We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Not: Aksi belirtilmediği sürece, işlemler oda sıcaklığında gerçekleştirilir. Sıcaklık kontrollü inkübatör sinek yetiştirme için sıcaklıkları korumak için kullanılan ve aksi belirtilmediği sürece haçlar vardır. 1. hazırlıklar <ol><li> Sinekler hazırlayın. <ol><li> oosit koleksiyonları prometafaz zenginleştirilmiş. <ol><li> Net yetişkin sağlıklı, genç stok veya çapraz kültürlerinden uçar. 25 ° C&#39;de iki gün için yaş şişe. Not: Genellikle, iki sağlıklı şişe yeterli olacaktır, daha çok bazı çapraz kültürler için gerekli olabilir, ancak. </li><li> İki gün sonra, şişe (bu noktada, 0 ila 2 gün geçmiş) ~ 100 ila 300 kadın toplar. kadın bakire olması gerekmez. Bir şişenin yanına maya hamur dab ekleyin ve 30 kadın ve mayalı şişeleri içine 10 ila 15 erkek her koyun. 25 ° C&#39;de iki gün için yaş şişeler. </li></ol></li><li> Oosit Koleksiyonlar metafaz zenginleştirilmiş. <ol><li> Hisse senedi veya çapraz KÜLTÜR gelen ~ 100 ila 300 kadın toplamakes. Bir şişenin yanına maya hamur dab ekleyin ve 30 kadın yer mayalı şişe içine (ilave hiçbir erkek ile birlikte) her biri. 25 ° C &#39;de üç ila beş gün için yaş şişeler. </li></ol></li></ol></li><li> Çözümler hazırlayın. Not: Aksi belirtilmediği sürece, Solutions, oda sıcaklığında süresiz depolanabilir. <ol><li> Robb tampon Modifiye hazırlama (5x): 500 mM HEPES, 500 mM sukroz, 275 mM sodyum asetat, 200 mM potasyum asetat, 50 mM glukoz, 6 mM magnezyum klorid, 5 mM kalsiyum klorid. 7.4 pH değerini elde etmek için potasyum hidroksit: 8 sodyum hidroksit: 10 K 11 kullanın. filtrasyon ile sterilize; kaynatmayın. -20 ° C&#39;de saklayın. ~ 1x Robb&#39;un oosit başına hazırlık 200 ml hazırlamak için gerekli olarak çözülme. </li><li> Tespit Çözümleri. <ol><li> Seçenek # 1: formaldehit / heptan tespit hazırlayın. Sabitleme tampon hazırlayın: 1x Fosfat tamponlu tuz (PBS) artı 150 mM sukroz. kullanmak için, 687,5 ul Sabitleme Tampon ve 312,5 ul% 16 formaldehit ile taze yapmakoosit hazırlık başına. DİKKAT: Davlumbaz formaldehit çözümlerini kullanırken eldiven giyin. kurumsal kurallarına göre bertaraf edilmelidir. </li><li> Seçenek # 2: formaldehit / kakodilat tespit hazırlayın. Düzeltme Mix hazırlayın: 250 mM sükroz, 100 mM potasyum asetat (pH 7.5), 25 mM sodyum asetat (pH 7.0) ve 25 mM EGTA (pH 8.0). kullanmak için, 400 ul taze karışımı saptamak yapmak 100 ul potasyum kakodilat (1 M, pH 7.2), ve oosit prep 500 ul% 16 formaldehid. DİKKAT: Potasyum kakodilat Arsenik içerir. </li></ol></li><li> 1x PBS artı% 1 veya% 0.05 Triton X-100 PBS / Triton X-100 hazırlayın. 4 ° C&#39;de saklayın. </li><li> 1 x PBS, (ağ / hac)% 0.5 BSA ve% 0.1 Tween-20: PBS-Tween 20 Sığır Serum Albumin (BSA) (PTB) hazırlayın. bir hafta boyunca 4 ° C&#39;de saklanabilir. </li><li> Situ Hibridizasyon (FISH) Çözümleri floresan. <ol><li> Hazırlama 20X Sodyum klorür-sodyum sitrat (SSC): 3 M sodyum klorür ve 0.3 M sodyum sitrat. </li><li> Hazırlama 2x SSC-Tween-20 (SSCT) 2X SSC artı% 0.1 Tween-20. oosit hazırlık başına taze ~ 20 ml olun. </li><li> formamid çözümler hazırlayın: 2 x SSC,% 0.1 Tween-20, ayrıca formamid. 1 ml% 20 formamid, 0.5 mL% 40 formamid, ve oosit hazırlık başına 2 ml% 50 formamid, taze olun. DİKKAT: Davlumbaz formamid çözümlerini kullanırken eldiven giyin. kurumsal kurallarına göre bertaraf edilmelidir. </li><li> (Ağırlık / hacim) 2X SSC,% 50 formamid,% 10 dekstran sülfat: hibridizasyon çözeltisi hazırlayın. 4 ° C&#39;de saklayın. </li></ol></li><li> BALIK Probes. <ol><li> Order HPLC ile arıtma sahip oligonükleotid (dizileri için Tablo 1 &#39;e bakınız) ve 5&#39; flüoresan modifikasyonu (örneğin Cy3 veya Cy5) istenen. 50 ng / | il Tris-EDTA (TE) içinde süspanse edin. NOT: Her zaman ışık maruz oligos koruyun. </li></ol></li></ol></li></ol> Geç evre Drosophila Oosit 2. Koleksiyonu <ol><li> Gibi <em&gt; plastik ve cam sopa intakt membranlı Drosophila oositlerin öncesi kat bir 5 ml tüp ve PTB ile oosit hazırlık başına bir süspanse içinde. </li><li> karbon dioksit ile tüm ~ 100 ila 300 mayalı sinekler uyutmak ve ~ 100 ml 1x Robb&#39;un Tamponu içeren bir blender ekleyin. Darbe üç kez (~ 1 sn her). aktivasyonunu önlemek için &lt;için 20 dakika Robb en içinde oosit tutun. NOT: Alternatif olarak, oosit dişilerden el-disseke edilebilir. Bu yöntemin avantajı, daha az kadın gerektirmesidir. Ancak, bakım hipoksi 7 ile bağlantılı bozulmaları önlemek için sadece birkaç dakikaya kadar karbon dioksite maruz sınırlamak için dikkat edilmelidir. </li><li> Büyük beden parçalarını kaldırmak için 250 ml behere büyük örgü (~ 1.500 mm) süzülür. Birçok bozulmamış karnı yine örgü, yeniden eziyet ek Robb&#39;un Tampon kullanarak malzeme ve filtre üzerinde kalırsa. Daha sonra mümkün olduğunca büyük vücut parçaları gibi birçok kaldırarak, üst tabaka aspire ~ 2 dk dinlendiriniz. </li><li> Fi250 ml&#39;lik bir cam kaba, küçük elek (~ 300 um) vasıtasıyla ltresi. Ek Robb adlı ve kaplamalı Pasteur pipet kullanarak ilk beher dışına kalan oosit durulayın. yerleşmek ~ 3 dk edelim; oosit dışarı razı olacak. Aspire off ama ~ 10 ml. </li><li> kaplanmış 5 ml tüp içine sığacak kadar 10 ml kadar dökün. , Yerleşmek sıvı kaldırmak ve kalanı tekrar edelim. Ek Robb adlı ve kaplamalı Pasteur pipet kullanarak kaptan dışarı kalan oosit durulayın. 3-5 dakika ~ 5 ml tüp dinlendiriniz. </li></ol> 3. İlaç Tedavileri (İsteğe bağlı) <ol><li> Coat her oosit hazırlık için PTB ile ikinci 5 ml tüp. 1 ml Robb birbirlerinin oosit hazırlık için, her (Tablo 2), uygun bir çözücü (kontrol) ya da ilaç ekleyin. </li><li> İkinci kaplanmış 5 ml tüp içine bölünmüş oositler. , Yerleşmek Let sıvı kaldırmak ve bir tüp içine 1 ml Robb en artı çözücü eklemek ve 1 ml Robb en artı ilaç ikinci tüpe. Ilaç tedavisi (Tablo 2) uygun zaman miktarı için Nutate. Let yerleşmek. </li></ol> 4. Sabitleme <ol><li> Aspire tüm sıvı ve hemen 1 ml Fix ekleyin. </li><li> Seçenek # 1: Formaldehit / heptan sabitleme (Fixation Tampon artı% 5 formaldehit). <ol><li> Bir nutator 2.5 dakika için düzelt. 1 mi heptan ve 1 dakika vorteksleyin ekleyin. yerleşmek ~ 1 dk olsun. </li><li> tüm sıvı çıkarın ve sonra PBS 1x 1 ml ekleyin. Vortex 30 sn. yerleşmek ~ 1 dk olsun. </li><li> tüm sıvı çıkarın ve sonra 1x PBS ile tüp doldurun. Not: Oositler hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li></ol></li><li> Seçenek # 2: Formaldehit / kakodilat sabitleme (Mix artı% 8 formaldehit ve 100 mM kakodilat Fix). <ol><li> Bir nutator 6 dakika düzelt. 2 dakika dinlendiriniz. sıvı çıkarın ve sonra 1x PBS ile tüp doldurun. Not: Oositler hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li></ol></li></ol> 5. Membranlar çıkarma ( &quot;Rolling&quot;) <ol><li> kaplanmış yeniden süspanse kullanarak, bir cam slayt buzlu (kumlanmış) kısmına ~ 500 ila 1000 oosit ekleyin. tüm vücut parçaları ve yabancı madde kullanarak forseps çıkarın. oosit kurumasına izin vermeyin; gerektiğinde 1x PBS ilave edin. </li><li> Periyodik mikroskop altında ilerleyişini kontrol (. En iyi şekilde çalışır oosit genelinde lamel kenarına sürükleyerek) kaldırılır tüm membranların kadar oosit ve yavaşça &quot;roll&quot; oosit üstünde bir lamel yerleştirin gerektiğinde daha 1x PBS ekledi. oosit yok edecek çok fazla basınç olarak özen gösterin. NOT: immünfloresans sadece, (immünofloresan olan veya olmayan) FISH için Adım 6 ile devam için, Adım 7 ile devam edin. </li></ol> Drosophila OOSİT 6. Antikor Boyama <ol><li> Ekstraksiyon ve Engelleme <ol><li> ~ 15 mi, PBS /% 1 Triton X-100 ihtiva eden 15 ml konik bir tüp içine haddelenmiş oosit durulayın. en az 1.5 saat için bu çözüm ve en fazla 2 saat içinde Nutate oositler.Bu adım, antikor nüfuz etmesini sağlar. </li><li> oosit ~ 2 dk dinlendiriniz. Mümkün olduğunca çok sayıda membran ile birlikte sıvı çıkarın, daha sonra PBS ekleme /% 0.05 Triton X-100. NOT: Zarlar haddelenmiş oosit daha yavaş geçer. </li><li> oosit ~ 2 dk yerleşmek izin, sonra tüm ama ~ 1 ml sıvı kaldırmak. Transfer oosit 1.5 ml tüp mezun oldu ve kalan sıvı çıkarın. 1 saat boyunca bloke etmek ve nutate 1 mi ATB ekleyin. </li></ol></li><li> antikor Boyama <ol><li> Embriyoların karşı sekonder antikor Ön emilim. Not: Bu adım, Drosophila proteinleri ile spesifik olmayan antikor reaksiyonları arka plan boyaması ortadan kaldırır. <ol><li> Toplayın ve tipik prosedür 8 uyarınca Drosophila embriyolar (~ 25 ul) düzeltmek. -20 ° C&#39;de metanol içinde depolayın. </li><li> , Embriyolardan, metanolün çıkması, 15 dakika boyunca 800 ul metanol artı PBS 1X 200 ul ve nutate ekleyin. süpernatan 500 ul çıkarın ve PBS 1X 500 ul ile değiştirin. Daha sonra 15 dakika boyunca nutate. (Yıkar ~ 1 saat olmak üzere toplam) iki kez tekrarlayın ve sonra PTB bitirmek. Not: Embriyolar hemen kullanılabilir ya da oda sıcaklığında birkaç saat boyunca nutator tutulabilir. </li><li> , Sıvı çıkarın oosit hazırlık başına 200 ul PTB ile doldurun ve uygun dilüsyonlarda floresan etiketli sekonder antikor ekleyin (son hacim 300 ul olacağını göz önünde bulundurarak;. Adım 7.4) Nutate 4 ° C&#39;de gece boyunca (tercih edilir) ya da 3 ila 4 saat boyunca oda sıcaklığında karıştırılmıştır. Not: önceden absorbe antikorlar Aşama 6.2.4 kullanılacaktır. NOT: mümkün olduğu kadar floresan antikorlar eklenmiştir kez karanlıkta örnekleri tutun. </li></ol></li><li> , Oosit sıvıyı çıkarmak 300 ul PTB ile doldurun ve uygun dilüsyonlarda primer antikorlar ekleyin. 4 ° C&#39;de bir gece boyunca Nutate (tercih edilir) ya da 3 ila 4 saat boyunca oda sıcaklığında karıştırılmıştır. </li><li> Yıkama 1 ml PTB 15 dakika her biri için dört kez oosit. </li><li> Kaldıroosit, sıvı, embriyolar (sekonder antikor önceden absorbe) üstte yüzen madde 200 ul ekle. Ardından 300 ul PTB ile doldurun. 3 ila 4 saat (tercihen) veya gece boyunca 4 ° C&#39;de oda sıcaklığında Nutate. </li><li> 1 mi PTB ile 15 dakika boyunca bir kez oosit yıkayın, sıvıyı ayırın. Daha sonra, 7 dakika boyunca 0.5 ul Hoechst 33342 ve 500 ul PTB ve nutate ekleyin. </li><li> 1 mi PTB ile her biri 15 dakika için iki kere oosit yıkayın. Not: Oositler hemen slayt üzerine monte edilebilir veya görüntüleme için hazır olana kadar 4 ° C&#39;de PTB depolanabilir. </li></ol></li></ol> 7. BALIK (Above Adım 5 Devam) <ol><li> ~ 15 ml 2x SSCT içeren 15 ml konik tüp içine yuvarlandı oosit durulayın. oosit ~ 2 dk dinlendiriniz. 0.5 ml sıvı mümkün olduğu kadar çok membran ile birlikte tüm ama ~ çıkarın. NOT: Zarlar haddelenmiş oosit daha yavaş geçer. </li><li> Transferi 0.5 ml tüp oosit ve kalan sıvıyı çıkarın. Arda eklemek ve 500 ul kaldırmak% 20,% 40,% 50 formamid çözeltiler, her çözelti içinde 10 dakika için nutating. NOT: Oositler formamid yüksek oranları ile yavaş geçer. </li><li> daha sonra 1 5 saat boyunca 37 ° C&#39;de 500 ul% 50 formamid çözeltisi ve nutate ekleyin sıvıyı ayırın. NOT: Daha uzun inkubasyon daha sonda penetrasyon ile sonuçlanır. </li><li> En fazla 100 ° den ul oosit bırakarak sıvı çıkarın ve 36 ul hibridizasyon çözeltisi artı prob 2 ul (50 ng / | il) ve 2 ul su veya 2. prob (Tablo 1) 2 ul ekle. </li><li> gece boyunca 37 ° C&#39;de su banyosunda kuluçkaya bırakılır, ardından 3 dakika boyunca (FISH için) ya da 20 dakika (balık artı immünofloresan), 80 ° C, 91 ° C de inkübe edilir. Not: Bu adımlar, bir PCR gerçekleştirilebilir. </li><li> sıvı çıkarmayın. 1 saat boyunca 37 ° C&#39;de 500 ul% 50 formamid çözeltisi ve nutate ekleyin. </li><li> , Sıvı kaldırmak, yerleşmek Let 500 ul% 50 formamid çözüm ekleyin, bir1 saat süre ile 37 ° C &#39;de D nutate. </li><li> , Sıvının çıkması, yerleşmek izin 10 dakika için oda sıcaklığında 500 ul% 20 formamid çözeltisi ve nutate ekleyin. </li><li> (Tekrarlama birkaç kez ters, sonra sıvı ekleyin kaldır, yerleşmek izin verin.) 500 ul 2x SSCT üç hızlı yıkar gerçekleştirin yerleşmek edelim, sıvı kaldırmak, daha sonra 4 saat boyunca 500 ul ATB ve nutate ekleyin. </li></ol> 8. Antikor Boyama FISH sonra <ol><li> , Oosit sıvıyı çıkarmak 300 ul PTB ile doldurun ve FITC konjuge 10 ul anti-α-tubulin antikor ekleyin. Seçenek olarak ise, diğer antikorlar, yukarıda protokol izlenerek, kullanılabilir. gece boyunca, oda sıcaklığında Nutate. </li><li> daha sonra, 7 dakika boyunca 0.5 ul Hoechst 33342 ve 500 ul PTB ve nutate ekleyin sıvının çıkması, 500 ul PTB ile 15 dakika boyunca bir kez oosit yıkayın. </li><li> 500 ul PTB ile her biri 15 dakika için iki kere oosit yıkayın. Not: Oositler hemen slayt üzerine monte edilebilir ya da hazır olana kadar 4 ° C&#39;de PTB depolanabilirgörüntüleme. mümkün olduğu kadar floresan antikorlar eklenmiştir kez karanlıkta oosit tutun. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Tekrarlama Ad </td><td fo:width="1in"> Kromozom </td><td> Oligo Sırası * </td></tr><tr><td> 359 </td><td> X </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodeka </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1.686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * Eric Joyce, kişisel iletişim, Sullivan ve ark diğer dizilerden 359 dizisi. 8 </td&gt; </tr></tbody></table> Tablo 1: Drosophila sentromerine tekrarlar için FISH probları. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> İlaç </td><td> çözücü </td><td> stok konsantrasyonu </td><td> Nihai konsantrasyon </td><td> Tedavinin zamanı </td><td> Efekt </td></tr><tr><td> kolşisin </td><td> etanol </td><td> 125 mM </td><td> 150 uM </td><td> 10 dakika ya da 30 dakika </td><td> olmayan kinetochore (10 dakika) 9 veya Tüm (30 dakika) mikrotübül destabilize </td></tr><tr><td> paklitaksel </td><td> DMSO </td><td> 10 mM </td><td> 10 uM </td><td> 10 dk </td><td> mikrofona stabilizerotubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 uM </td><td> 20 dakika </td><td> Aurora B kinaz 10 inhibe </td></tr></tbody></table> Tablo 2: İlaç tedavisi.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Drosophila Oositler evreleme bir ince uzun karyosome genellikle metafaz oositlerden prometafaz ayırt karyosome şeklini kullanarak, prometafaz oositlerinde görülmekle birlikte sorunlu olabilir. prometafaz sırasında, karyosome, yuvarlak bir şekil olarak başlar uzar ve daha sonra oosit metafaz tutuklama yaklaştıkça bir yuvarlak şekle geri çekilir. Bu, pek çok prometafaz oositler uzatılmış karyosome yok demektir. mutant ya da ilaçla tedavi oosit incele...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>16% formaldehyde</td>
			<td>Ted Pella, Inc.</td>
			<td>18505</td>
			<td>HAZARDOUS; once opened, discard after one month</td>
		</tr>
		<tr>
			<td>250 mL beakers</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>active dry yeast</td>
			<td>Various</td>
			<td></td>
			<td>mix with water to make a paste the consistency of peanut butter</td>
		</tr>
		<tr>
			<td>anti-&#945;-tubulin antibody conjugated to FITC</td>
			<td>Sigma</td>
			<td>F2168</td>
			<td>clone DM1A</td>
		</tr>
		<tr>
			<td>Binucleine 2</td>
			<td>Sigma</td>
			<td>B1186</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>blender</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A4161</td>
			<td></td>
		</tr>
		<tr>
			<td>calcium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>colchicine</td>
			<td>Sigma</td>
			<td>C-9754</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>coverslips</td>
			<td>VWR</td>
			<td>48366-227</td>
			<td>No. 1 1/2</td>
		</tr>
		<tr>
			<td>dextran sulfate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forceps</td>
			<td>Ted Pella, Inc.</td>
			<td>5622</td>
			<td>Dumont tweezers high precision grade style 5</td>
		</tr>
		<tr>
			<td>formamide</td>
			<td>Sigma</td>
			<td>47670-250ML-F</td>
			<td></td>
		</tr>
		<tr>
			<td>glass slides</td>
			<td>VWR</td>
			<td>48312-003</td>
			<td></td>
		</tr>
		<tr>
			<td>glucose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>graduated 1.5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>VWR</td>
			<td>EM-5330</td>
			<td>available from several venders</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>magnesium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>methanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>large mesh (~1500 &#181;m)</td>
			<td>VWR</td>
			<td>AA43657-NK</td>
			<td>variety of formats and other suppliers, 12 or 14 mesh</td>
		</tr>
		<tr>
			<td>small mesh (~300 &#181;m)</td>
			<td>Spectrum labs</td>
			<td>146 424</td>
			<td>variety of formats, eg 146 422 or 146 486</td>
		</tr>
		<tr>
			<td>nutator</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipets</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>potassium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cacodylic acid</td>
			<td>Sigma</td>
			<td>C0125</td>
			<td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td>
		</tr>
		<tr>
			<td>potassium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium citrate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sucrose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>taxol (paclitaxel)</td>
			<td>Sigma</td>
			<td>T1912</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Fisher</td>
			<td>PI-28314</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Fisher</td>
			<td>PI-28320</td>
			<td></td>
		</tr>
		<tr>
			<td>vortex</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

Burada tarif edilen metodlar mayoz üç aşamadan (Şekil 1) temsil eden geç evre Drosophila oosit toplama neden olur. Profaz Oositler karyosome (Şekil 1A) çevreleyen bölgede tübülin sinyal eksikliği ile görünür çekirdek zarfına varlığı ile ayırt edilir. Prometafaz nükleer zarf arıza sırasında iğ monte ediyor sonra dönemdir. Prometafaz sırasında karyosome, farklı bir şekil alır, ana karyosome kütlesi (Şekil 1...

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Sabit Görüntüleme prometafaz ve Metafaz Mayoz ve I Teknikleri<em&gt; Drosophila</em&gt; Oositler

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K Görüntüleme.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Video: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Mitoz incelenmesi için Mikroenjeksiyon Teknikleri Drosophila melanogaster Sinsityal Embriyo

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Biyoloji

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

Mezoskopik Floresans Tomografi için In-vivo Görüntüleme Geliştirme Drosophila</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three preparations of the brain and visual system that cover the range from the developing eye disc-brain complex in the developing pupae to individual eye and brain dissection from adult flies. All protocols are optimized for the live culture of the preparations. However, we also present the conditions for fixed tissue immunohistochemistry where applicable. Finally, we show live imaging conditions for these preparations using conventional and resonant 4D confocal live imaging in a perfusion chamber. Together, these protocols provide a basis for live imaging on different time scales ranging from functional intracellular assays on the scale of minutes to developmental or degenerative processes on the scale of many hours.

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

This protocol describes three Drosophila preparations: 1) adult brain dissection, 2) adult retina dissection and 3) developing eye disc- brain complexes dissection. Emphasis is laid on special preparation techniques and conditions for live imaging, although all preparations can be used for fixed tissue immunohistochemistry.

Geliştirilmesi ve Yetişkin hazırlanması Drosophila Brain ve Canlı Görüntüleme için Retinae

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three ...

Techniques for Imaging Ca2+ Signaling in Human Sperm

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in live cells. Here we describe the method used in our laboratories for loading suspensions of human sperm with Ca2+-reporting dyes and measuring the fluorescence signal during physiological stimulation. Motile cells are isolated by direct swim-up and incubated under capacitating conditions for 0-24 h, depending upon the experiment. The cell-permeant AM (acetoxy methyl ester) ester form of the Ca2+-reporting dye is then added to a cell aliquot and a period of 1 h is allowed for loading of the dye into the cytoplasm. We use visible wavelength dyes to minimize photo-damage to the cells, but this means that ratiometric recording is not possible. Advantages and disadvantages of this approach are discussed. During the loading period cells are introduced into an imaging chamber and allowed to adhere to a poly-D-lysine coated coverslip. At the end of the loading period excess dye and loose cells are removed by connection of the chamber to the perfusion apparatus. The chamber is perfused continuously, stimuli and modified salines are then added to the perfusion header. Experiments are recorded by time-lapse acquisition of fluorescence images and analyzed in detail offline, by manually drawing regions of interest. Data are normalized to pre-stimulus levels such that, for each cell (or part of a cell), a graph showing the Ca2+ response as % change in fluorescence is obtained.

Techniques for Imaging Ca2+ Signaling in Human Sperm

Stimulus-evoked [Ca2+]i signals of individual human sperm are assessed. Motile cells are loaded with Ca2+-sensitive fluorescent dye (AM-ester method) and immobilised in a perfusable chamber. Cells are imaged by time-lapse fluorescence microscopy and stimulated via the perfusing medium. Responses of single cells (or regions) are analysed offline using Excel.

Görüntüleme Ca Teknikleri 2 + İnsan Sperm sinyal

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in ...

Upright Imaging of Drosophila Embryos

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current techniques used to view such processes are somewhat limited. The following protocol describes a new technique for mounting fixed and labeled Drosophila embryos for coronal viewing with confocal imaging. This method consists of embedding embryos between two layers of glycerin jelly mounting media, and imaging jelly strips positioned upright. The first step for sandwiching the embryos is to make a thin bedding of glycerin jelly on a slide. Next, embryos are carefully aligned on this surface and covered with a second layer of jelly. After the second layer is solidified, strips of jelly are cut and flipped upright for imaging. Alternatives are described for visualizing the embryos depending upon the type of microscope stand to be used. Since all cells along the dorsal-ventral axis are imaged within a single confocal Z-plane, our method allows precise measurement and comparison of fluorescent signals without photobleaching or light scattering common to 3D reconstructions of longitudinally mounted embryos.

Upright Imaging of Drosophila Embryos

Here we present a mounting protocol for stained Drosophila embryos in an upright position that allows imaging of cross-sections using Confocal microscopy.

VE Dik Görüntüleme Drosophila Embriyolar

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

Alt hücresel Çözünürlük bozulmamış Drosophila Larva in vivo Görüntüleme

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

İyon Kanalları incelenmesi için yama Kelepçe ve Perfüzyon Teknikleri cinsinden ifade edilir Xenopus Oosit

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

Living Görüntüleme Hücre Şekli Değiştir Drosophila Embriyolar

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

GFP etiketli Proteinlerin Görüntüleme Canlı<em&gt; Drosophila</em&gt; Oosit

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

Apoptotik hücresi Temizliği görüntülenmesi sırasında Canlı<em&gt; Drosophila</em&gt; Embriyo

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...