Bu eser (Investigación en Fronteras de la Ciencia de Investigación Científica BasicA 82614, 153998, 253549, ve 178359 yanı sıra 118) ve Dirección Genel de Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Meksika) hibe ile desteklenmiştir (DGAPA-UNAM; PAPIIT IN202616, IN203612) asuntos de Kişisel Académico-Universidad Nacional Autonoma de México.

<ol>
	<li>Nelson, D. L., Cox, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lehninger, Principles of Biochemistry. , (2013).</li><li>Jaeger, K. E., Eggert, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipases+for+biotechnology.">Lipases for biotechnology.</a> Curr. Opin. Biotechnol. 13 (4), 390-397 (2002).</li><li>Dowhan, W., Bogdanov, M., Mileykovskaya, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+roles+of+lipids+in+membranes.">Functional roles of lipids in membranes.</a> Biochemistry of Lipids, Lipoproteins and Membranes. , 1-37 (2008).</li><li>Dowhan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+for+membrane+phospholipid+diversity:+why+are+there+so+many+lipids?.">Molecular basis for membrane phospholipid diversity: why are there so many lipids?.</a> Annu. Rev. Biochem. 66, 199-232 (1997).</li><li>De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhizobium+meliloti+mutants+deficient+in+phospholipid+N-methyltransferase+still+contain+phosphatidylcholine.">Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine.</a> J. Bacteriol. 179, 6921-6928 (1997).</li><li>Geiger, O., R&#246;hrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+regulator+gene+phoB+mediates+phosphate+stress-controlled+synthesis+of+the+membrane+lipid+diacylglyceryl-N,N,N-trimethylhomoserine+in+Rhizobium+(Sinorhizobium)+meliloti.">The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti.</a> Mol. Microbiol. 32 (1), 63-73 (1999).</li><li>Klug, R. M., Benning, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+enzymes+of+diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine+biosynthesis+are+encoded+by+btaA+and+btaB+in+the+purple+bacterium+Rhodobacter+sphaeroides.">Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides.</a> Proc. Natl. Acad. Sci. USA. 98 (10), 5910-5915 (2001).</li><li>Zavaleta-Pastor, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sinorhizobium+meliloti+phospholipase+C+required+for+lipid+remodeling+duringphosphorus+limitation.">Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation.</a> Proc. Natl. Acad. Sci. USA. 107 (1), 302-307 (2010).</li><li>Pech-Canul, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FadD+is+required+for+utilization+of+endogenous+fatty+acids+released+from+membrane+lipids.">FadD is required for utilization of endogenous fatty acids released from membrane lipids.</a> J. Bacteriol. 193 (22), 6295-6304 (2011).</li><li>Banerji, S., Flieger, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patatin-like+proteins:+a+new+family+of+lipolytic+enzymes+present+in+bacteria?.">Patatin-like proteins: a new family of lipolytic enzymes present in bacteria?.</a> Microbiology. 150 (Pt 3), 522-525 (2004).</li><li>Sahonero-Canavesi, D. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatty+acid-releasing+activities+in+Sinorhizobium+meliloti+include+unusual+diacylglycerol+lipase.">Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase.</a> Environ. Microbiol. 17 (9), 3391-3406 (2015).</li><li>Fischer, M., Pleiss, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lipase+Engineering+Database:+a+navigation+and+analysis+tool+for+protein+families.">The Lipase Engineering Database: a navigation and analysis tool for protein families.</a> Nucl. Acid. Res. 31 (1), 319-321 (2003).</li><li>Sigrist, C. J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+and+continuing+developments+at+PROSITE.">New and continuing developments at PROSITE.</a> Nucleic Acids Res. 41 (Database issue), D344-D347 (2013).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+Protocol+Plus+Troubleshooting+and+Optimization+Strategies.">Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies.</a> J. Vis. Exp. (63), e3998 (2012).</li><li>Untergasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+-+new+capabilities+and+interfaces.">Primer3 - new capabilities and interfaces.</a> Nucl. Acids Res. 40 (15), e115 (2012).</li><li>Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+T7+RNA+polymerase+to+direct+expression+of+cloned+genes.">Use of T7 RNA polymerase to direct expression of cloned genes.</a> Methods Enzymol. 185, 60-89 (1990).</li><li>Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Experiments in Molecular Genetics. , (1972).</li><li>Desjardins, P., Hansen, J. B., Allen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microvolume+Protein+Concentration+Determination+using+the+NanoDrop+2000c+Spectrophotometer.">Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer.</a> J. Vis. Exp. (33), e1610 (2009).</li><li>Bligh, E. G., Dyer, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+method+for+total+lipid+extraction+and+purification.">A rapid method for total lipid extraction and purification.</a> Can. J. Biochem. Physiol. 37 (8), 911-917 (1959).</li><li>Molecular Dynamics. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Phosphorimager SI User&#180;s Guide. , (1994).</li><li>Dixon, M., Webb, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enzymes: Third Edition. , (1979).</li><li>Rudolph, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression,+characterization,+and+mutagenesis+of+the+Yersinia+pestis+murine+toxin,+a+phospholipase+D+superfamily+member.">Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member.</a> J. Biol. Chem. 274 (17), 11824-11831 (1999).</li><li>Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+analysis+of+a+novel+lipolytic+enzyme+YvdO+from+Bacillus+subtilis.">Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis.</a> Biosci. Biotechnol. Biochem. 74 (4), 701-706 (2010).</li><li>Peppelenbosch, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinome+profiling.">Kinome profiling.</a> Scientifica (Cairo). , (2012).</li><li>Manafi, M., Kneifel, W., Bascomb, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorogenic+and+chromogenic+substrates+used+in+bacterial+diagnostics.">Fluorogenic and chromogenic substrates used in bacterial diagnostics.</a> Microbiol. Rev. 55 (3), 335-348 (1991).</li><li>Kuznetsova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+genomics:+Application+of+general+enzymatic+screens+to+discover+new+enzymes.">Enzyme genomics: Application of general enzymatic screens to discover new enzymes.</a> FEMS Microbiol. Rev. 29 (2), 263-279 (2005).</li><li>Scopes, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Protein Purification, Principles and Practice. , (2010).</li><li>Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphatidylcholine+biosynthesis+and+function+in+bacteria.">Phosphatidylcholine biosynthesis and function in bacteria.</a> Biochim. Biophys. Acta. 1831 (3), 503-513 (2013).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Son 20 yılda, birçok organizmanın genomu dizilimi edilmiş ve genom dizisi verilerin bir zenginlik üretilen olmasına rağmen, fonksiyonel yorumlama geride ve bu nedenle genom fonksiyonunun anlayışımızı engellemektedir edilir. genomları Gen fonksiyonları genellikle bilinen işlev veya korunmuş motiflerinin oluşum genlerine benzerliğine dayalı atanır. Bununla birlikte, belirli bir genin tam işlevi genellikle bilinmez. Özellikle, enzimler için yapısal genler nedeniyle kolaylıkla en enzimler iki yüzeyler ve iki ürünü içeren karmaşık reaksiyonları katalize gerçeğine omic tekniklerle keşfedilmeyi olamaz öngördü. Halen, en azından bir alt-tabaka sabittir ve burada değiştirilebilir burada enzim grupları için alt-tabaka özgüllükleri keşfetmek için daha uygundur görünmektedir. Örneğin, ökaryotlar içindeki proteinlerin en fosforillenme motifleri bilinen kinazlar için konsensüs peptidler peptid AR oluşturmak için bir katı destek üzerinde tespit edilmiştir edilirışınlar. Bir kinome profilinin kurulması izin belirlenebilir Bu diziler ve radyo-etiketlenmiş ATP, alt-tabaka özgüllükleri ile bir organizmanın farklı kinazlann aktivitesi seviyelerinin kullanılması ve alt tabakayı oluşturan 24 özgüllükler. Hidrolazlar bir alt tabaka, su, sabit fakat hangi (diğer) alt tabakanın hassas doğası genellikle bilinmemektedir hidroliz edilecek olan enzimlerin başka büyük bir grup oluşturur. Yeni bir enzim için optimum deney koşullan ya bilinmektedir değildir aslında, bir çok değişkenli problem yeni bir enzim etkinliğinin bulgulanması dönüştürür. Bu nedenle enzimin en iyi şekilde çalışır hangi koşullar altında tanımlamak amacıyla hidroliz edilecek alt tabakayı düzeltmek mümkün yardımcı olabilir. Mevcut yazıda, prospektif (fosfo) için Tayin koşullarının optimize edilmesi tarif bilinmiyor alt-tabaka özgüllükleri olan lipazlar ve yeniden doğal alt-tabaka için arama, bu optimum koşulların kullanılması nasıl ayrıntılıprospektif (fosfo) lipaz. Bu tekniğin anlamı bir ölçüde doğal substratlar taklit florojenik veya kromojenik yapay substratlar, hidrolizi, spektrometri 25 ile takip edilebilir aslında oluşur ve bu deneyler, büyük ölçekli kolay uygulanabilir olduğu 26 inceler. Ötürü, bu gibi tahliller duyarlılık ve tepkisini izlemek için basitlik için, kolay, belirli bir enzim için optimize edilebilir. Açıkçası, yapay yüzeyler için bir daha az elverişli kinetik sabitleri bekliyor olabilir (yani, yüksek K M, düşük k kedi) doğal yüzeylerde 1,21 için daha spesifik bir enzim için. Ancak uygulamada, yapay substratlar kolay kullanılabilirliği ve tespit dezavantajları telafi genellikle daha fazla enzimin bütün grupları için (kötü) alt tabakalar olarak işlev yapar. (Yapay alt tabaka ile) çalışmak için bir enzim için koşullar karşılaşmıştır sonra, Natur ile yapacaktırgibi diğerleri fizyolojik / alt-tabaka. Potansiyel lipit substratların hazırlanması ve izole edilmesi zahmetli ve zaman alıcı olabilir, bir enzim birleştiren ve değerli substratlar ile inkübe zaman çalışmaya hazır olduğunu güvence olması önemlidir. Önemli bir şekilde, ilk olarak bir enzim çalışması için koşulları optimize prosedürü, yeni bir (fosfo) lipaz fizyolojik alt-tabaka daha hızlı bir olanak sağlayacak. Kavramının bir kanıtı olarak, başarılı bir lipaz SMc00171, SMc00930 ve SMc01003 8,11 substrat özgünlükleri karakterizasyonu için bu yöntemi kullanmışlardır. Buna karşılık, (fosfo) lipaz etkinlikleri için tahliller oluşturulması pek çok geleneksel, alternatif yöntemler alt-tabaka ve ürün, daha önce bilinen reaksiyonlarla içerir. Açıktır ki, tahliller modifikasyonları işaretlenmiş yapay substratlar, kromojenik veya başka türlü varyasyonu, diğer florojenik kullanımını içerebilir uygun enzim etkinliği tespit etmek içinenzim konsantrasyonu, tipi ve tampon konsantrasyonu ya da başka katkı maddeleri (örneğin, deterjan veya iki değerli katyonlar). Hiçbir enzim aktivitesi yapay substratları ile tespit edilirse, ilgili enzim sadece bu alt tabaka ile işe yaramayabilir, ama bu gibi durumlarda sorun giderme kesinlikle enzim aktivitesi bozulmadan korumak için gerekli olabilir tüm önlemler alınmıştı güvence var içermelidir 27 (gerekirse örneğin 4 ° C&#39;de hücre içermeyen özütler veya kullanıma kadar düşük sıcaklıklar ve depolanması, için hücre içermeyen özütler proteaz inhibitörlerinin kokteyl ilave ilgi enzimin proteolitik bozulmasını önlemek için). Bu yazıda sunulan teknik sınırlamaları katalizli reaksiyon yanı sıra 1 olacak suni substrat ve doğal alt tabaka Biyoenerjetiğin birbirlerinden ve sonuç olarak farklı olmasından kaynaklanmaktadır. çeşitli parEnzim faaliyetin en iyi koşullar için metreler, doğal alt-tabaka için, aynı zamanda kurulmalıdır (güç tampon, tampon türü pH değiştirilerek, örneğin Triton X-100, yokluğunun ya da farklı bivalent katyonlar varlığında olarak NaCl ve deterjan konsantrasyonu), onlar söndürmeden olabilir yapay alt tabaka için karşılaşılan en uygun şartlarda biraz farklı olması. Diğer önemli bir sınırlama, muhtemelen Tüm (fosfo) lipazlar yapay kromojenik alt-tabakaların kullanımı ile tespit edilebilir olmasıdır. Örneğin ester yüzeylerde yapay p-nitrofenil kalıntısı sadece çok hantal, ya da böyle bir alt tabaka, bir enzimin aktif sitesine erişim alabilirsiniz engelleyen diğer kimyasal özelliklerini ortaya çıkarabilir. Bu DAG lipaz SMc01003 farklı zincir uzunlukları 11 tüm p-nitrofenil ester, alt-tabakalar ile, düşük aktivitelerini gösterdiği tespit edilmiştir. DAG SMc01003 ve doğal substrat olan bilgi birikimi ile DAG bir rel vardırgliserol oluşan lişmekte küçük polar baş grup, sadece 11 kadarı hantal p-nitrofenil kalıntısı sadece SMc01003 aktif sitesine kolay erişim için çok büyük olduğunu kolayca hayal olduğunu. Bununla birlikte, SMc01003 p-nitrofenil esterler iyi alt tabakalar değil neden molekül detayları bu noktada bilinmemektedir. protokolü içinde kritik adımlar çalışılan enzim ilgili alt tabakaya erişimi sağlamak için alınan tüm hükümler içermektedir. Örneğin, fizyolojik sfingosinin arayışında, lipid substratı bir çözünmüş formda sağlanan çok önemlidir. Bu enzim tahlilleri ayarlarken Bu nedenle, (protokol 5&#39;te tarif edilmiştir), genellikle metanol karışımları içinde çözülmüş lipidik substratlar: kloroform örneğin, bir deterjanın sulu çözeltisi ile karıştırılmalıdır, Triton X-100, kesilmeden önce kurutulması azot gazı ile karışımıdır. Bu prosedür sağlar, bu diğer Ingré ekledikten sonraDeney için tartarken potansiyel lipid sübstratı deterjan miseller ve tahlil sırasında enzim için, erişilebilir şekilde yerleştirilmiştir. Prensip olarak, burada sunulan teknik yeni (fosfo) lipaz bulunması ve bunların doğal substratların tanımı için gelecekte yaygın olarak uygulanabilir olmalıdır. teknik Hidrolazların diğer sınıflar için kolayca genişletilebilir, ama onların katalitik döngüsünü tamamlamak için iki, genellikle bilinmeyen, substratlar gerektiren yeni enzimler için yapay substratları ile deneyleri geliştirmek için daha karmaşık olabilir. tahmin (fosfo) lipaz veya doğru substrat ne bilinir fosfatazlar ne enzim iyi çalıştığı tahlil koşulları için. Bu nedenle, bu çalışma için yararlı olabilir örneğin tat p-nitrofenil-ihtiva eden bileşikler (s-nitrofenil fosfat, bis- p-nitrofenil fosfat gibi yapay bileşikleri, bir pil bir bileşik olup, <em&gt; p-nitrofenil dekanoat, ya da p-nitrofenil palmitat), substrat olarak işlev olabilir. Yapay yüzeylerde ile ilk enzim faaliyetlerinin keşif SMc01003 bir DAG lipaz 11 olduğunu, SMc00171 PC özgü fosfolipaz C 8 olduğunu çözmek için yol açmıştır, ve SMc00930 bir hidrolaz 11 gibi davranan hangi şartlar altında tanımlamak için yardımcı olmuştur. Açıkçası, SMc00930 doğal substrat şu anda hala bilinmeyen ve SMc00930 ve SMc01003 fizyolojik bağlamları hala çözülecek olan. Bu nedenle, bir tahmin lipaz için bir fizyolojik fonksiyonu öneren görevi zordur ve her zaman hemen başarı ile bir araya geldi değil. tahmin edilen lipaz geninin eksik mutantlar kullanılarak ve ilgili vahşi tip suşu ile karşılaştırılması lipaz protokolünün bir parçası 4) &#39;de ileri sürülmüştür doğal suş arka özgüllük ile hareket olduğunu bulmuşlardır verebilir. Açıkçası, yeni bir lipaz aktivitesi sh iddiasıBelirli bir alt tabaka tanımlanan ürünler haline hidroliz yoluyla dönüştürülür in vitro kanıtlarla desteklenmelidir ould. Bazen öne fizyolojik fonksiyonu metabolik yollarda boşlukları doldurmak ya da üreten organizmanın fizyolojik davranışlarını açıklamak, ancak diğer durumlarda orada sadece hala bazı faaliyetler mantıklı yeterli biyokimyasal bilgi olabilir de olmayabilir de. Yaptığımız çalışmalar sırasında, biz daha karmaşık lipit döngüleri bir oyuncu dönüştürerek, bazı durumlarda, bunları aşağılayıcı bakterilerin içsel kutup membran lipitleri hareket enzimleri tespit ve. Örneğin, yeni bilgi birleştirerek SMc00171 önceden var verilerle, büyüme fosfor sınırlayıcı koşullar altında uyarılan bir PC özgü fosfolipaz C (PLCP) 8 olduğunu, bir çok çevre proteobakteride var olabilecek bir roman DAG döngüsü postulate edebilirsiniz bu, fosfor büyümesi sınırlayıcı olduğunda, fosfor içermeyen membran lipidlerinin oluşumuna neden olur. Contr içindefosfor kaynakları bol olduğunda ast, DAG fosfatidik asit, böylece bu lipit döngüsünü kapatarak, de novo fosfolipid biyosentezini giren ve çoğunlukla (glisero) fosfolipidler zarında 8,28 mevcut sağlamak için rephosphorylated edilir.

Bu tür triaçilgliserol ve (glisero) fosfolipidler gibi gliserol tabanlı lipidler önemli oluşturmaktadır ve muhtemelen en iyi bilinen lipit sınıfları 1. Triaçilgliseroller (TAG) yağlar ya da genellikle depolama lipidler olarak işlev yağlar, ve bu nedenle potansiyel enerji ve karbon kaynağı olarak bulunmaktadır. TAG&#39;lar sık ​​sık dış TAG sindirmek ve karbon kaynağı olarak kullanılabilir hale getirmek için üreten organizma tarafından salgılanan lipaz tarafından bozulmuş olabilir. Ayrıca, lipazlar yaygın nedeniyle önemli biyo teknolojik uygulamalarda 2 yıl içinde incelenmiştir. Nedeniyle amfifilik doğası ve onların yakın silindirik şekil, (glisero) fosfolipidler sergi zar oluşturan özellikleri ve genellikle iki katmanlı membranın 3 ana lipidik bileşenlerini teşkil edecek. Bu bakteri Escherichia coli, sadece üç ana kafa grubu varyantları, fosfatidilgliserol (PG), kardiyolipin (CL) ve phosphatid basit mikroorganizmalardabunlardan biri, her biri farklı moleküler türler 4 çok sayıda bir sn farklı yağlı asil zincirleri önemli sayıda -1 ya da sn -2 pozisyonu veren artış ile ikame edilebilir bilmelidir, ancak ylethanolamine (PE), karşılaşılan . Diğer bakteriler diğer fosfolipidler ek olarak veya bunun yerine sahip olabilir. Örneğin, Sinorhizobium meliloti, baklagil yonca (Medicago sativa), bir azot bağlayıcı kök nodül simbiyoz oluşturmak için güçlü bir toprak bakterisi, ikinci bir zitteriyonik fosfolipid, fosfatidilkolin (PC), PE ilave olarak ihtiva eden 5 ile. Ayrıca, lipit içermeyen, fosfor veya gliserol, hücre zarının amfifilik ve form parçası olabilir. Örneğin, fosfor sınırlayıcı büyüme koşullarına bağlı olarak, S. meliloti (glisero) Fosfolipidler, büyük ölçüde, yani sulfolipidlerin, ornitin lipidler ve diacylglyceryl trimethylho fosfor içermeyen membran lipidleri ile ikame edilmektedirmoserine (DGTS) 6. Bakterilerde DGTS iki aşamalı yolun 7 diasilgliserole (DAG) teşekkül eden, fakat DAG üretimi için bir kaynak belli değildi edilir. Darbe kovalayıcı deneyler bilgisayar fosfor sınırlayıcı koşullar altında meydana geldiği ve DAG ve fosfokolin haline PC dönüştürmek olan DGTS 8 için bir ön-madde olarak ve bir fosfolipaz C (PLCP, SMc00171) tanımlayabilir Bu yazıda tarif edilen metodoloji kullanılarak düşündürmektedir 8. Ayrı bir çalışmada, biz keşfettik bir açil-KoA sentetaz (fadd) S. -açıklı mutant büyüme 9 sabit faz girerken melılotı veya Escherichia coli serbest yağ asitleri birikmiş. Bu yağlı asitler, membran lipitleri elde edilecek gibi görünse de, serbest yağ asitleri ya da bunların serbest bırakılması enzim (ler) için kesin bir kaynak bilinmemektedir. Yine, bu stratejiyi uygulayan bu yazının ana hatlarıyla, iki patatin gibi 10 (fosfo) lipazlar (S. serbest yağ asitleri oluşmasına katkıda SMc00930 ve SMc01003) meliloti 11 tahmin edildi. Şaşırtıcı bir şekilde, SMc01003 o gliserol ve serbest yağ asitleri 11 nihayet monoaçilgliserol ve dönüştürme substrat olarak DAG kullanıldı. Bu nedenle, SMc01003 DAG lipazı (DGLA) &#39;dir. Algoritmaları bir dizi potansiyel (fosforo) tahmin etmek için mevcut olmakla beraber 12,13, lipazlar onların hassas fonksiyon ve fizyolojik rolü genellikle bilinmemektedir. Burada klonlamak, bir protokol anahat ve tahmin veya potansiyel (fosfo) lipazlar aşın. Bu el yazması enzim tahlilleri geliştirilmiş ve yapay kromojenik maddeleri kullanarak aşırı (fosfo) lipaz için optimize edilebilir açıklar. Bu bulguların mikrobiyal fizyoloji anlayışımızı zenginleştirecek nasıl optimize edilmiş bir enzim testi ile gerçek (fosfo) lipaz substrat karşılaştı olabilir ve nasıl örnekler sağlar.

<table><tbody><tr><td>Chloroform</td><td>JT Baker</td><td>9180-03</td><td>TLC analysis &amp;amp; Lipid extraction</td></tr><tr><td>Methanol</td><td>JT Baker</td><td>9070-03</td><td>TLC analysis &amp;amp; Lipid extraction</td></tr><tr><td>Acetic Acid</td><td>JT Baker</td><td>9507-05</td><td>TLC analysis &amp;amp; Lipid extraction</td></tr><tr><td>Hexanes</td><td>JT Baker</td><td>9309-02</td><td>TLC analysis &amp;amp; Lipid extraction</td></tr><tr><td>Diethylether</td><td>Sigma</td><td>32203</td><td>Enzymatic assays</td></tr><tr><td>bidistilled water</td><td>&amp;nbsp;ANY</td><td>&amp;nbsp;NA</td><td>Enzymatic assays</td></tr><tr><td>Tris Base</td><td>Sigma</td><td>T-1503</td><td>Enzymatic assays</td></tr><tr><td>HCl</td><td>Baker</td><td>9535-02</td><td>Enzymatic assays</td></tr><tr><td>NaCl</td><td>Baker</td><td>3624-01</td><td>Enzymatic assays</td></tr><tr><td>Triton X-100</td><td>Sigma</td><td>X-100</td><td>Enzymatic assays</td></tr><tr><td>LB broth</td><td>ANY</td><td>NA</td><td>Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water</td></tr><tr><td>tryptone</td><td>Becton Dickinson and Company</td><td>211705</td><td>Bacterial growth</td></tr><tr><td>yeast extract</td><td>Becton Dickinson and Company</td><td>212750</td><td>Bacterial growth</td></tr><tr><td>TY broth</td><td>ANY</td><td>NA</td><td>Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl&lt;sub&gt;2&lt;/sub&gt;&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O per liter of bidistilled water</td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Baker</td><td>1332-01</td><td>Enzymatic assays</td></tr><tr><td>isopropyl-&amp;beta;-D-thiogalactoside (IPTG)</td><td>Invitrogen</td><td>15529-019</td><td>Bacterial growth</td></tr><tr><td>Diethanolamine</td><td>Sigma</td><td>D-8885</td><td>Enzymatic assays</td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>221279</td><td>Enzymatic assays</td></tr><tr><td>Phospholipase A&lt;sub&gt;2&lt;/sub&gt; snake venom</td><td>Sigma</td><td>P0790</td><td>Enzymatic assays</td></tr><tr><td>Phospholipase C &lt;em&gt;Clostridium perfringens&lt;/em&gt;</td><td>Sigma</td><td>P7633</td><td>Enzymatic assays</td></tr><tr><td>Bis-&lt;em&gt;p&lt;/em&gt;-nitrophenyl phosphate</td><td>Sigma</td><td>07422AH</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl stearate</td><td>Sigma</td><td>N3627</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl dodecanoate</td><td>Sigma</td><td>61716</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl decanoate</td><td>Sigma</td><td>N0252</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl palmitate</td><td>Sigma</td><td>N2752</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl butyrate</td><td>Sigma</td><td>N9876</td><td>Enzymatic assays</td></tr><tr><td>&lt;em&gt;p&lt;/em&gt;-nitrophenyl octanoate</td><td>Sigma</td><td>21742</td><td>Enzymatic assays</td></tr><tr><td>Acetic Acid, sodium salt [1-&lt;sup&gt;14&lt;/sup&gt;C]</td><td>Perkin Elmer</td><td>NEC084</td><td>Bacterial growth</td></tr><tr><td>dimethylsulfoxide (DMSO)</td><td>JT Baker</td><td>9224-01</td><td>Enzymatic assays</td></tr><tr><td>Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets.</td><td>Merck</td><td>105547</td><td>TLC analysis &amp;amp; Lipid extraction</td></tr><tr><td>Spectrometer UV/VIS Lambda 35</td><td>Perkin Elmer</td><td>NA</td><td>Enzymatic assays</td></tr><tr><td>Storm 820 Phosphorimager</td><td>Molecular Dynamics</td><td>NA</td><td>Photostimulable Luminescence scanner&amp;nbsp;</td></tr><tr><td>Multipurpose Scintillation Counter</td><td>Beckman Coulter</td><td>NA</td><td>Radioactivity Quantification</td></tr><tr><td>French Pressure Cell</td><td>ThermoSpectronic</td><td>NA&amp;nbsp;</td><td>Breakage of cells</td></tr><tr><td>chromatography paper 3MM Chr</td><td>Whatman</td><td>3030917</td><td>TLC analysis</td></tr><tr><td>&lt;em&gt;Sinorhizobium meliloti&lt;/em&gt; 1021our</td><td>reference 11</td><td></td><td>studied strain</td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt; BL21 (DE3) pLysS Competent cells</td><td>Novagen</td><td>69451</td><td>protein expression strain</td></tr><tr><td>pET9a vector</td><td>Novagen</td><td>69431</td><td>protein expression vector</td></tr><tr><td>pET17b vector</td><td>Novagen</td><td>69663</td><td>protein expression vector</td></tr><tr><td>sterile polystyrene round-bottom tube (14 ml) Falcon</td><td>Becton Dickinson</td><td>352057</td><td>radiolabeling of bacterial cultures</td></tr><tr><td>polypropylene microcentrifuge tubes (1.5 ml)</td><td>Eppendorf</td><td>30125.15</td><td>Enzymatic assays</td></tr><tr><td>1,2-dipalmitoyl-&lt;em&gt;sn&lt;/em&gt;-glycerol</td><td>Sigma</td><td>D9135</td><td>lipid standard</td></tr><tr><td>L-&amp;alpha;-phosphatidylcholine, dipalmitoyl</td><td>Sigma</td><td>P6267</td><td>lipid standard</td></tr><tr><td>DL-&amp;alpha;-monopalmitin</td><td>Sigma</td><td>M1640</td><td>lipid standard</td></tr><tr><td>palmitic acid</td><td>Sigma</td><td>P0500</td><td>lipid standard</td></tr></tbody></table>

defining substrate specificities for lipase and phospholipase candidates

Mikroorganizmalar organizma için dış yüzeyler kullanılabilir hale getirmek için salgılanan (fosfo) lipaz çok geniş bir yelpaze oluşturur. Alternatif olarak, diğer (fosfo) lipazlar fiziksel üreten organizma iç lipidlerin ciro sebep olması ve sıklıkla, hücre membranlarının bir biçimlenme sebebiyet veren ile ilişkili olabilir. potansiyeli (fosfor) lipazlar gen / protein dizisi mevcuttur algoritmaları bir dizi ile tahmin edilebilir, ancak, enzim aktiviteleri, alt-tabaka özgüllükleri ve potansiyel fizyolojik fonksiyonları deneysel kanıtı sıklıkla elde edilmemiştir. Bu yazıda bilinmiyor alt-tabaka özgüllükleri ve nasıl bir ilgili (fosfo) lipaz doğal alt-tabaka için arama, bu optimum koşulların kullanılması ile potansiyel (fosfo) lipazlar için Tayin koşullarının optimize edilmesi açıklanmaktadır. Küçük tespit etmek için yardımcı, p-nitrofenil türevleri gibi yapay kromojenik substratlar, olabilir kullanmaStandart koşullar altında bir tahmin (fosfo) lipaz için enzimatik aktivite. Böyle küçük bir enzimatik aktivite karşılaşmıştır, bir enzim tahlili ayrı parametre ile yapay alt tabaka daha verimli bir hidrolizi elde etmek için değiştiirlebilir. bir enzim çalışır koşulları tespit ettikten sonra, potansiyel, doğal substratlar, çeşitli tenzillerinden tat kromatografik yöntemler kullanılarak takip edilebilir bir işlem test edilmelidir. Yeni enzimler için alt-tabaka özgüllükleri tanımı, genellikle daha sonra deneysel olarak test edilebilir, bu enzimlerin, potansiyel bir fizyolojik rolü için hipotez içerir. Bu yönergeleri izleyerek, biz büyüme fosfor sınırlayıcı koşullara bağlı bakteri Sinorhizobium meliloti membranların remodeling için önemli bir adım olarak, fosfokoline ve diaçilgliserol için fosfatidilkolin bozan bir fosfolipaz C (SMc00171) tespit başardık. İki patatin- tahmin içinAynı organizmanın fosfolipaz (SMc00930 ve SMc01003) gibi, biz onların alt tabaka özgüllükleri yeniden tanımlamak ve SMc01003 bir diaçilgliserol lipaz olduğunu açıklamak olabilir.

Bis p-nitrofenil Fosfat PC özgü Fosfolipaz C SMc00171 Faaliyet E. elde edilen hücre içermeyen özütler E. coli BL21 (DE3) &#39;smc00171 oluşan s -np ölçme bir spektrofotometrik enzimatik analiz kullanılarak, bis- p-nitrofenil fosfat esterleri hidrolize etme kabiliyetleri açısından incelendi ifade vardı pLysS, x. Resim hidrolitik aktivitesi E. elde edilen hücresiz ekstrelerinde mevcuttu p-nitrofenil fosfat alt tabakası olarak kullanılmıştır bis zaman (veriler gösterilmemiştir) E. coli BL21 (DE3) pLysS X boş pET9a vektörü barındıran. Oluşan s -np için zaman içerisinde SM sahip pLysS x, E. coli BL21 (DE3) hücre içermeyen ekstresi miktarı kuvvetli bir bağımlılık (olduğunu göstermektedirc00171) olarak ifade edilmiştir deneyi (Şekil 2A) ilave edildi. Oluşan s -np ürününün miktarı enzim konsantrasyonu sadece bağlı olacaktır ise, belirli bir süre sonra oluşan enzim (protein) arasında doğrusal bir ilişki konsantrasyonu kullanılabilen ve ürün gözlenmelidir. Açıktır ki, bu E. elde edilen hücre içermeyen ekstreler için geçerli değildir E. coli BL21 (DE3) &#39;smc00171 ifade olan pLysS (Şekil 2B) x. Protein konsantrasyonu 21 enzim etkinliğinin bir üstel bağlı bir çok nedeni olabilir, ancak sık sık sebebi enzim içeren bir protein ekstresi seyrelmesi üzerine, özü diğer bileşenler, enzim aktivitesi, örneğin, potansiyel kofaktörler için sınırlayıcı edilebilir olmasıdır yanı sıra seyreltilir. Bu gibi durumlarda, beklenmedik bir şekilde, düşük enzim aktiviteleri seyreltilmiş hücre içermeyen özütler kayıtlıdır. Enzim tahlilinde MnCl2 3 mM&#39;lik bir doyma konsantrasyonunu dahil ederek, s<html> Belirli bir zaman yalnızca enzim miktarına bağlıdır sonra oluşan -np ürün MnCl2 E. hücresiz özütlerinde SMc00171 aktivitesi için sınırlayıcı bir bileşen olduğunu belirten (veriler gösterilmemiştir) ilave E. coli. <img alt="şekil 2" src="/files/ftp_upload/54613/54613fig2.jpg" /> Yapay alt tabaka bis p-nitrofenil fosfat kullanılarak SMc00171 (fosfolipaz) aktivitesinin Şekil 2. belirlenmesi. S -np oluşumu için zaman süreci, 15 ug / ml n, 10 ug / ml ● (hücresiz protein özleri kullanılarak olarak gösterilmektedir ▲ SMc00171 (ifade edilmiş olan A). SMc00171 ifade edilmiş olan hücresiz protein özleri farklı miktarlarda (B) inkübasyon 40 dakika sonra, oluşan p -np 20 ug / ml). Hata çubukları standart sapmayı belirtir..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg &quot;target =&quot; _ blank &quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız. Farklı zincir uzunluğu p-Nitrofenil Asil Esterlerinin Fosfolipazlar SMc00930 ve SMc01003 Öngörülen Patatin benzeri faaliyetleri E. smc00930 ya smc01003 sentezlenmesi sonra E. coli BL21 (DE3) pLysS, hücre içermeyen özütler elde edilmiş ve p-nitrofenil yağlı asil esterler hidrolize etme kabiliyetleri açısından incelenmiştir x. Enzimatik Deney sırasında oluşan s -np bir spektrofotometresinde tayin edildi. Küçük hidrolitik etkinlikleri E. elde edilen hücresiz ekstrelerinde mevcuttu differe coli BL21 (DE3) boş pET17b vektörü ile pLysS x (Tablo 4) p-nitrofenil asil esterlernt zincir uzunlukları substrat olarak istihdam edildi. Smc01003 ifade edildiğinde, elde edilen ekstreler, farklı zincir uzunluklarına p-nitrofenil esterleri artmış hidroliz gösterdi. SMc01003 orta zincirli p-nitrofenil dekanoat yanı sıra uzun zincirli p-nitrofenil palmitat ve p-nitrofenil stearat (Tablo 4) bozulmuş. SMc01003 S. uzun zincirli serbest yağlı asitlerin formasyonu için önemli bir etken olduğu gibi meliloti durağan faz 11 sırasında, SMc01003 uzun zincirli p-nitrofenil asil esterler (Tablo 4) göre daha orta zincir üzerinde eşit olarak hareket görülmesi şaşırtıcı idi. Beklenmedik bir şekilde, SMc01003 da p-nitrofenil butirat ya da p-nitrofenil oktanoat kısa zincirli alt tabakalar üzerinde hareket eder (veriler gösterilmemiştir). Bununla birlikte, bu ikinci alt-tabakalar, aynı zamanda, E., hücre içermeyen özütler mevcut faaliyetleri tarafından parçalanan E. coli (yani, boş vect barındıranya da herhangi bir ilave gen ve kısa zincirli substratlar (C4) ifade etmeden pET17b), alt-tabaka yarısının E. tarafından parçalanır E. coli iç enzimler (veriler gösterilmemiştir). Açıkçası, SMc01003 SMc01003, kısa, orta ve uzun zincirli yüzeylerde eşit derecede iyi çalışır olup olmadığını netleştirmek için saflaştırılmış gerekmektedir. Genel olarak, p-nitrofenil asil esterler SMc01003 gerçeklik bir DAG lipaz 11 olduğunu bilerek anlaşılır olabilir SMc01003 için iyi yüzeyler olmak değil gibi görünüyor. Smc00930 ifade edilmiş olan hücre içermeyen özütler, p-nitrofenil esterleri (Tablo 4) çok daha yüksek enzim aktivitelerini göstermektedir. (- 1 mg protein - 1 spesifik aktivitesi 5.5 mmol NP dakika) açık bir şekilde p-nitrofenil palmitat olsa da, SMc00930 farklı zincir uzunlukları (C10, C12, C14, C16 ve C18) p-nitrofenil asil esterler hidrolize edebilmektedir SMc00930 en iyi alt-tabaka. Bugüne kadar, physioloSMc00930 için jik alt-tabaka olarak bilinmemektedir. İster Polar Lipidler keşfetme Öngörülen (Phospho) lipaz için Substratlar olarak işlev Can A (fosfo) lipaz enzimatik deney, yapay substratlar, radyo-etiketli lipit karışımları veya saf lipidlerle optimize edildikten sonra, potansiyel alt-tabakalar olarak test edilebilir. Optimize edilmiş koşullar altında 14 C-etiketli PC ile hücre içermeyen özütler SMc00171 içeren tahlil zaman, SMc00171 DAG, kütle spektrometrik çalışmaları 8 ile doğrulandı sonucu PC bozunduğunu gösterebilir. SMc00171 Ayrıca büyüme fosfor sınırlandığı koşullar altında uyarılır, bir bilgisayar özgü fosfolipaz C (PLCP) 8 olarak hareket eden, bu nedenle fosfokoline 32 P-etiketli PC çözülür ve. Ne zamantahlil SMc00930- ya SMc01003 içeren optimize edilmiş koşullar altında 14 C veya 32-işaretli toplam polar lipidler ile hücre içermeyen özütler, biz fosfolipidlerin yok p-nitrofenil asil esterler görev koşullar altında SMc00930 ya SMc01003 dolayı derece kaybeder ve olduğunu gösterebilir olarak 11 alt tabakalar. Bunun aksine, yılan zehirinden bir ticari bir fosfolipaz A2 fosfolipid 11 böyle bir karışım indirgeme edebildi. Bu sonuçlar şaşırtıcıdır ve hem de beklenmedik, SMc00930 ve SMc01003, fosfolipazlar gibi patatin olarak tahmin edildi. SMc00930- ya SMc01003 içeren optimize edilmiş koşullar altında 14 C-etiketli diaçilgliserol (DAG) ile hücre içermeyen özütler, biz DAG SMc00930 veya E. hücre içermeyen özütler tarafından bozulmaz gösterilebilir tahlil zaman E. coli, SMc01003 DAG çözülür ve serbest yağ asitleri gibi göç bileşikler oluşturmaktadır buna karşın (Şekil<html> 3). Son zamanlarda biz SMc01003 DAG düşürebilir veya gliserol ve serbest yağ asitleri 11 (Şekil 4) monoaçilgliserol bir DAG lipaz olarak hareket ettiğini gösterebilir. <img alt="Şekil 3," src="/files/ftp_upload/54613/54613fig3.jpg" /> Şekil 3. SMc01003 diaçilgliserol düşürür. E. hücre içermeyen özütler pLysS SMc01003, SMc00930 ifade veya boş pET17b vektörü içeren, veya tampon x coli BL21 (DE3) 24 saat için (S. meliloti de elde edilmiş) 14 C-DAG ile inkübe edilmiştir. ilgili kuluçka süresi sonunda, radyo-etiketli lipitlerin ekstre edildi ve nötr kutupsal lipitler ayrılması için mobil faz (4.3.2) ile 1D-TLC ile ayrıldı. FA, yağ asitleri; DAG, diaçilgliserol. Bu rakam [Sahonero-CANAVESI ve ark. 2015] 11 modifiye edilmiştir.3large.jpg &quot;target =&quot; _ blank &quot;&gt; bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız. <img alt="Şekil 4," src="/files/ftp_upload/54613/54613fig4.jpg" /> Şekil 4. Enzimatik diaçilgliserol lipaz DGLA (SMc01003) fonksiyonu. Diaçilgliserol (DAG) lipaz SMc01003 monoaçilgliserol ve bir yağ asidi için DAG düşürür ve daha sonra gliserol ve başka yağ asidi daha da monoaçilgliserol alçaltır. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54613/54613fig4large.jpg" target="_blank">Bu büyük halini görmek için tıklayınız rakam.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> oligonükleotid isim </td><td colspan="3"> Sıra (5&#39;-3 &#39;) </td><td> Gen ilgi </td><td> Enzim kısıtlama Site eklendi</td><td> Vektör ifadesi için </td></tr><tr><td> oLOP149 </td><td colspan="3"> AGGAATA CATATG CTGAACTGGACATTCACG </td><td> smc01003 </td><td> Nde </td><td> pET17b </td></tr><tr><td> oLOP150 </td><td colspan="3"> ACGG CTCGAG TCAACGGGACAGCGGTTC </td><td> smc01003 </td><td> Xhol </td><td> pET17b </td></tr><tr><td> oLOP151 </td><td colspan="3"> AGGAATA CATATG ACGGAGGTGGCGATGG </td><td> smc00930 </td><td> Nde </td><td> pET17b </td></tr><tr><td> oLOP152 </td><td colspan="3"> AAA GGATCC TTATATCCCTTTCCTCCACC </td><td> smc00930 </td><td> BamHI </td><td> pET17b </td></tr><tr><td> cgpho171u </td><td colspan="3"> AGCT CATATG GCGGCGGCATCGGCACCCCACAG </td><td> smc00171 </td><td> Nde </td><td> pET9a </td></tr><tr><td>cgpho171d </td><td colspan="3"> ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC </td><td> smc00171 </td><td> BamHI </td><td> pET9a </td></tr><tr><td colspan="7"> Kalın harfler kısıtlama siteleri gösterir. </td></tr></tbody></table> Yükseltmek ve klonlamak için kullanılan Tablo 1. Oligonükleotidler pET17b ya pET9a vektörüne fosfo (lipaz) genleri tahmin. Primer oligonükleotidler tarif yazılımı 15 ile tasarlanmıştır. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td></td><td></td><td> SMc00171 için tahlil </td><td> SMc01003 için tahlil </td><td> SMc00930 için tahlil </td></tr><tr><td> Stok </td><td> Bileşen </td><td></td><td></td><td></td></tr><tr><td><stRong&gt; 2M </td><td> Tris-HCI, pH 8.5 </td><td></td><td></td><td> 25 ul </td></tr><tr><td> 2M </td><td> Tris-HCI, pH 9.0 </td><td></td><td> 25 ul </td><td></td></tr><tr><td> 1M </td><td> dietanolamin-HCI, pH 9.8 </td><td> 50 ul </td><td></td><td></td></tr><tr><td> 1M </td><td> NaCI </td><td> 40 ul </td><td> 150 ul </td><td> 150 ul </td></tr><tr><td> % 1 </td><td> Triton X-100 </td><td></td><td> 200 ul </td><td> 200 ul </td></tr><tr><td> 50 mM </td><td> p-nitrofenil palmitat </td><td></td><td> 12.5 ul </td><td> 12.5 ul </td></tr><tr><td> 200 mM </td><td> bis p-nitrofenil fosfat, </td><td> 2.5 ul </td><td></td><td></td></tr><tr><td> hücresiz özü (1 mg protein,N aday gen / ml) olarak ifade </td><td></td><td> 20 ul </td><td> 100 ul </td><td> 1 ul </td></tr><tr><td></td><td> Bidistile su </td><td> 887,5 ul </td><td> 512,5 ul </td><td> 611,5 ul </td></tr><tr><td> son hacim </td><td></td><td> 1 mi </td><td> 1 mi </td><td> 1 mi </td></tr></tbody></table> Yapay p-nitrofenil ester substratları ile optimize edilmiş enzim testleri için Tablo 2. Pipetleme şemaları. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td></td><td></td><td> Smc00171 kodlanmış Fosfolipaz C için tahlil </td><td> Smc01003 için tahlil - kodlanmış DAG lipaz </td><td> Fosfolipaz A etkinlik için optimize tahlil </td></tr><tr><td> Stok </td><td> Bileşen </td><td></td><td></td><td></td></tr><tr><td> 2M </td><td> Tris-HCI, pH 8.5 </td><td></td><td></td><td> 2.5 ul </td></tr><tr><td> 2M </td><td> Tris-HCI, pH 9.0 </td><td></td><td> 2.5 ul </td><td></td></tr><tr><td> 100 mM </td><td> MnCl2 </td><td> 3 ul </td><td></td><td></td></tr><tr><td> 1M </td><td> Dietanolamin-HCI pH 9.8 </td><td> 5 ul </td><td></td><td></td></tr><tr><td> 1M </td><td> NaCI </td><td> 4 ul </td><td> 15 ul </td><td> 15 ul </td></tr><tr><td> % 1 </td><td> Triton X-100 </td><td> 2 ul </td><td> 20 ul </td><td> 20 ul </td></tr&gt; <tr><td></td><td> 14C-etiketli lipit (fosfolipit) </td><td></td><td></td><td> 20 ul (5.000 cpm) </td></tr><tr><td></td><td> 14C işaretli sfingosin (PC) </td><td> 20 ul (5.000 cpm) </td><td></td><td></td></tr><tr><td></td><td> 14C işaretli sfingosin (DAG) </td><td></td><td> 20 ul (5.000 cpm) </td><td></td></tr><tr><td> 10 mg / ml </td><td> ifade aday genler ile protein ekstresi </td><td> 0.5 ul </td><td> 5 ul </td><td> 5 ul </td></tr><tr><td></td><td> Bidistile su </td><td> 87.5 ul </td><td> 77,5 ul </td><td> 77,5 ul </td></tr><tr><td> nihai hacmi </td><td></td><td> 100 ul </td><td> 100 ul </td><td> 100 ul </td></tr></tbody></table> tabloiçin optimize edilmiş enzim testlerinin (fosfo) 3. Pipetleme şemaları radyo işaretli sfingosin substratlan olan lipazlar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> etkinlik (mmol nitrofenol / mg protein x dk) birimleri cinsinden verilir </td><td></td><td></td><td></td><td></td><td></td></tr><tr><td> Kalın p sayılan-nitrofenil ester, alt-tabakanın asil zinciri uzunluğuna işaret </td><td> 10 </td><td> 12 </td><td> 14 </td><td> 16 </td><td> 18 </td></tr><tr><td> E.coli özü (arka plan) </td><td> 16 ± 0.3 </td><td> 10 ± 1.1 </td><td> 13 ± 0.3 </td><td> 11 ± 0.8 </td><td> 10 ± 0.6 </td></tr><tr><td> SMc00930 E. ifade E. coli ekstresi </td><td> 1.839 ± 283 </td><td&gt; 1.839 ± 283 </td><td> 2873 ± 117 </td><td> 5517 ± 394 </td><td> 3402 ± 65 </td></tr><tr><td> SMc01003 E. ifade E. coli ekstresi </td><td> 43 ± 2.1 </td><td> 29 ± 2 </td><td> 20 ± 0.7 </td><td> 25 ± 1.5 </td><td> 22 ± 0.9 </td></tr><tr><td> SMc00930 eksi zemin </td><td> 1823 ± 283 </td><td> 1829 ± 283 </td><td> 2860 ± 117 </td><td> 5506 ± 394 </td><td> 3392 ± 65 </td></tr><tr><td> SMc01003 eksi zemin </td><td> 27 ± 2.1 </td><td> 18 ± 2 </td><td> 7 ± 0.7 </td><td> 14 ± 1.5 </td><td> 12 ± 0.9 </td></tr></tbody></table> Patatin gibi lipazlar SMc00930 ve SMc01003 için substrat olarak Tablo 4. p Nitrofenil asil esterler.

Watch this Scientific Journal Video about Defining Substrate Specificities for Lipase and Phospholipase Candidates at JoVE.com

Defining Substrate Specificities for Lipase and Phospholipase Candidates

Many predicted (phospho)lipases are poorly characterized with regard to their substrate specificities and physiological functions. Here we provide a protocol to optimize enzyme activities, search for natural substrates, and propose physiological functions for these enzymes.

Lipaz ve Fosfolipaz Adayları için substrat özellikleri tanımlama

Microorganisms produce a wide spectrum of (phospho)lipases that are secreted in order to make external substrates available for the organism. ...

defining-substrate-specificities-for-lipase-phospholipase

Nanyang Technological University

Research

JoVE Journal

Biochemistry

14.9K Görüntüleme.  Universidad Nacional Autónoma de México. Many predicted (phospho)lipases are poorly characterized with regard to their substrate specificities and physiological functions. Here we provide a protocol to optimize enzyme activities, search for natural substrates, and propose physiological functions for these enzymes.

Video: Defining Substrate Specificities for Lipase and Phospholipase Candidates

A Fluorescence-based Assay of Phospholipid Scramblase Activity

Scramblases translocate phospholipids across the membrane bilayer bidirectionally in an ATP-independent manner. The first scramblase to be identified and biochemically verified was opsin, the apoprotein of the photoreceptor rhodopsin. Rhodopsin is a G protein-coupled receptor localized in rod photoreceptor disc membranes of the retina where it is responsible for the perception of light. Rhodopsin&#39;s scramblase activity does not depend on its ligand 11-cis-retinal, i.e., the apoprotein opsin is also active as a scramblase. Although constitutive and regulated phospholipid scrambling play an important role in cell physiology, only a few phospholipid scramblases have been identified so far besides opsin. Here we describe a fluorescence-based assay of opsin&#39;s scramblase activity. Opsin is reconstituted into large unilamellar liposomes composed of phosphatidylcholine, phosphatidylglycerol and a trace quantity of fluorescent NBD-labeled PC (1-palmitoyl-2-{6-[7-nitro-2-1,3-benzoxadiazole-4-yl)amino]hexanoyl}-sn-glycero-3-phosphocholine). Scramblase activity is determined by measuring the extent to which NBD-PC molecules located in the inner leaflet of the vesicle are able to access the outer leaflet where their fluorescence is chemically eliminated by a reducing agent that cannot cross the membrane. The methods we describe have general applicability and can be used to identify and characterize scramblase activities of other membrane proteins.

We describe a fluorescence-based assay to measure phospholipid scrambling in large unilamellar liposomes reconstituted with opsin.

Fosfolipid Scramblase Aktivitesinin bir floresan bazlı analiz

Scramblases translocate phospholipids across the membrane bilayer bidirectionally in an ATP-independent manner. The first scramblase to be identified and ...

Biyokimya

Unraveling Entropic Rate Acceleration Induced by Solvent Dynamics in Membrane Enzymes

Enzyme catalysis evolved in an aqueous environment. The influence of solvent dynamics on catalysis is, however, currently poorly understood and usually neglected. The study of water dynamics in enzymes and the associated thermodynamical consequences is highly complex and has involved computer simulations, nuclear magnetic resonance (NMR) experiments, and calorimetry. Water tunnels that connect the active site with the surrounding solvent are key to solvent displacement and dynamics. The protocol herein allows for the engineering of these motifs for water transport, which affects specificity, activity and thermodynamics. By providing a biophysical framework founded on theory and experiments, the method presented herein can be used by researchers without previous expertise in computer modeling or biophysical chemistry. The method will advance our understanding of enzyme catalysis on the molecular level by measuring the enthalpic and entropic changes associated with catalysis by enzyme variants with obstructed water tunnels. The protocol can be used for the study of membrane-bound enzymes and other complex systems. This will enhance our understanding of the importance of solvent reorganization in catalysis as well as provide new catalytic strategies in protein design and engineering.

Channels for the transportation of water molecules in enzymes influence active site solvation and catalysis. Herein we present a protocol for the engineering of these additional catalytic motifs based on in silico computer modeling and experiments. This will enhance our understanding of the influence of solvent dynamics on enzyme catalysis.

Membran Enzim Solvent Dynamics Bağlı çözülüyor Entropic Oranı İvme

Enzyme catalysis evolved in an aqueous environment. The influence of solvent dynamics on catalysis is, however, currently poorly understood and usually ...

Kimya

The Determination of Protease Specificity in Mouse Tissue Extracts by MALDI-TOF Mass Spectrometry: Manipulating PH to Cause Specificity Changes

Proteases have several biological functions, including protein activation/inactivation and food digestion. Identifying protease specificity is important for revealing protease function. The method proposed in this study determines protease specificity by measuring the molecular weight of unique substrates using Matrix-assisted Laser Desorption/Ionization Time-of-Flight (MALDI-TOF) mass spectrometry. The substrates contain iminobiotin, while the cleaved site consists of amino acids, and the spacer consists of polyethylene glycol. The cleaved substrate will generate a unique molecular weight using a cleaved amino acid. One of the merits of this method is that it may be carried out in one pot using crude samples, and it is also suitable for assessing multiple samples. In this article, we describe a simple experimental method optimized with samples extracted from mouse lung tissue, including tissue extraction, placement of digestive substrates into samples, purification of digestive substrates under different pH conditions, and measurement of the substrates&#39; molecular weight using MALDI-TOF mass spectrometry. In summary, this technique allows for the identification of protease specificity in crude samples derived from tissue extracts using MALDI-TOF mass spectrometry, which may easily be scaled up for multiple sample processing.

Here, we present a protocol to determine protease specificity in crude mouse tissue extracts using MALDI-TOF spectrometry.

Proteaz özgüllük fare doku belirlenmesi MALDI-TOF Kütle spektrometresi tarafından ayıklar: PH özgüllük değişiklikler neden manipüle

Proteases have several biological functions, including protein activation/inactivation and food digestion. Identifying protease specificity is important ...

Use of Microscale Thermophoresis to Measure Protein-Lipid Interactions

The ability to determine the binding affinity of lipids to proteins is an essential part of understanding protein-lipid interactions in membrane trafficking, signal transduction and cytoskeletal remodeling. Classic tools for measuring such interactions include surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC). While powerful tools, these approaches have setbacks. ITC requires large amounts of purified protein as well as lipids, which can be costly and difficult to produce. Furthermore, ITC as well as SPR are very time consuming, which could add significantly to the cost of performing these experiments. One way to bypass these restrictions is to use the relatively new technique of microscale thermophoresis (MST). MST is fast and cost effective using small amounts of sample to obtain a saturation curve for a given binding event. There currently are two types of MST systems available. One type of MST requires labeling with a fluorophore in the blue or red spectrum. The second system relies on the intrinsic fluorescence of aromatic amino acids in the UV range. Both systems detect the movement of molecules in response to localized induction of heat from an infrared laser. Each approach has its advantages and disadvantages. Label-free MST can use untagged native proteins; however, many analytes, including pharmaceuticals, fluoresce in the UV range, which can interfere with determination of accurate KD values. In comparison, labeled MST allows for a greater diversity of measurable pairwise interactions utilizing fluorescently labeled probes attached to ligands with measurable absorbances in the visible range as opposed to UV, limiting the potential for interfering signals from analytes.

Microscale thermophoresis obtains binding constants quickly at low material cost. Either labeled or label free microscale thermophoresis is commercially available; however, label free thermophoresis is not capable of the diversity of interaction measurements that can be performed using fluorescent labels. We provide a protocol for labeled thermophoresis measurements.

Protein-Lipid Etkileşimlerini Ölçmek için Mikro Ölçekli Termoforez Kullanımı

The ability to determine the binding affinity of lipids to proteins is an essential part of understanding protein-lipid interactions in membrane ...

Click-Chemistry Based Fluorometric Assay for Apolipoprotein N-acyltransferase from Enzyme Characterization to High-Throughput Screening

Lipoproteins from proteobacteria are posttranslationally modified by fatty acids derived from membrane phospholipids by the action of three integral membrane enzymes, resulting in triacylated proteins. The first step in the lipoprotein modification pathway involves the transfer of a diacylglyceryl group from phosphatidylglycerol onto the prolipoprotein, resulting in diacylglyceryl prolipoprotein. In the second step, the signal peptide of prolipoprotein is cleaved, forming an apolipoprotein, which in turn is modified by a third fatty acid derived from a phospholipid. This last step is catalyzed by apolipoprotein N-acyltransferase (Lnt). The lipoprotein modification pathway is essential in most &#947;-proteobacteria, making it a potential target for the development of novel antibacterial agents. Described here is a sensitive assay for Lnt that is compatible with high-throughput screening of small inhibitory molecules. The enzyme and substrates are membrane-embedded molecules; therefore, the development of an in vitro test is not straightforward. This includes the purification of the active enzyme in the presence of detergent, the availability of alkyne-phospholipids and diacylglyceryl peptide substrates, and the reaction conditions in mixed micelles. Furthermore, in order to use the activity test in a high-throughput screening (HTS) setup, direct readout of the reaction product is preferred over coupled enzymatic reactions. In this fluorometric enzyme assay, the alkyne-triacylated peptide product is rendered fluorescent through a click-chemistry reaction and detected in a multiwell plate format. This method is applicable to other acyltransferases that use fatty acid-containing substrates, including phospholipids and acyl-CoA.

Presented here is a sensitive fluorescence assay to monitor apolipoprotein N-acyltransferase activity using diacylglyceryl peptide and alkyne-phospholipids as substrates with click-chemistry.

Enzim Karakterizasyonundan Yüksek Verimli Taramaya Kadar Apolipoprotein N-asiltransferaz için Click-Kimya Tabanlı Florometrik Analiz

Lipoproteins from proteobacteria are posttranslationally modified by fatty acids derived from membrane phospholipids by the action of three integral ...

Fluorescence-Based Measurements of Phosphatidylserine/Phosphatidylinositol 4-Phosphate Exchange Between Membranes

Several members of the evolutionarily conserved oxysterol-binding protein (OSBP)-related proteins(ORP)/OSBP homologs (Osh) family have recently been found to represent a novel lipid transfer protein (LTP) group in yeast and human cells. They transfer phosphatidylserine (PS) from the endoplasmic reticulum (ER) to the plasma membrane (PM) via PS/phosphatidylinositol 4-phosphate (PI(4)P) exchange cycles. This finding allows a better understanding of how PS, which is critical for signaling processes, is distributed throughout the cell and the investigation of the link between this process and phosphoinositide (PIP) metabolism. The development of new fluorescence-based protocols has been instrumental in the discovery and characterization of this new cellular mechanism in vitro at the molecular level. This paper describes the production and the use of two fluorescently labelled lipid sensors, NBD-C2Lact and NBD-PHFAPP, to measure the ability of a protein to extract PS or PI(4)P and to transfer these lipids between artificial membranes. First, the protocol describes how to produce, label, and obtain high-purity samples of these two constructs. Secondly, this paper explains how to use these sensors with a fluorescence microplate reader to determine whether a protein can extract PS or PI(4)P from liposomes, using Osh6p as a case study. Finally, this protocol shows how to accurately measure the kinetics of PS/PI(4)P exchange between liposomes of defined lipid composition and to determine lipid transfer rates by fluorescence resonance energy transfer (FRET) using a standard fluorometer.

Here, we describe protocols using fluorescent lipid sensors and liposomes to determine whether a protein extracts and transports phosphatidylserine or phosphatidylinositol 4-phosphate in vitro.

Membranlar Arasında Fosfataylserine/Fosfatidiylinositol 4-Fosfat Değişiminin Floresan Bazlı Ölçümleri

Several members of the evolutionarily conserved oxysterol-binding protein (OSBP)-related proteins(ORP)/OSBP homologs (Osh) family have recently been found ...

Analysis of Lipid Signaling in Drosophila Photoreceptors using Mass Spectrometry

The activation of phospholipase C&#946; (PLC&#946;) is an essential step during sensory transduction in Drosophila photoreceptors. PLC&#946; activity results in the hydrolysis of the membrane lipid phosphatidylinositol 4,5 bisphosphate [PI(4,5)P2] leading ultimately to the activation of transient receptor potential (TRP) and TRP like (TRPL) channels. The activity of PLC&#946; also leads subsequently to the generation of many lipid species several of which have been proposed to play a role in TRP and TRPL activation. In addition, several classes of lipids have been proposed to play key roles in organizing the cell biology of photoreceptors to optimize signaling reactions for optimal sensory transduction. Historically, these discoveries have been driven by the ability to isolate Drosophila mutants for enzymes that control the levels of specific lipids and perform analysis of photoreceptor physiology in these mutants. More recently, powerful mass spectrometry methods for isolation and quantitative analysis of lipids with high sensitivity and specificity have been developed. These are particularly suited for use in Drosophila where lipid analysis is now possible from photoreceptors without the need for radionuclide labeling. In this article, the conceptual and practical considerations in the use of lipid mass spectrometry for the robust, sensitive, and accurate quantitative assessment of various signaling lipids in Drosophila photoreceptors are covered. Along with existing methods in molecular genetics and physiological analysis such lipid is likely to enhance the power of photoreceptors as a model system for discoveries in biology.

<meta charset="utf8"></head><body>Drosophila Fotoreseptörlerinde Lipid Sinyalizasyonunun Kütle Spektrometresi Kullanılarak Analizi

The manuscript presents versatile, robust, and sensitive mass spectrometry protocols to identify and quantify several classes of lipids from Drosophila photoreceptors.

Drosophila Fotoreseptörlerinde Lipid Sinyalizasyonunun Kütle Spektrometresi Kullanılarak Analizi

The activation of phospholipase C&#946; (PLC&#946;) is an essential step during sensory transduction in Drosophila photoreceptors. PLC&#946; activity ...

PIP-on-a-chip: A Label-free Study of Protein-phosphoinositide Interactions

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific lipid component within a membrane, as in the case of phosphoinositides (PIPs), to ensure specific subcellular localization and/or activation. PIPs and cellular PIP-binding domains have been studied extensively to better understand their role in cellular physiology. We applied a pH modulation assay on supported lipid bilayers (SLBs) as a tool to study protein-PIP interactions. In these studies, pH sensitive ortho-Sulforhodamine B conjugated phosphatidylethanolamine is used to detect protein-PIP interactions. Upon binding of a protein to a PIP-containing membrane surface, the interfacial potential is modulated (i.e. change in local pH), shifting the protonation state of the probe. A case study of the successful usage of the pH modulation assay is presented by using phospholipase C delta1 Pleckstrin Homology (PLC-&#948;1 PH) domain and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) interaction as an example. The apparent dissociation constant (Kd,app) for this interaction was 0.39 &#177; 0.05 &#181;M, similar to Kd,app values obtained by others. As previously observed, the PLC-&#948;1 PH domain is PI(4,5)P2 specific, shows weaker binding towards phosphatidylinositol 4-phosphate, and no binding to pure phosphatidylcholine SLBs. The PIP-on-a-chip assay is advantageous over traditional PIP-binding assays, including but not limited to low sample volume and no ligand/receptor labeling requirements, the ability to test high- and low-affinity membrane interactions with both small and large molecules, and improved signal to noise ratio. Accordingly, the usage of the PIP-on-a-chip approach will facilitate the elucidation of mechanisms of a wide range of membrane interactions. Furthermore, this method could potentially be used in identifying therapeutics that modulate protein&#39;s capacity to interact with membranes.

Here we present a supported lipid bilayer in the context of a microfluidic platform to study protein-phosphoinositide interactions using a label-free method based on pH modulation.

PIP-on-a-chip: Protein-fosfoinositid Etkileşimlerinin Etiketsiz Bir Çalışması

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific ...

Biyomühendislik

In vitro Digestion of Emulsions in a Single Droplet via Multi Subphase Exchange of Simulated Gastrointestinal Fluids

Emulsions are currently being used to encapsulate and deliver nutrients and drugs to tackle different gastrointestinal conditions such as obesity, nutrient fortification, food allergies, and digestive diseases. The ability of an emulsion to provide the desired functionality, namely, reaching a specific site within the gastrointestinal tract, inhibiting/retarding lipolysis, or facilitating digestibility, ultimately depends on its susceptibility to enzymatic degradation in the gastrointestinal tract. In oil-in-water emulsions, lipid droplets are surrounded by interfacial layers, where the emulsifiers stabilize the emulsion and protect the encapsulated compound. Achieving a tailored digestibility of emulsions depends on their initial composition but also requires monitoring the evolution of those interfacial layers as they are subjected to different phases of gastrointestinal digestion. A pendant drop surface film balance implemented with a multi-subphase exchange allows for simulating the in vitro digestion of emulsions in a single aqueous droplet immersed in oil by applying a customized static digestion model. The transit through the gastrointestinal tract is mimicked by the subphase exchange of the original droplet bulk solution with artificial media, mimicking the physiological conditions of each compartment/step of the gastrointestinal tract. The dynamic evolution of the interfacial tension is recorded in situ throughout the whole simulated gastrointestinal digestion. The mechanical properties of digested interfaces, such as interfacial dilatational elasticity and viscosity, are measured after each digestion phase (oral, gastric, small intestine). The composition of each digestive media can be tuned to account for the particularities of the digestive conditions, including gastrointestinal pathologies and infant digestive media. The specific interfacial mechanisms affecting proteolysis and lipolysis are identified, providing tools to modulate digestion by the interfacial engineering of emulsions. The obtained results can be manipulated for designing novel food matrices with tailored functionalities such as low allergenicity, controlled energy intake, and decreased digestibility.

In vitro Digestion of Emulsions in a Single Droplet via Multi Subphase Exchange of Simulated Gastrointestinal Fluids

A pendant drop surface film balance implemented with a multi-subphase exchange, nicknamed the OCTOPUS, allows for mimicking digestive conditions by the sequential subphase exchange of the original bulk solution with simulated gastrointestinal fluids. The simulated in vitro digestion is monitored by recording in situ the interfacial tension of the digested interfacial layer.

Lipaz ve Fosfolipaz Adayları için substrat özellikleri tanımlama

Özet

Daha Fazla Video Keşfet

Fosfolipid Scramblase Aktivitesinin bir floresan bazlı analiz

Membran Enzim Solvent Dynamics Bağlı çözülüyor Entropic Oranı İvme

Proteaz özgüllük fare doku belirlenmesi MALDI-TOF Kütle spektrometresi tarafından ayıklar: PH özgüllük değişiklikler neden manipüle

Protein-Lipid Etkileşimlerini Ölçmek için Mikro Ölçekli Termoforez Kullanımı

Enzim Karakterizasyonundan Yüksek Verimli Taramaya Kadar Apolipoprotein N-asiltransferaz için Click-Kimya Tabanlı Florometrik Analiz

Membranlar Arasında Fosfataylserine/Fosfatidiylinositol 4-Fosfat Değişiminin Floresan Bazlı Ölçümleri

Drosophila Fotoreseptörlerinde Lipid Sinyalizasyonunun Kütle Spektrometresi Kullanılarak Analizi

Drosophila Fotoreseptörlerinde Lipid Sinyalizasyonunun Kütle Spektrometresi Kullanılarak Analizi

PIP-on-a-chip: Protein-fosfoinositid Etkileşimlerinin Etiketsiz Bir Çalışması

İn vitro Simüle Edilmiş Gastrointestinal Sıvıların Çok Alt Fazlı Değişimi Yoluyla Emülsiyonların Tek Bir Damlacıkta Sindirimi