA에서 희소 한 변이의 탐지

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

혈 청 및 혈장 복사 번호 검출 실시간 PCR를 사용 하 여

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

pT3N0M0 위암 조직의 파라핀 내장 슬라이드에 탄성 염색

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image analysis. Digital scanning is a fast way to scan a stack of slides and produce digital images with high quality. It can produce concordant results with conventional light microscopy (CLM) by pathologists. Furthermore, the availability of digital images makes it possible that the same slide can be concurrently observed by multiple people. Moreover, digital images of slides can be stored in a database, which means the long-term deterioration of glass slides is avoided. The limitations of this technique are as follows. First, it needs high-quality prepared tissue and the original immunohistochemistry (IHC) slides without any damage or excess sealant residue. Second, tumor or nontumor areas should be specified by experienced pathologists before the analysis using software, in order to avoid any confusion about the tumor or nontumor areas during scoring. Third, the operator needs to control the color reproduction throughout the digitization process in whole-slide imaging.

ZW10 interacting protein (ZWINT) participates in the mitotic spindle checkpoint and the pathogenesis of carcinoma. Here, we introduce a methodology of the immunostaining of ZWINT in human lung cancer tissues, followed by the digital scanning of whole slides and image analysis. This methodology can provide high-quality digital images and reliable results.

인간 폐 조직에서 ZW10 상호 작용 단백질의 면역 염색의 디지털 분석

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using electrophoresis through a resolving gel embedded with a degradable substrate. This method differs from traditional gel zymography in that a quenched fluorogenic peptide is covalently incorporated into the resolving gel instead of full length proteins, such as gelatin or casein. Use of the fluorogenic peptides enables direct detection of proteolytic activity without additional staining steps. Enzymes within the biological samples cleave the quenched fluorogenic peptide, resulting in an increase in fluorescence. The fluorescent signal in the gels is then imaged with a standard fluorescent gel scanner and quantified using densitometry. The use of peptides as the degradable substrate greatly expands the possible proteases detectable with zymographic techniques.

Here, we present a detailed protocol for a modified zymographic technique in which fluorescent peptides are used as the degradable substrate in place of native proteins. Electrophoresis of biological samples in fluorescent peptide zymograms enables detection of a wider range of proteases than previous zymographic techniques.

형광 성 펩 티 드 Zymography에 의해 프로 테아 제 활동의 탐지

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

위암 환자 유래 이종이식 모델 및 1차 세포주 구축

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

장거리 역PCR에 의한 핫 LINE-1의 역변도 활성 감지

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic alterations in oncogenes such as the KRAS oncogene, which constitutes ~25% of lung cancer cases. The difficulty in therapeutically targeting KRAS-driven lung cancer partly stems from having poor models that can mimic the progression of the disease in the lab. We describe a method that permits the relative quantification of primary KRAS lung tumors in a Cre-inducible LSL-KRAS G12D mouse model via ultrasound imaging. This method relies on brightness (B)-mode acquisition of the lung parenchyma. Tumors that are initially formed in this model are visualized as B-lines and can be quantified by counting the number of B-lines present in the acquired images. These would represent the relative tumor number formed on the surface of the mouse lung. As the formed tumors develop with time, they are perceived as deep clefts within the lung parenchyma. Since the circumference of the formed tumor is well-defined, calculating the relative tumor volume is achieved by measuring the length and width of the tumor and applying them in the formula used for tumor caliper measurements. Ultrasound imaging is a non-invasive, fast and user-friendly technique that is often used for tumor quantifications in mice. Although artifacts may appear when obtaining ultrasound images, it has been shown that this imaging technique is more advantageous for tumor quantifications in mice compared to other imaging techniques such as computed tomography (CT) imaging and bioluminescence imaging (BLI). Researchers can investigate novel therapeutic targets using this technique by comparing lung tumor initiation and progression between different groups of mice.

This protocol describes the steps taken to induce KRAS lung tumors in mice as well as the quantification of formed tumors by ultrasound imaging. Small tumors are visualized in early timepoints as B-lines. At later timepoints, relative tumor volume measurements are achieved by the measurement tool in the ultrasound software.

초음파 화상 진찰에 의하여 마우스에 있는 폐 종양 진행의 탐지

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

종양 세포의 측면 꼬리 정맥 주입 다음 폐 전이의 병리학 적 분석

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...