We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Nota: Os procedimentos são realizados à temperatura ambiente a menos que indicado de outra maneira. incubadoras de temperatura controlada são usados ​​para manter as temperaturas para criação mosca e cruza salvo indicação em contrário. 1. Preparações <ol><li> Prepare Moscas. <ol><li> Prometáfase enriquecido coleções de ovócitos. <ol><li> Limpar moscas adultas a partir saudáveis, jovens de ações ou transversais culturas. garrafas de idade para dois dias a 25 ° C. Nota: Geralmente duas garrafas saudáveis ​​serão suficientes, embora mais podem ser necessários para algumas culturas cruzadas. </li><li> Após dois dias, recolher ~ 100 a 300 (fêmeas que são 0 a 2 dias de idade, neste ponto) de garrafas. As fêmeas não precisa ser virgens. Adicionar uma pincelada de pasta de levedura para o lado de um frasco e colocá-30 fêmeas e 10 machos e 15 cada um em frascos yeasted. frascos de idade para dois dias a 25 ° C. </li></ol></li><li> Metaphase enriquecido ovócitos Collections. <ol><li> Recolha ~ 100 a 300 fêmeas de estoque ou cross cultures. Adicionar uma pincelada de pasta de levedura para o lado de um frasco e colocar cada 30 fêmeas (sem machos adicionados) para dentro de frascos yeasted. frascos de idade para três a cinco dias a 25 ° C. </li></ol></li></ol></li><li> Prepare Solutions. Nota: As soluções podem ser armazenadas indefinidamente à temperatura ambiente, a menos que indicado de outra maneira. <ol><li> Preparar tampão de modificação de Robb (5x): 500 mM de HEPES, 500 mM de sacarose, acetato de sódio 275 mM, acetato de potássio 200 mM, glicose 50 mM, cloreto de magnésio a 6 mM, e cloreto de cálcio 5 mM. Use 10 N 11: 8 de hidróxido de sódio: hidróxido de potássio para trazer o pH para 7,4. Esterilizar por filtração; Não autoclave. Armazenar a -20 ° C. Descongelar conforme necessário para preparar ~ 200 ml de 1x Robb por ovócitos prep. </li><li> Fixação Solutions. <ol><li> Opção # 1: Prepare formaldeído / fixação heptano. Preparar tampão de fixação: solução salina tamponada 1x com fosfato (PBS), mais 150 mM de sacarose. Para usar, faça fresco com 687,5 ul Fixação de buffer e 312,5 mL de 16% de formaldeídopor prep oócito. CUIDADO: Use luvas enquanto estiver usando soluções de formaldeído em um exaustor. Descarte de resíduos de acordo com as diretrizes institucionais. </li><li> Opção # 2: Preparar o formaldeído / fixação cacodilato. Prepare a mistura Fix: sacarose 250 mM, acetato de potássio 100 mM (pH 7,5), acetato de sódio 25 mM (pH 7,0), e EGTA 25 mM (pH 8,0). Para usar, faça fresco com 400 ul Fix Mix, 100 cacodilato ul de potássio (1 M, pH 7,2), e 500 mL de 16% de formaldeído por prep oócito. CUIDADO: cacodilato de potássio contém arsênico. </li></ol></li><li> Prepare PBS / Triton X-100: 1x PBS mais 1% ou 0,05% de Triton X-100. Armazenar a 4 ° C. </li><li> Prepare PBS-Tween 20 Albumina de Soro Bovino (BSA) (PTB): 1x PBS, BSA a 0,5% (w / v) e 0,1% de Tween-20. Pode ser armazenado a 4 ° C durante uma semana. </li><li> A fluorescência in situ fluorescente (FISH) Soluções. <ol><li> Prepara-cloreto de sódio 20X Citrato de sódio (SSC): 3 M de cloreto de sódio e citrato de sódio 0,3 M. </li><li> Prepare 2x SSC-Tween-20 (SSCT): 2 x SSC mais 0,1% de Tween-20. Faça frescas, ~ 20 ml por prep oócito. </li><li> Preparar soluções de formamida: 2 x SSC, 0,1% de Tween-20, além de formamida. Adicione fresco, 1 ml de 20% de formamida, 0,5 ml de formamida a 40%, e 2 ml de formamida a 50% por preparação de oócitos. CUIDADO: Use luvas enquanto estiver usando soluções de formamida em um exaustor. Descarte de resíduos de acordo com as diretrizes institucionais. </li><li> Preparar a solução de hibridização: 2 x SSC, formamida a 50%, e 10% de sulfato de dextrano (w / v). Armazenar a 4 ° C. </li></ol></li><li> Sondas peixe. <ol><li> Oligonucleotídeos ordem (ver Tabela 1 para sequências) com HPLC e desejado 5 &#39;modificação fluorescente (por exemplo, Cy3 ou Cy5). Ressuspender em Tris-EDTA (TE) a 50 ng / ul. NOTA: Proteja oligos da exposição à luz em todos os momentos. </li></ol></li></ol></li></ol> 2. Recolha de tarde-estágio Drosophila Oócitos <ol><li> Como <em&gt; oócitos de Drosophila com membranas íntegras vai ficar com plástico e vidro, pré-revestir o interior de um tubo de 5 ml e uma pipeta de Pasteur por prep ovócito com PTB. </li><li> Anestesiar todos os ~ 100 a 300 moscas yeasted com dióxido de carbono e adicionar a um misturador contendo ~ 100 ml de 1X tampão de Robb. Pulso três vezes (~ 1 segundo cada). Mantenha oócitos em Robb para &lt;20 min para evitar a activação. NOTA: Como alternativa, os oócitos podem ser mão-dissecados das fêmeas. A vantagem deste método é que ele exige menos fêmeas. No entanto, os cuidados devem ser tomadas para limitar a exposição ao dióxido de carbono para apenas alguns minutos para evitar erros associados à hipóxia 7. </li><li> Filtrar através de malha grande (~ 1.500 mm) em 250 ml copo para remover partes do corpo grandes. Se muitos abdomens intactas permanecer no material de malha, re-moagem usando adicional buffer de Robb e filtro novamente. Vamos resolver ~ 2 min, em seguida, aspirar off camada superior, removendo como muitos dos grandes partes do corpo quanto possível. </li><li> Filtro através de malha pequena (~ 300 uM) para uma proveta de 250 ml. Lavar ovócitos restantes fora do primeiro copo usando adicional de Robb e revestido Pasteur pipeta. Vamos settle ~ 3 min; oócitos vai resolver fora. Aspirar off todos, mas ~ 10 ml. </li><li> Despeje o máximo de 10 ml como se encaixam em revestido tubo de 5 ml. Vamos resolver, remover o líquido, e repita com o restante. Lavar ovócitos restantes fora do copo usando Pasteur pipeta adicional de Robb e revestido. Vamos resolver em 5 ml tubo para ~ 3-5 min. </li></ol> 3. Os tratamentos medicamentosos (Opcional) <ol><li> Revestimento de um segundo tubo de 5 ml com PTB para cada prep oócito. Adicionar solvente apropriado (controle) ou de drogas para 1 ml de Robb cada oócito para cada preparação (Tabela 2). </li><li> oócitos dividida em segunda revestido tubo de 5 ml. Vamos Settle, remover o líquido e adicionar 1 ml Robb das mais solventes em um tubo e 1 ml Robb de mais droga no segundo tubo. Nutar para a quantidade de tempo apropriado para o tratamento de drogas (Tabela 2). euet resolver. </li></ol> 4. Fixação <ol><li> Aspirar off todo o líquido e imediatamente adicionar 1 ml Fix. </li><li> Opção # 1: Formaldeído / fixação heptano (Tampão de Fixação mais 5% de formaldeído). <ol><li> Fixar para 2.5 min em um nutator. Adicionar 1 ml de heptano e vortex 1 min. Vamos settle ~ 1 min. </li><li> Retire todo o líquido e, em seguida adicionar 1 ml 1x PBS. Vortex 30 seg. Vamos settle ~ 1 min. </li><li> Retire todo o líquido e, em seguida, preencher tubo com 1x PBS. NOTA: Os oócitos podem ser utilizadas imediatamente ou mantidas no nutator durante várias horas à temperatura ambiente. </li></ol></li><li> Opção # 2: fixação de formaldeído / cacodilato (Fix Mix mais 8% formaldeído e cacodilato 100 mM). <ol><li> Correção para 6 min em um nutator. Vamos contentar 2 min. Remover o líquido e, em seguida, preencher tubo com 1x PBS. NOTA: Os oócitos podem ser utilizadas imediatamente ou mantidas no nutator durante várias horas à temperatura ambiente. </li></ol></li></ol> 5. Removendo membranas ( &quot;Rolling&quot;) <ol><li> Usando revestido pipeta de Pasteur, adicione ~ 500 a 1.000 oócitos para a parte fosco (jacto de areia) de uma lâmina de vidro. Remover todas as partes do corpo e materiais usando uma pinça estranhos. Não deixe oócitos secar; adicionar 1x PBS conforme necessário. </li><li> Coloque uma lamela em cima dos oócitos e gentilmente oócitos &quot;Roll&quot; até que todas as membranas são removidos (arrastando a borda da lamela entre os oócitos funciona melhor.) Verifique periodicamente o progresso sob o microscópio, adicionando mais 1x PBS, conforme necessário. Tome cuidado como muita pressão irá destruir os ovócitos. NOTA: Para imunofluorescência somente, continue com o Passo 6. Para peixes (com ou sem imunofluorescência), continue na Etapa 7. </li></ol> 6. Coloração de anticorpos de Drosophila Oócitos <ol><li> Extração e Bloqueio <ol><li> Lavar oócitos enroladas em um tubo cónico de 15 mL contendo ~ 15 mL de PBS / 1% de Triton X-100. oócitos nutar nesta solução por não menos do que 1,5 horas e não mais do que 2 h.Este passo permite a penetração do anticorpo. </li><li> Vamos oócitos resolver ~ 2 min. Remover o líquido, juntamente com o maior número de membranas quanto possível, em seguida, adicionar PBS / 0,05% de Triton X-100. NOTA: Membranas vai resolver mais lento do que oócitos laminados. </li><li> Deixe oócitos resolver ~ 2 min, em seguida, remover todos, mas ~ 1 ml de líquido. oócitos de transferência para se formou 1,5 tubo ml e remover o líquido remanescente. Adicionar 1 ml de TBP para o bloqueio e nutar durante 1 h. </li></ol></li><li> coloração de anticorpos <ol><li> Pré-absorção de anticorpos secundários contra embriões. NOTA: Este passo elimina a coloração de fundo a partir de interações de anticorpos não específicos com proteínas de Drosophila. <ol><li> Recolher e corrigir embriões de Drosophila (~ 25 ul) por típico procedimento 8. Armazenar em metanol a -20 ° C. </li><li> Remover o metanol a partir de embriões, adicionar 800 mL de metanol, com 200 ul de 1x PBS, e nutar durante 15 min. Retirar 500 ul de sobrenadante e substituir com 500 ul de PBS 1x. Então nutar para 15 min. Repita duas vezes (para um total de ~ 1 hr de lavagens), e depois terminar no PTB. NOTA: Os embriões podem ser utilizadas imediatamente ou mantidas no nutator por várias horas à temperatura ambiente. </li><li> Remover o líquido, encher com PTB para 200 mL por prep oócito, e adicionar anticorpos secundários fluorescente-etiquetados em diluições adequadas (tendo em mente que o volume final será de 300 ul;. Consulte o passo 7.4) nutar a 4 ° C durante a noite (preferível) ou à temperatura ambiente durante 3 a 4 horas. NOTA: Os anticorpos pré-absorvida irá ser utilizado no Passo 6.2.4. NOTA: Manter as amostras no escuro, tanto quanto possível, uma vez anticorpos fluorescentes foram adicionados. </li></ol></li><li> Remover o líquido a partir de oócitos, encher com PTB até 300 ml, e adicionar anticorpos primários nas diluições apropriadas. Nutar a 4 ° C durante a noite (preferível) ou à temperatura ambiente durante 3 a 4 horas. </li><li> Lavar oócitos quatro vezes durante 15 minutos cada um com 1 ml PTB. </li><li> Removerlíquido a partir de oócitos, adicionar 200 ul de sobrenadante a partir de embriões pré-absorvida (anticorpos secundários). Em seguida, preencha com PTB para 300 l. Nutar à temperatura ambiente durante 3 a 4 horas (preferivelmente) ou a 4 ° C durante a noite. </li><li> Lavar oócitos uma vez durante 15 min com 1 ml PTB, remover o líquido. Em seguida, adicione 0,5 mL Hoechst 33342 e 500 ul PTB e nutar para 7 min. </li><li> Lavar oócitos duas vezes durante 15 minutos cada um com 1 ml PTB. NOTA: Os oócitos pode ser montada numa lamela imediatamente ou pode ser armazenada na TBP a 4 ° C até estar pronto para a imagiologia. </li></ol></li></ol> 7. FISH (Continue a partir do passo 5 acima) <ol><li> Lavar oócitos enroladas em um tubo cônico de 15 ml contendo ~ 15 ml 2x SSCT. Vamos oócitos resolver ~ 2 min. Remova todos, mas ~ 0,5 ml de líquido, juntamente com o maior número de membranas quanto possível. NOTA: Membranas vai resolver mais lento do que oócitos laminados. </li><li> Transferência de oócitos para 0,5 tubo ml e remover o líquido remanescente. Sucessivamente adicionar e remover 500 mL20%, 40%, 50% e soluções de formamida, de nutação durante 10 minutos em cada solução. NOTA: Os oócitos vai resolver mais lento com maiores percentagens de formamida. </li><li> Remover o líquido, em seguida, adicionar solução de formamida a 500 ul de 50%, e nutar a 37 ° C durante 1 a 5 horas. NOTA: Longer incubações resultar em uma melhor penetração da sonda. </li><li> Remover o líquido, deixando para trás nada mais do que ~ 100 ul de oócitos, e adicionar 36 ul de solução de hibridação mais 2 ul de sonda (50 ng / mL) e 2 mL de água ou 2 mL de uma sonda 2 ND (Tabela 1). </li><li> Incubar a 91 ° C durante 3 min (apenas FISH) ou 80 ° C durante 20 min (FISH e de imunofluorescência), seguido por incubação num banho de água a 37 ° C durante a noite. NOTA: Estes passos podem ser efectuados num termociclador. </li><li> Não remover o líquido. Adicionar 500 ul de solução a 50% de formamida e nutar a 37 ° C durante 1 h. </li><li> Vamos Settle, remover o líquido, adicione a solução de formamida 500 mL de 50%, umd nutar a 37 ° C durante 1 h. </li><li> Vamos assentar, remover o líquido, adicionar solução de formamida a 500 ul de 20%, e nutar à temperatura ambiente durante 10 min. </li><li> Execute três lavagens rápidas em 500 ul 2x SSCT (vamos Settle, remover, em seguida, adicione o líquido, inverter várias vezes, repetir.) Vamos Settle, remover o líquido, em seguida, adicionar 500 mL PTB e nutar durante 4 h. </li></ol> 8. Coloração de anticorpos após FISH <ol><li> Remover o líquido a partir de oócitos, encher com 300 uL de TBP, e adicionar anticorpo anti-tubulina α 10 ul conjugado com FITC. Alternativamente, outros anticorpos podem ser utilizados, seguindo o protocolo acima. Nutar à temperatura ambiente durante a noite. </li><li> Lavar oócitos uma vez durante 15 min com 500 uL PTB, remover o líquido, em seguida, junta-se 0,5 ul de Hoechst 33342 e 500 ul PTB e nutar durante 7 min. </li><li> Lavar oócitos duas vezes durante 15 minutos cada um com 500 ul PTB. NOTA: Os oócitos pode ser montada numa lamela imediatamente ou pode ser armazenada na TBP a 4 ° C até pronto para serimagiologia. Mantenha oócitos no escuro, tanto quanto possível, uma vez anticorpos fluorescentes foram adicionados. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Repita Nome </td><td fo:width="1in"> Cromossoma </td><td> Seqüência Oligo * </td></tr><tr><td> 359 </td><td> X </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodeca </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1.686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * 359 sequência de Eric Joyce, comunicação pessoal, outras sequências de Sullivan et al. 8 </td&gt; </tr></tbody></table> Tabela 1: sondas de peixe para repete centroméricas de Drosophila. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Droga </td><td> Solvente </td><td> da concentração </td><td> A concentração final </td><td> Tempo de tratamento </td><td> Efeito </td></tr><tr><td> colchicina </td><td> etanol </td><td> 125 mM </td><td> 150 uM </td><td> 10 min ou 30 min </td><td> desestabilizar não cinetocoro (10 min), 9 ou todos os microtúbulos (30 min) </td></tr><tr><td> paclitaxel </td><td> DMSO </td><td> 10 mM </td><td> 10 uM </td><td> 10 min </td><td> estabilizar microtubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 uM </td><td> 20 min </td><td> inibir Aurora B quinase 10 </td></tr></tbody></table> Tabela 2: O tratamento medicamentoso.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Staging Drosophila Oócitos Embora um cariossomo alongada é muitas vezes visto em oócitos prometáfase, usando cariossomo forma de distinguir prometáfase a partir de oócitos metafase pode ser problemático. Durante prometáfase, o cariossomo começa como uma forma redonda, alonga, e, em seguida, se retrai para uma forma redonda como o oócito se aproxima da prisão metáfase. Isto significa que muitos oócitos prometáfase não tem uma cariossomo alongado. Além disso, se os oócitos mutantes ou tratados com fármaco são examinados, cariossomo forma pode ser afectada, se opõe a utilização deste método para a fase oócitos. Uma vez que outros marcadores para distinguir estas fases não estão disponíveis no momento, que utiliza o método acima descrito para manipular a velocidade de postura de ovos de fêmeas de Drosophila para enriquecer em oócitos quer em prometáfase ou metafase. O raciocínio é que, se oócitos passar um determinado período de tempo em prometáfase, e uma quantidade indefinida de tempo arrresse em metáfase, que dura até de postura, então mais rápido postura de ovos irá inclinar em direção a uma maior percentagem de oócitos prometáfase, enquanto mais lento postura de ovos irá enriquecer para metáfase. A quantidade de esforço necessário para recolher fêmeas virgens ou coletar mulheres ao longo de um período de tempo mais curto do que 2 dias, como descrito por Gilliland et al. 6, não é recompensado por um aumento apreciável em oócitos prometáfase. Também é impossível usar os apêndices dorsais para encenar oócitos preparados com este protocolo como apêndices dorsais são removidos juntamente com as membranas. Embora não seja possível para a fase oócitos individuais com 100% de certeza utilizando este método, os dados de prometáfase enriquecido ou colecções enriquecido em metafase pode ser tomados em conjunto para tirar conclusões sobre estas diferentes fases 9. Oócitos de Drosophila não são fertilizados até que eles passam através do oviducto; portanto, porque os ovócitos recolhidos para the protocolos descritos aqui examinar oócitos tomadas antes postura de ovos, esses ovócitos não foram fertilizados. A passagem através do oviducto também faz com que o oócito para activar e retomar a progressão do ciclo celular. Métodos para examinar as fases do ciclo celular após metaphase eu existo 11,12, mas estão fora do âmbito deste protocolo. Considerações método de fixação Nós descrevemos dois métodos distintos para a fixação do estágio final de ovócitos de Drosophila. O método de fixação de formaldeído / cacodilato foi primeiramente descrita por Theurkauf e Hawley 3 e o método de fixação de formaldeído / heptano foi primeiramente descrita por Zou et al. 4. Além disso, um terceiro método (fixação metanol) é usado cerca de 13, mas não descritas aqui. A remoção das membranas de oócitos é um pouco mais difícil após fixação formaldeído / heptano em relação ao formaldeído / cacodilato. Isto porque &quot;rolling&quot; dependerás no atrito entre a lamela e de oócitos, e formaldeído fixação / heptano faz com que os oócitos mais escorregadia. Apesar desta dificuldade adicional, a nossa primeira escolha do método de fixação ao testar novos anticorpos é formaldeído / heptano porque ele funciona melhor para a maioria dos anticorpos que temos tentado. Por outro lado, prefere-se o formaldeído / cacodilato de fixação para os peixes, primeiramente para a facilidade de remoção da membrana, embora a fixação de formaldeído / heptano também tem sido bem sucedida. Ambos os métodos preservar a morfologia do oócito melhor do que a fixação de metanol, e, portanto, recomendamos a fixação metanol apenas nos casos de anticorpos que são refratários ao métodos de fixação à base de formaldeído. Os protocolos descritos aqui em foco de imagem fixa, de modo a demonstrar métodos eficazes para render oócitos maduros Drosophila passíveis de penetração de anticorpos, ou seja, através da remoção das membranas de oócitos. Métodos alternativos para a remo membranaval (usando uma pinça 14 ou sonicação 13) são possíveis; No entanto, encontramos &quot;rolar&quot; a ser o método mais eficiente e confiável. Técnicas de imagem ao vivo também têm sido descritos em outros lugares 14-16 e estão fora do âmbito deste protocolo. Recomendações PEIXES FISH em oócitos de Drosophila foi descrito originalmente por Dernburg et al. 5. Este protocolo foi concebido para proporcionar condições ideais para a hibridação sonda para os cromossomas de ovócitos condensadas, mas o protocolo original não era ideal para imunofluorescência. O método descrito acima inclui adaptações que fizemos para aumentar a coloração de anticorpos de α-tubulina, que é essencialmente o que usamos na realização de FISH. Para outros anticorpos, diminuindo a temperatura do passo de desnaturação (Passo 7.5) a partir de 80 ° C pode ser necessário. As sondas são listadas aqui para oseqüências repetitivas no heterocromatina perto dos centrômeros. Porque estas sequências são altamente repetitiva, as sondas emparelhar com vários lugares e os sinais coletivos são bastante fortes. Temos tido pouco sucesso com sondas para sequências na eucromatina, possivelmente devido à estrutura única dos cromossomas, enquanto contida na cariossomo condensado. imagiologia Oócitos Drosophila maduros, como os ovócitos da maioria dos organismos, são células grandes, único. Isto significa que existe um grande volume de citoplasma que contém um único núcleo. Felizmente, este núcleo, também conhecido como um cariossomo em Drosophila, pode ser prontamente identificado uma vez que está normalmente localizado a apenas sob os apêndices dorsais junto ao córtex. Os apêndices dorsal são removidos juntamente com as membranas de oócitos, mas o cariossomo ainda pode ser localizado encontrando o pequeno torrão no córtex oócito onde os apêndices ódno foram. As melhores imagens são obtidas a partir de oócitos que foram montados com este torrão de frente para a lamela uma vez que este coloca o cariossomo mais próximo do objectivo. Embora possa ser possível organizar os oócitos Nesta orientação antes da montagem, prefere-se montar muitos oócitos aleatoriamente e então procurar o diapositivo para aqueles na orientação preferida. Aplicações futuras No futuro, será importante para identificar marcadores que distinguir de forma confiável prometáfase I e metaphase fusos I. Ser capaz de organizar de forma mais confiável os oócitos irá reduzir a dependência de mais alternativas de trabalho intensivo, tais como imagiologia grande número de oócitos enriquecido em palco ou imagens ao vivo, o que também tem os seus problemas de teste. Este método é um método de base, que pode ser usado para tirar partido dos avanços no campo da genética de Drosophila como novas ferramentas tornam-se disponíveis para modificar ou knock out produtos de genes. Isto inclui métodosde alvejar diretamente a atividade da proteína com novas drogas ou estratégias de degradação alvejados. Além disso, estes métodos não estão limitados a imagiologia de eixos meióticos. Qualquer estrutura dentro do oócito, tais como o citoesqueleto de actina, podem ser analisados ​​utilizando estes métodos.

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>16% formaldehyde</td>
			<td>Ted Pella, Inc.</td>
			<td>18505</td>
			<td>HAZARDOUS; once opened, discard after one month</td>
		</tr>
		<tr>
			<td>250 mL beakers</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>active dry yeast</td>
			<td>Various</td>
			<td></td>
			<td>mix with water to make a paste the consistency of peanut butter</td>
		</tr>
		<tr>
			<td>anti-&#945;-tubulin antibody conjugated to FITC</td>
			<td>Sigma</td>
			<td>F2168</td>
			<td>clone DM1A</td>
		</tr>
		<tr>
			<td>Binucleine 2</td>
			<td>Sigma</td>
			<td>B1186</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>blender</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A4161</td>
			<td></td>
		</tr>
		<tr>
			<td>calcium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>colchicine</td>
			<td>Sigma</td>
			<td>C-9754</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>coverslips</td>
			<td>VWR</td>
			<td>48366-227</td>
			<td>No. 1 1/2</td>
		</tr>
		<tr>
			<td>dextran sulfate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forceps</td>
			<td>Ted Pella, Inc.</td>
			<td>5622</td>
			<td>Dumont tweezers high precision grade style 5</td>
		</tr>
		<tr>
			<td>formamide</td>
			<td>Sigma</td>
			<td>47670-250ML-F</td>
			<td></td>
		</tr>
		<tr>
			<td>glass slides</td>
			<td>VWR</td>
			<td>48312-003</td>
			<td></td>
		</tr>
		<tr>
			<td>glucose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>graduated 1.5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>VWR</td>
			<td>EM-5330</td>
			<td>available from several venders</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>magnesium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>methanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>large mesh (~1500 &#181;m)</td>
			<td>VWR</td>
			<td>AA43657-NK</td>
			<td>variety of formats and other suppliers, 12 or 14 mesh</td>
		</tr>
		<tr>
			<td>small mesh (~300 &#181;m)</td>
			<td>Spectrum labs</td>
			<td>146 424</td>
			<td>variety of formats, eg 146 422 or 146 486</td>
		</tr>
		<tr>
			<td>nutator</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipets</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>potassium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cacodylic acid</td>
			<td>Sigma</td>
			<td>C0125</td>
			<td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td>
		</tr>
		<tr>
			<td>potassium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium citrate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sucrose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>taxol (paclitaxel)</td>
			<td>Sigma</td>
			<td>T1912</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Fisher</td>
			<td>PI-28314</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Fisher</td>
			<td>PI-28320</td>
			<td></td>
		</tr>
		<tr>
			<td>vortex</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

Os métodos que descrevemos aqui resultará na coleta de oócitos em estágio final de Drosophila representam três fases da meiose (Figura 1). Os oócitos na profase distinguem-se pela presença do envelope nuclear, que é visível pela falta de sinal de tubulina na região em torno do cariossomo (Figura 1A). Prometáfase é o período após nuclear quebra envelope durante o qual os monta fuso. Durante prometáfase, o cariossomo assume uma forma distinta, tornando-se alongado muitas vezes com o 4º cromossomos Além dos principais massa cariossomo (Figura 1B). Prometáfase conclui com metáfase, na qual oócitos Drosophila naturalmente prender até a ovulação. Em oócitos metafase, o cariossomo tenha se retratado em uma forma redonda (Figura 1C). Descrevemos aqui métodos para manipular a velocidade de postura de ovos das fêmeas de Drosophila para enriquecer oócitos quer em prometáfase ou metáfase. Oócitos de prometáfase enriquecidas coleções com freqüência mostram a cariossomo alongada (Figura 2A), enquanto coleções metafásicas enriquecido ou coleções de fêmeas virgens de Drosophila, que eliminam quase completamente postura de ovos, mostram principalmente o cariossomo round (Figura 2B). Curiosamente, prometáfase enriquecidas coleções mostram também tipicamente muito mais robusto fusos, sugerindo que tanto a mudança cariossomo eo eixo entre prometáfase e metaphase em Drosophila oócitos 9. A Figura 3 mostra imagens representativas dos dois protocolos descritos aqui. Os anticorpos contra α-tubulina (para mostrar o eixo), CENP-C (para mostrar centrómeros), e INCENP (para mostrar o eixo central) foram utilizados em oócitos fixo com formaldehyde / heptano (Figura 3A). As sondas para as sequências centroméricos repetitivas no cromossoma 2 ND (AACAC) e 3 rd cromossoma (Dodeca) foram usadas em oócitos fixas com formaldeído / cacodilato e co-coradas com um anticorpo α-tubulina de acordo com o protocolo de FISH (Figura 3B). A sonda AACAC aparece como vários focos de cluster enquanto a sonda dodeca aparece como um único foco por cromossomo. Os oócitos tratados com colchicina 150 uM durante 10 min foram fixados com formaldeído / heptano (Figura 3C). Este tratamento elimina a maioria dos não-cinetócoro-microtúbulos, o que resulta em todos os microtúbulos em contacto com o ADN em focos marcado com centrómero. Os oócitos tratados com paclitaxel a 10 uM durante 10 min mostrar microtúbulos excessivas no citoplasma, mas pouco efeito sobre os microtúbulos do fuso (Figura 3D). Oócitos tratados com 25 mM Binucleine 2 por 20 min para inibir a perda de Aurora B quinase show completo demicrotúbulos fusiformes (Figura 3E). <img alt="figura 1" src="/files/ftp_upload/54666/54666fig1.jpg" /> Figura 1: Três fases de oócitos maduros Drosophila:. Prophase, Prometáfase e Metaphase imagens confocal de oócitos de Drosophila em prophase (A), prometáfase (B) e metáfase (C) do DNA da meiose I. é mostrado em azul e tubulina é mostrado em verde em imagens fundidas. As inserções em (B) e (C) mostram ADN em branco. Barras de escala = 10 mm. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54666/54666fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/54666/54666fig2.jpg" /> Figura 2:Prometaphase- vs. coleções metafásicas enriquecido de oócitos de Drosophila. Imagens confocal de oócitos de Drosophila de prometáfase enriquecido (A) ou coleções enriquecido em metáfase (B). DNA é mostrado em azul e tubulina é mostrado em verde. Barras de escala = 10 mm. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54666/54666fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/54666/54666fig3.jpg" /> Figura 3: coloração de anticorpos, peixe e drogas tratamentos de oócitos Drosophila imagens confocal de oócitos de Drosophila com DNA em azul e tubulina no verde.. Barras de escala = 10 uM. (A) Imunofluorescência em formaldehyde / heptano fixação com INCENP (eixo central) em vermelho e CENP-C (centrômeros) em branco. (B) FISH na fixação de formaldeído / cacodilato com AACAC mostrado na dodeca vermelho e mostrado em branco. (C) O tratamento com 150 colchicina M para 10 min com CENP-C mostrada em vermelho. O tratamento com paclitaxel 10 mM durante 10 min (D) ou 25 mM Binucleine 2 para 20 min (E). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54666/54666fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Técnicas de imagem Prometáfase e Metaphase da meiose I em Fixed<em&gt; Drosophila</em&gt; oócitos

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K visualizações.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Vídeo: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Técnicas de microinjeção para estudar na Mitose Drosophila melanogaster Embrião Sincicial

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Biologia

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

Mesoscópica de fluorescência para Tomografia In-vivo Imaging de desenvolvimento Drosophila</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three preparations of the brain and visual system that cover the range from the developing eye disc-brain complex in the developing pupae to individual eye and brain dissection from adult flies. All protocols are optimized for the live culture of the preparations. However, we also present the conditions for fixed tissue immunohistochemistry where applicable. Finally, we show live imaging conditions for these preparations using conventional and resonant 4D confocal live imaging in a perfusion chamber. Together, these protocols provide a basis for live imaging on different time scales ranging from functional intracellular assays on the scale of minutes to developmental or degenerative processes on the scale of many hours.

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

This protocol describes three Drosophila preparations: 1) adult brain dissection, 2) adult retina dissection and 3) developing eye disc- brain complexes dissection. Emphasis is laid on special preparation techniques and conditions for live imaging, although all preparations can be used for fixed tissue immunohistochemistry.

Preparação de Desenvolvimento e Adultos Drosophila Brains e retina de imagens ao vivo

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three ...

Techniques for Imaging Ca2+ Signaling in Human Sperm

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in live cells. Here we describe the method used in our laboratories for loading suspensions of human sperm with Ca2+-reporting dyes and measuring the fluorescence signal during physiological stimulation. Motile cells are isolated by direct swim-up and incubated under capacitating conditions for 0-24 h, depending upon the experiment. The cell-permeant AM (acetoxy methyl ester) ester form of the Ca2+-reporting dye is then added to a cell aliquot and a period of 1 h is allowed for loading of the dye into the cytoplasm. We use visible wavelength dyes to minimize photo-damage to the cells, but this means that ratiometric recording is not possible. Advantages and disadvantages of this approach are discussed. During the loading period cells are introduced into an imaging chamber and allowed to adhere to a poly-D-lysine coated coverslip. At the end of the loading period excess dye and loose cells are removed by connection of the chamber to the perfusion apparatus. The chamber is perfused continuously, stimuli and modified salines are then added to the perfusion header. Experiments are recorded by time-lapse acquisition of fluorescence images and analyzed in detail offline, by manually drawing regions of interest. Data are normalized to pre-stimulus levels such that, for each cell (or part of a cell), a graph showing the Ca2+ response as % change in fluorescence is obtained.

Techniques for Imaging Ca2+ Signaling in Human Sperm

Stimulus-evoked [Ca2+]i signals of individual human sperm are assessed. Motile cells are loaded with Ca2+-sensitive fluorescent dye (AM-ester method) and immobilised in a perfusable chamber. Cells are imaged by time-lapse fluorescence microscopy and stimulated via the perfusing medium. Responses of single cells (or regions) are analysed offline using Excel.

Técnicas de imagem Ca 2 + Sinalização no esperma humano

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in ...

Upright Imaging of Drosophila Embryos

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current techniques used to view such processes are somewhat limited. The following protocol describes a new technique for mounting fixed and labeled Drosophila embryos for coronal viewing with confocal imaging. This method consists of embedding embryos between two layers of glycerin jelly mounting media, and imaging jelly strips positioned upright. The first step for sandwiching the embryos is to make a thin bedding of glycerin jelly on a slide. Next, embryos are carefully aligned on this surface and covered with a second layer of jelly. After the second layer is solidified, strips of jelly are cut and flipped upright for imaging. Alternatives are described for visualizing the embryos depending upon the type of microscope stand to be used. Since all cells along the dorsal-ventral axis are imaged within a single confocal Z-plane, our method allows precise measurement and comparison of fluorescent signals without photobleaching or light scattering common to 3D reconstructions of longitudinally mounted embryos.

Upright Imaging of Drosophila Embryos

Here we present a mounting protocol for stained Drosophila embryos in an upright position that allows imaging of cross-sections using Confocal microscopy.

Imagem vertical de Drosophila Os embriões

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

Na imagem in vivo de larvas Drosophila Intact no Sub-celular Resolução

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

Grampo patch e Técnicas de Perfusão para estudar canais iônicos Expresso em Xenopus Oócitos

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

Imagem Alterar Forma Celular em Viver Drosophila Os embriões

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

Imagens ao vivo de Proteínas GFP-rotulados em<em&gt; Drosophila</em&gt; Oócitos

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

Imagens ao vivo de Apuramento celular por apoptose durante<em&gt; Drosophila</em&gt; Embriogênese

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...