Bu iş için fon Paris Bettencourt iGEM takımı destek Fondation Bettencourt Schueller tarafından sağlandı. Biz teknik yardım ve tavsiye için İNSERM U1001 araştırma ünitesi ve Chantal Lotton teşekkür ederiz. Fajmid Litmus28i_J23115-B0032-GFP Monica Ortiz ve Stanford Drew Endy tarafından sağlandı.

Srna Susturulması kasetler Rulman 1. Tasarım ve İnşaat Fajemid Vektörler <ol><li> Srna Susturulması Kasetler 8 De Novo Tasarımı <ol><li> mRNA tam dizi bir DNA dizisi veritabanı kullanılarak susturulması tespit edilir. Hedef sekans oluşturmak için, bir başlangıç ​​kodonu (örneğin, ATG) ile başlayan pozisyonda +1 +24, kodlama dizisinin ilk 24 bp not edin. Not: diğer siteler veya mRNA kesimleri 8 hedeflenen zaman suskunluğu daha az verimlidir. </li><li> Srna kaset için KILAVUZU dizisi üretmek için HEDEF dizisinin ters tamamlayıcı alın. Kloramfenikol asetiltransferaz (CAT) için HEDEF ve REHBER dizilerinin örnekleri için Tablo 1&#39;e bakınız. </li><li> 292 bp&#39;lik tam Srna sentezleme kasetini tasarlamak için, seri pR promotör, rehber sekans, Hfq protein bağlayıcı etki alanı ve T1 / TE kopyalama sonlandırıcı dizileri içerir (Tablo 2) yerleştirin. </li><li> Hedef vektörüne Srna kasetinin klonlanmasını kolaylaştırmak için seçimin diğer bir klonlama siteleri ekleyin. </li><li> Ticari gen sentezi veya benzer bir yöntemle tam Srna kasetini edinin ve işlevsel bir f1 replikasyon orijini 11 ile herhangi bir fajemid vektörü içine klonlamak. Nihai fajmid vektörü tam dizisi için Yardımcı Bilgiler bakın. </li></ol></li><li> PCR tabanlı site Yönlendirilmiş Mutagenezler 12 kullanarak Varolan Srna İfade Kaset tarafından Hedeflenen sırası değiştirilmesi <ol><li> Mevcut bir Srna ekspresyon kaseti 24 bp&#39;lik rehber sekans tanımlama. Not: Bu çalışmada kullanılan açıklamalı pAB.001 plazmid, tamamlayıcı dizi dosyası olarak kullanılabilir. </li><li> Tasarım ileri ve yeni 24 bp KILAVUZU dizisini kuşatan mevcut Srna kasetine homoloji kısa bölgeleri ile primerler ters. Ticari oligonükleotid sentezi yoluyla primerler elde edilir. Not: yer yönelimli mutajenez için geliştirilmiş primer tasarımı depic olanted Şekil 2&#39;de tam astar şablon sekansların, Tablo 3&#39;te verilmiştir. </li><li> E. 5 ml&#39;lik bir kültürden hazırlanması E. coli şablonu Srna sentezleme fajmid yapılması. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Özü ve bir DNA miniprep kiti ya da benzer bir yöntem 12 ile 5 ml bakteri kültüründen şablon Srna ifade fajmid arındırmak. </li><li> Şablon Srna sentezleme fajmid ve yüksek kalitede polimeraz ileri ile bir ve ters primer (Tablo 4) birini kullanarak iki PCR reaksiyonları hazırlayın. Polimeraz ile ilgili (Tablo 5) tarafından tavsiye edildiği gibi PCR koşulları kullanarak. Tek astar reaksiyon üstel amplifikasyon üretmek değil gerçeği açıklamak için bir standart reaksiyonu daha yüksek 10-50x şablon konsantrasyonu artırır. </li><li> Bir mikrosantrifüj tüp içinde iki yukarıdaki PCR reaksiyonları birleştirin. AnneaL, bir kaynar su banyosu içinde 98 ° C&#39;de ısıtılarak ürünleri. Hemen su banyosuna mikrosantrifüj tüpü yerleştirdikten sonra, ısı kaynağı çıkarın ve banyo yavaş 1-2 saat boyunca oda sıcaklığına dönmesi için izin verir. </li><li> 1 ul, mutasyona uğramamış şablonu Srna sentezleme fajmid ortadan kaldırmak için. Karışıma DpnI sınır enzimi ve 1 saat, ya da tam sindirim için üretici tarafından önerilen bir süre için 37 ° C&#39;de inkübe edin. Not: DpnI PCR ürünleri ana çoğaltılmış fajmidler mevcut değil sadece metillenmiş hedef sitesi, sindirir. </li><li> Satın alınan veya 13 kimyasal yetkili E. hazırlanmış Transform tavlanmış PCR ürünü 1-5 ul E. coli. Uygun antibiyotik içeren LB agar plakaları üzerinde seçici bir kaplama ile transforme soyun tek koloniler izole edin. </li><li> Doğru KILAVUZU dizisinin katılmasını doğrulamak için, koloni PCR ile elde edilen koloniler ekran. 200 ul bir pipet kullanılarak, COTek bir dönüştürülmüş koloniden küçük bir hücre miktarı llect. Mark ve doğrulamadan sonra aşağı kullanım için özgün koloni korumak. </li><li> mikrosantrifüj tüpü içinde nükleaz içermeyen su, 50 ul toplanan hücreler ekleyin. Yukarı ve aşağı pipetleme karıştırın. </li><li> bir tezgah üstü PCR ya da kaynar su banyosu kullanılarak, 2 dakika boyunca 95 ° C&#39;ye kadar ısıtılarak hücrelerin lize. </li><li> DNA şablonu olarak ısı ile lize edilmiş hücrelerden 1 ul kullanılarak fajmid bölge PCR ile amplifiye. PCR koşulları ve PCR protokolleri Tablo 6 ve 7&#39;de verilmiştir. Doğrulama astar dizileri için ek pAB.001 dizisi dosyasına bakın. </li><li> Doğru KILAVUZU dizisinin katılmasını doğrulamak için PCR ürünü sırası. </li><li> E. 5 ml&#39;lik bir kültürü inoküle dizisi doğrulanmış Srna ifade fajmid taşıyan E. coli klonu. Seçici LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Bir gliserol stok hazırlayındizisi doğrulanmış klonu. vida kapaklı bir kriyo tüpüne içinde% 60 gliserol, 250 ul, gece boyunca kültürün 750 ul ekle. </li><li> belirsiz bir süre -80 ° C&#39;de gliserol stokları saklayın. gece boyunca kültür kalan aşama 2&#39;de Srna sentezleme fajmid için bir kaynak olarak kullanılabilmektedir. </li></ol></li></ol> M13-paketlenmiş Fajemid Stoklar 2. Üretim ve Hasat <ol><li> E. 5 ml&#39;lik bir kültürden hazırlanması E. coli Srna sentezleme fajmid yapılması. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. Not: Srna sentezleme fajemid aşama 1.1.5 de tarif edildiği gibi de novo klonlama yoluyla elde edilen, ya da tadil edilmiş olan bir fajmid gelen ve aşama 1.2.16 hasat edilebilir. </li><li> Benzer şekilde E. 5 ml&#39;lik bir kültür hazırlamak E. coli M13KO7 yardımcı plazmid taşıyan. Seçici LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Özü ve Srna expressio arındırmakn fagemit ve DNA ekstraksiyon kiti ya da benzer bir yöntem 12 ile yardımcı plazmid. </li><li> Cotransform satın alınabilir ya da 1 ul Srna sentezleme fajmid ve yardımcı plazmidin her biri ile 13 kimyasal olarak E. coli hazırlandı. Her iki yapı için seçici antibiyotik LB agar kaplama ile cotransformants için seçilir. </li><li> Seçici antibiyotiklerle LB birlikte dönüşmüş soyun tek bir koloni 10 ml kültür hazırlayın. 8-12 saat veya gece boyunca çalkalama ile 37 ° C&#39;de inkübe edin. </li><li> 10 dakika boyunca 3300 x g&#39;de kültürü santrifüj. 0.2 um&#39;lik bir filtreden süpernatan ve filtre toplayın. Dikkat: Medya sızıntısı durumunda, enfektif faj partikülleri yok etmek için seyreltilmiş çamaşır suyu (% 0.5) ile bölgeyi temizleyin. </li><li> 4 ° C &#39;de paketlenmiş fagemit Filtrat saklayın. Not: Örnekler aktivite kaybı olmadan günler, haftalar boyunca muhafaza edilebilir. </li></ol> Bayan + Hedef Hücreler 3. hazırlanması susturmak için <ol><li> Susturmak için hedeflenecek hücreleri F pilusun 14 ifade olmadığını belirleyin. F pilus zaten varsa, 4. adıma geçin. Not: E., olağan laboratuar suşları E. coli genomları ya da bir plasmid F pilus varlığını göstermek için F + ya da F &quot;olarak açıklanmış bulunmaktadır. </li><li> E. F + suşu elde edilir E. coli gibi TOP10F olarak &#39;. Not: Hedef streyn konjugasyondan sonra F-plazmid donörden ayrılması için benzersiz bir direnç işaretleyicisi taşıyan emin olun. </li><li> Bir F + suşu ile konjugasyon F pilusun tanıtmak için, hedef zorlanma ve F-plazmid donör 14 hem 5 ml kültür hazırlayın. uygun antibiyotikler ile LB ortamında, çalkalanarak 37 ° C&#39;de gece boyunca hücre büyütün. </li><li> Ertesi gün, her iki soy 1 seyreltilmiş 100 seçici LB 5 ml ve çalkalanarak 37 ° C&#39;de kültürlenmesini devam etmektedir. </li><li> opt ölçerek hücrelerin büyüme fazı belirlemebir tezgah üstü spektrofotometre kullanılarak 600 nm (OD 600) de kültür iCal&#39;ın yoğunluğu. Kültür 0.3 OD 600 kadar, yaklaşık 2 saat boyunca hücrelerin log-faz büyümesini 15 işaret sağlanır. </li><li> mikrosantrifüj tüpleri içinde 3 konjugasyon reaksiyonları hazırlayın: 0.5 mi, F-plazmid verici + 0.5 mi, hedef soyu, 0.5 mi, F-plazmid verici + 0.5 mi LB ortamı (negatif kontrol) ve 0.5 mi, hedef soyu + 0.5 mi LB ortamı (negatif kontrol). çekimi çalkalanarak 37 ° C&#39;de 2 saat devam etmesine izin verir. </li><li> Plaka F-plazmid özgü antibiyotik (genellikle tetrasiklin) ve hedef suşu ile seçici LB agar her konjugasyon reaksiyon 100 ul. ne alıcı veya verici suş hem antibiyotik dirençleri ifade onaylamak için negatif kontrol reaksiyonları Plate. </li></ol> Susturma ambalajlı fajmidler 4. Enfeksiyon <ol><li> LB Medi 5 ml&#39;lik bir kültür haline F + hedef hücrelerin tek bir koloni İnokülasyonUygun antibiyotik ile. çalkalanarak 37 ° C&#39;de gece boyunca inkübe edilir. </li><li> Ertesi gün, K + hedef hücreler 1 seyreltin: 100 seçici LB ortamı 5 ml ve çalkalanarak 37 ° C&#39;de kültüre devam etmektedir. </li><li> Bir tezgah üstü spektrofotometre kullanılarak 600 nm (OD 600) de, kültürün optik yoğunluğu ölçülerek hücre büyüme fazı belirler. Kültür 0.3 OD 600 kadar, yaklaşık 2 saat boyunca hücrelerin log-faz büyümesini 15 işaret sağlanır. Not: F pilus ve enfeksiyon verimliliği ifade log fazında yüksektir. </li><li> Hedef nüfusunun yaklaşık% 99 enfeksiyon elde etmek için 1: 100 arasında bir hacim oranında hedef hücrelere (adım 2.6) M 13 paketlenmiş fajmidleri ekleyin. Enfeksiyon, 30-60 dakika çalkalanarak 37 ° C&#39;de devam etmek için izin verin. </li><li> seçim yöntemine göre Srna sessizleştirme fenotip deneyi. Not: Bir floresan protein hedefi için, susturma etkisi belirlenebilirdoğrudan fluorometri 10 tarafından. Alternatif olarak, fenotipik deneyler gen yok etme 8 fenotipik sonuçlarını gözlemlemek için kullanılabilir. </li><li> adımlar 1.2.14-1.2.16 aşağıdaki Srna ifade eden fagemit konak için bir gliserol stok hazırlayın. Not: fagemit süresiz konakçı suşunda yayılması ve geleneksel bir plazmid antibiyotik benzeri bir muhafaza edilebilir. </li></ol>

<ol>
	<li>Ohkumo, T., Masutani, C., Eki, T., Hanaoka, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+RNAi+in+C.+elegans.">Use of RNAi in C. elegans.</a> RNAi. , 129-137 (2008).</li><li>Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Iordanou, E., Chandran, R. R., Blackstone, N., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+interference+by+dsRNA+injection+into+Drosophila+embryos.">RNAi interference by dsRNA injection into Drosophila embryos.</a> J Vis Exp. (50), e2477 (2011).</li><li>Ramadan, N., Flockhart, I., Booker, M., Perrimon, N., Mathey-Prevot, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+high-throughput+RNAi+screens+in+cultured+Drosophila+cells.">Design and implementation of high-throughput RNAi screens in cultured Drosophila cells.</a> Nat Protoc. 2 (9), 2245-2264 (2007).</li><li>Tsong, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+cell+membranes.">Electroporation of cell membranes.</a> Biophys J. 60 (2), 297-306 (1991).</li><li>Kim, W. J., Chang, C. -. W., Lee, M., Kim, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+siRNA+delivery+using+water+soluble+lipopolymer+for+anti-angiogenic+gene+therapy.">Efficient siRNA delivery using water soluble lipopolymer for anti-angiogenic gene therapy.</a> J Control Release. 118 (3), 357-363 (2007).</li><li>Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+RNAi+for+the+masses.">Mammalian RNAi for the masses.</a> Trends Genet. 19 (1), 9-12 (2003).</li><li>Na, D., Yoo, S. M., Chung, H., Park, H., Park, J. H., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+engineering+of+Escherichia+coli+using+synthetic+small+regulatory+RNAs.">Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.</a> Nat Biotechnol. 31 (2), 170-174 (2013).</li><li>Ceroni, F., Algar, R., Stan, G. -. B., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+cellular+capacity+identifies+gene+expression+designs+with+reduced+burden.">Quantifying cellular capacity identifies gene expression designs with reduced burden.</a> Nat Methods. 12 (5), 415-418 (2015).</li><li>Libis, V. K., Bernheim, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+Antibiotic+Resistance+in+E.+coli+with+Engineered+Phage+Bearing+Small+Regulatory+RNAs.">Silencing of Antibiotic Resistance in E. coli with Engineered Phage Bearing Small Regulatory RNAs.</a> ACS Synth Biol. 3 (12), 1003-1006 (2014).</li><li>Ortiz, M. E., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+cell-cell+communication+via+DNA+messaging.">Engineered cell-cell communication via DNA messaging.</a> J Biol Eng. 6 (1), 16 (2012).</li><li>Edelheit, O., Hanukoglu, A., Hanukoglu, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+site-directed+mutagenesis+using+two+single-primer+reactions+in+parallel+to+generate+mutants+for+protein+structure-function+studies.">Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.</a> BMC Biotechnol. 9 (1), 61 (2009).</li><li>Chung, C. T., Miller, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+storage+of+competent+Escherichia+coli+cells.">Preparation and storage of competent Escherichia coli cells.</a> Recombinant DNA Part I. , 621-627 (1993).</li><li>Phornphisutthimas, S., Thamchaipenet, A., Panijpan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conjugation+in+Escherichia+coli.">Conjugation in Escherichia coli.</a> Biochem Mol Biol Educ. 35 (6), 440-445 (2007).</li><li>Sezonov, G., Joseleau-Petit, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Physiology+in+Luria-Bertani+Broth.">Escherichia coli Physiology in Luria-Bertani Broth.</a> J Bacteriol. 189 (23), 8746-8749 (2007).</li><li>Mittal, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+efficiency+of+RNA+interference+in+mammals.">Improving the efficiency of RNA interference in mammals.</a> Nat Rev Genet. 5 (5), 355-365 (2004).</li><li>Qi, L. S., Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dispersing+biofilms+with+engineered+enzymatic+bacteriophage.">Dispersing biofilms with engineered enzymatic bacteriophage.</a> Proc Natl Acad Sci USA. 104 (27), 11197-11202 (2007).</li><li>Yosef, I., Manor, M., Kiro, R., Qimron, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperate+and+lytic+bacteriophages+programmed+to+sensitize+and+kill+antibiotic-resistant+bacteria.">Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.</a> Proc Natl Acad Sci USA. 112 (23), 7267-7272 (2015).</li><li>Karlsson, F., Malmborg-Hager, A. -. C., Albrekt, A. -. S., Borrebaeck, C. A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+comparison+of+phage+M13-infected+vs.+uninfected+Escherichia+coli.">Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli.</a> Can J Microbiol. 51 (1), 29-35 (2005).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caveat+of+RNAi+in+plants:+the+off-target+effect.">Caveat of RNAi in plants: the off-target effect.</a> Methods in molecular biology. 744, 13-25 (2011).</li><li>Jackson, A. L., Linsley, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognizing+and+avoiding+siRNA+off-target+effects+for+target+identification+and+therapeutic+application.">Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application.</a> Nat Rev Drug Discov. 9 (1), 57-67 (2010).</li><li>Cho, S. W., Kim, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Hagens, S., Blasi, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+filamentous+phage+as+bactericidal+agents:+a+pilot+study.">Genetically modified filamentous phage as bactericidal agents: a pilot study.</a> Lett Appl Microbiol. 37 (4), 318-323 (2003).</li><li>Kasman, L. M., Kasman, A., Westwater, C., Dolan, J., Schmidt, M. G., Norris, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+the+phage+replication+threshold:+a+mathematical+model+with+implications+for+phage+therapy.">Overcoming the phage replication threshold: a mathematical model with implications for phage therapy.</a> J Virol. 76 (11), 5557-5564 (2002).</li><li>Chasteen, L., Ayriss, J., Pavlik, P., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eliminating+helper+phage+from+phage+display.">Eliminating helper phage from phage display.</a> Nucleic Acids Res. 34 (21), e145 (2006).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+bacteriophage+targeting+gene+networks+as+adjuvants+for+antibiotic+therapy.">Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy.</a> Proc Natl Acad Sci USA. 106 (12), 4629-4634 (2009).</li><li>Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+repression+and+activation+of+bacterial+gene+expression+using+an+engineered+CRISPR-Cas+system.">Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system.</a> Nucleic Acids Res. 41 (15), 7429-7437 (2013).</li></ol>

The authors have nothing to disclose.

Mevcut metot hedefsiz kontrollerle karşılaştırıldığında mKate floresan seviyelerinde% 80 azalma sağlanmıştır. Bu komple susturma gözlenmemiştir ve% 50-90 verim 16,17 tipik başka RNA demonte yöntemleri ile uyumludur. fenotipik düzeyde, CAT-hedefli knockdowns anlamlı kloramfenikol direnci zayıflatır ve bazı şartlar altında onu ortadan kaldırmak için başardık. Demonte fenotip sadece birkaç saat sonrası enfeksiyon (Şekil 3B) sonra nüfus düzeyinde saptanabilir oldu. Bu faj tabanlı bir teslim önemli bir özellik gösterilmiştir: yüksek yok etme frekansı önceden genetik modifikasyon kesikli kültürde doğrudan elde edilebilir. Plazmid dönüşüme veya genomik entegrasyon kullanılarak geleneksel genetik modifikasyon farklı faj enfeksiyonu nüfus tek bir izole koloniden yeniden yetiştirilebilir gerektirmez. Bu faj enfeksiyonun etkileri Explor olmasını sağlar18 ya da genetik olarak karışık doğal nüfus 19 biyofilm gibi önceden var olan mekansal yapıları ile karmaşık mekansal dinamikleri 11 ile popülasyonlarında ed. Bu yöntemde kritik bir safha, yüksek titrede paketlenmiş fajmid üretimidir. faj parçacığı üretimi ile ilişkili metabolik yükü fajemid üretim familyasından mutasyon ya da plazmid kaybı yüksek oranda neden olabilir. Fagemit üretim suşu tek bir birlikte dönüşmüş koloniden doğrudan kültüre ve buzdolabında değil, dondurulmuş veya faj hasat öncesinde alt kültüre edilmesi tavsiye edilir. E. fagemit ve yardımcı plazmit sokulması sırasında eş-dönüşüm düşük verimliliği de gözlenebilir Aynı anda E. coli. Bu durumda, daha yüksek verim, daha sonra ilk olarak bir yardımcı plazmid transforme fajmid ile müteakip transformasyonu için yardımcı plasmidi taşıyan yetkin hücrelerin hazırlanması ile elde edilebilir. Phagemid enfeksiyon veya Srna sentezleme aynı zamanda, hedef hücreler üzerinde saptanabilir bir metabolik yük getirir ve bazı fenotipik pertürbasyon neden olabilir. Hücreler fagemit hedefleme CAT (Şekil 3) ile enfekte edilmiştir, örneğin, mKate2 floresan bir azalma da gözlenmiştir. M13 ile Enfeksiyon E. sistemik stres tepkileri tetiklemek için düşünce değil coli 20, ama dolaylı olarak transkripsiyonel desenleri değiştirebilir. Alternatif olarak, fajmid dahil GFP veya ampisilin direnç işaretçileri mKate2 ifade ve büyümeyi 9 azaltarak, hücresel kaynaklar için rekabet edebilir. Son olarak, Srna kaset kendisi küresel Hfq proteinini titre edilerek gen ekspresyon profillerini değiştirmek, ya da off-hedef mRNA susturma yoluyla olabilir. Kapalı hedef etkileri in vivo RNAi 21-23 hedefleyen yaygındır, ancak sistematik bu sistem için araştırılmalıdır henüz. Bu yöntemin bir sınırlama olduğu enfeksiyonun ka olduğuVerimliliği olmayan bazı enfekte olmuş bakteri popülasyonunda korunmasına izin az% 100&#39;dür. Bu çalışma ve daha önceki çalışmaları 10 sonuçları enfekte olmayan hücreler nihai nüfusun% 1-10 olarak öne sürmek, ve gözlenen nonsilenced fenotipleri çoğu sorumludur. M13-direnci verilmesi için muhtelif yollar pilus ifadesi 24 en yaygın olan mutasyon kaybı ile, bilinmektedir. Bu sınırlamaların ışığında, kontroller yüksek enfeksiyon oranları ve demonte verimliliğini doğrulamak için kullanılmalıdır. Bazı uygulamalar için bir başka potansiyel sınırlama yardımcı faj kontamine arada transferidir. M13K07 mutasyona uğramış bir paketleme sinyali içermesine rağmen, faj üretimi ve ilk enfeksiyon olayı 25 dışına faj yayılmaya devam etmesi için yetkin hücrelerin sonuçlanan düşük bir frekansta faj kapsid içine paketlenmiş ve enfekte popülasyonları aktarılabilir. yardımcı faj yapılan değişiklikler etkili olduğu kanıtlanmıştırAzaltılmış faj üretimi 26 pahasına olsa bazen, spesifik olmayan ambalaj azaltmayı. Engineered bakteriyofaj E. için vazgeçilmez bir araç haline gelmiştir büyüyen bir nüfusa yeni genlerin hızlı teslimat sağlayan coli sentetik biyoloji,. Yeni çalışmalar hücrelerarası iletişim devrelerini 11 üretilen ya da antibiyotik direncini bastırmak için transkripsiyon faktörlerini ifade 27 yolaklarıyla etti. Burada sunulan protokol programlanmış RNA&#39;lar yoluyla bakteriyel fizyolojisinin kontrolünü sağlayan araçları büyüyen bir koleksiyon ekler. Nükleaz aktivitesi ortadan kaldırmak için mutasyona uğradığı zaman CRISPR-Cas nükleazlar, RNA yönlendirmeli geni hedef 17,28 transkripsiyon bastırmak için gösterilmiştir. Bunun aksine, Srna susturulması translasyon düzeyinde çalışır ve dışsal protein ekspresyonunu gerektirmemektedir. Yeni nesil Biyoteknoloji kompleksi fenoksi program faj aracılı teslim transkripsiyonel ve çeviri kontrol birleşebilirlerGerçek zamanlı türleri.

RNA aracılı gen knockdowns iki aşamada devam edin. İlk olarak, bir RNA molekülü, bir hücre hattı veya çalışma organizmaya verilir. İkinci olarak, endojen RNA bağlayıcı proteinler, RNA hedef tanınmasını kolaylaştırmak ve susturma etkisi üretmek. Tüm RNA demonte teknolojileri kolayca ilgi belirli bir hedef maç için üretilebilir sentetik sRNAs özelleştirilebilir doğası, yarar. Ancak, RNA alımı ve sessizliğini moleküler ayrıntıları nerede ve nasıl RNA knockdowns uygulanabilir kısıtlayıcı, model sistem çok değişkendir. Nematod, iki-şeritli RNA (dsRNA) molekülleri ortamda veya dsRNA eksprese eden E. nüfuslu solucanlar beslenmesi ile doğrudan sokulabilir coli hücreleri 1,2. Drosophila olarak, RNAi, sadece kültür ortamı 4 dsRNA eklenerek dsRNA 3 embriyolar microinjecting elde ya da hücre hatları uygulanabilir. Memeli hücre hatlarında,Sentetik küçük müdahale RNA&#39;lar (siRNA&#39;lar), lipozomlar 3,6 paketlenmiş, elektroporasyon 1,2,5 canlı hücre teslim veya DNA plazmid vektörleri 4,7 eksprese edilebilir. RNA türlerinin sitozolde ulaştığında, RNAi yolu, dsRNA işlemek hedefin antisens tanınmasını kolaylaştırmak ve konak bağlı, translasyonel baskıyı, mRNA bozulmalarını veya heterokromatin oluşumunu katalize etmek için RISC kompleksi dayanır. Bu gereksinimler nedeniyle, klasik RNAi sadece verimli eksojen RNA sürebilir ve RISC veya RISC benzeri aktivite ifade organizmalar yapılabilir. Özellikle, bu model bakterisi E. dışlar RNAi yolu yoksun coli. Ancak, sentetik biyoloji son gelişmeler teslimat sorunu ve susturma sorunu hem çözmek için araçlar sağlar. Bu protokolde, Srna yapılar E. ifade edilir DNA vektöründen coli li teslimM13 fajemid / yardımcı sistemini kullanarak hücrelerin Ving. Bir fagemit replikasyon bir faj türevli F1 kökenli herhangi bir plazmiddir. Bir yardımcı plazmid, bu durumda M13KO, viral parçacıkları üretmek için gerekli tüm makine taşır, ama replikasyon ve paketleme için yeterli değildir kendisidir. Bir fajemid ve yardımcı plazmid-dönüştürülmüş co zaman, tek başına fagemit, f1 kökenli çoğaltılmış paketlenmiş ve salgılanır. Vectorized fagemit canlı E. enfekte sonra yetkili F pilus yoluyla E. coli. Bu sistemde, susturulması etkisi hedef bağlayıcı sekansı ile bir iskele sekansı birleştiren özel Srna kasetleri üretilmektedir. Hedef bağlayıcı dizi tipik ribozom bağlanma yeri (RBS) olarak, bir mRNA hedef antisens 24 baz çifttir. Na ve arkadaşları 8 tarafından geliştirilen iskele dizisi, MICC, E. endojen küçük bir düzenleyici RNA çıkarılan bir Hfq bağlayıcı motifini E. coli. Hfq proteini RNA-RNA-bağlanma uyarırg ve mRNA degradasyon, RNAi RISC benzer, bu sistemde bir amaca hizmet. Şekil 1 Srna kaseti yapısı, fagemit vektörleştirme ve susturma mekanizması dahil olmak üzere faj aracılı Srna knockdowns için tam bir şemayı göstermektedir. Bir yöntemde E. gen ifadesini modüle etmek için E. coli, Srna susturma, basit, hızlı ve çok yönlüdür. Hedeflenen E. E. coli fajemid yayma ve Srna ifade ötesinde yatar değildir. Bu büyük heterolog yapıları ifadesi hücresel kaynakları 9 zorlayabilir sentetik biyoloji veya temel araştırma kapsamında ilgili olabilir. Yeni hedeflerle fajmidler tek PCR ile üretilen ve fagemid dönüşüm bir gün sonra hasat edilebilir. Son olarak, hemen hemen her mRNA hedeflenebilir. Srna düzenlemesi kaseti (standart plazmit üzerinde)&gt;% 90, tipik 8 baskı düzeyleri ile metabolizma hedeflerin çeşitli çalışma gösterilmiştir. 10 kasetlerinin kullanarak daha önceki çalışmaları genişletir. İlk olarak, bir paket fagemit E. bir parti kültür ilave edilir E. coli hücreleri ve floresan protein mKate2 ekspresyonunu kapatmak için kullanılabilir. Sonradan floresan değişiklikleri gerçek zamanlı olarak takip edilmektedir. İkinci olarak, CAT genini aşağı vurma agar plakaları üzerinde fenotipik kloramfenikol direncini azaltmak için gösterilmiştir. Her iki durumda da, fagemit kendisi enfeksiyon oranı, bağımsız bir yok etme verimliliğinin ölçülmesine izin verecek şekilde, bir GFP işaretleyici taşımaktadır.

<table border="0" cellpadding="0" cellspacing="0" width="637">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Plasmid Miniprep Kit</td>
			<td style="width:135px;">Qiagen</td>
			<td style="width:119px;">27104</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DpnI Enzyme</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phusion High Fidelity Polymerase</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0530S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Taq 2x Master Mix</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0270L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">M13KO7 Helper Phage</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">N0315S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DH5&#945; Competent Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">18265-017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TOP10F&#39; Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">C3030-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LB Broth</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">L3022-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">A9393-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">60615-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloramphenicol</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">C0378-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">87128-25G</td>
			<td></td>
		</tr>
	</tbody>
</table>

phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli

RNA aracılı knockdowns yaygın gen ifadesini kontrol etmek için kullanılır. teknikler Bu çok yönlü ailesi bir dizi ile sentezlenir ve susturma için hedeflenen bir geni tamamlayıcı tasarlanabilir kısa RNA (Srna) kullanır. Srna doğrudan bir çok hücre tipinde kişiye veya çeşitli vektörler kullanılarak olabilir inşa için, gen ekspresyonu zahmetli genetik modifikasyon olmadan canlı hücreler bastırılmış edilebilir. En yaygın RNA demonte teknolojisi, RNA interferans (RNAi), hedef mRNA&#39;nın endojen RNA kaynaklı kompleks (RISC) susturma aracılık sekans tanıma ve bölme merkezi kullanır. Bu teknik uygulamaları nedenle RISC sentezleyen organizmaların öncelikle ökaryotlar ile sınırlıdır. Son zamanlarda, RNA Biyo yeni nesil RNA vasıtasıyla gen ekspresyonunu kontrol etmek için alternatif bir mekanizmalar geliştirmişlerdir ve böylece bakteriler olası RNA aracılı gen knockdowns yapılmıştır. Burada gen Expres susturma için bir yöntem tarifE. sion coli işlevsel RNAi andırıyor. Bu sistemde, bir suni fajmid dizisini hedeflemek için tasarlanmış olabilir srna ifade etmek için tasarlanmıştır. Sentezleme konstruktu E. nüfusu teslim stabil bir plazmid gibi replike edebilmekte ve bundan sonra litik olmayan M13 fajı ile coli hücreleri. Antisens tanınması ve hedef mRNA&#39;nın susturulması E. endojen Hfq proteini aracılık etmektedir E. coli. Bu protokol, antisens Srna tasarımı fagemit vektör inşa, M13 bakteriyofaj içine fagemit ambalaj, enfeksiyon için bir canlı hücre popülasyonu hazırlanması ve enfeksiyon kendisi yapmak için yöntemler içerir. floresan protein mKate2 ve antibiyotik direnç geni kloramfenikol asetiltransferaz (CAT) temsilcisi verileri oluşturmak için ve demonte etkinliğini ölçmek için hedeflenir.

Sıvı Ortamda mKate2 Floresans susturma Şekil 1, Srna kaseti tasarım, fagemit vektörleştirme ve susturma mekanizması dahil olmak üzere bu çalışmada tarif Srna aracılı knockdowns için şemayı göstermektedir. protokol 1.2 ardından, plazmid pAB.001 bölgesinin Srna susturulması kaseti mKate hedef değiştirilmiştir. Srna kaseti sentezlenmiş ve fajmid Litmus28i_J23115-B0032-GFP, Monica Ortiz ve Drew EndY 11 bir hediye klonlanmıştır. Bu fagemit başarılı enfeksiyonu takip sağlayan, GFP tanımına ve kanamisin direnci için işaretleri taşır. Ambalajlı fagemit stokları protokole 2 Aşağıdaki hazırlanmıştır. E. bir türevi Bir yapıcı şekilde tanımlanmış, kromozomal olarak entegre mKate2 işaretleyici taşıyan E. coli K12 MG1655 konjugasyon ile faj enfeksiyonu için elde edilmiştir<html> mid log fazı ve fagemid enfeksiyondan sonra protokol 4. Aşağıdaki kişiye fajmid büyütülmüştür protokolü 3. Hücreler, aşağıdaki F plazmid donör soyu ile, 200 | il kültür bir floresan plaka okuyucu aktarılmış ve floresan, 24 saat boyunca sürekli olarak izlenmiştir. Şekil 3, mKate2 ifadesi üzerindeki Srna aracılı susturma etkisini göstermektedir. bir anti-mKate2 fajmid ile enfekte suş arka plan üzerinde saptanabilir mKate2 floresan gösterdi. Bunun aksine, bu suş fajmid başarıyla alımını göstermektedir GFP işaretleyici ifade yaptı. Enfekte olmamış kontrol hücrelerinin mKate2 floresan ancak GFP üretti. Anti-mKate2 hedef alan bir dizi hedef CAT ile ikame edildiği bir ek kontrol, mKate2 floresan üzerinde herhangi bir etki. Ağar Tabaklar üzerinde Kloramfenikol Direniş susturma İçerik: 1 &quot;&gt; protokol 1.1 takiben, Srna susturulması kaseti CAT hedef üretildi&quot; fo tutmak-together.within Sayfa = &quot;kurucu olarak ifade, kromozomal olarak entegre CAT markör için hazırlanan taşıyan E. coli K12 MG1655 bir türevi. protokol 3. hücreler, aşağıdaki F-plazmid donör soyu ile konjugasyon ile faj enfeksiyonu, orta log fazına büyüdükten ve fajmid, 37 ° C&#39;de inkübasyondan 1 saat sonra protokol 4. aşağıdaki kişiye, enfekte olmuş hücreler seri olarak seyreltildi ve kaplanmıştır kloramfenikol konsantrasyonları. Plakalar aralığı gece boyunca inkübe edildi ve her bir kloramfenikol konsantrasyonunda dirençli hücrelerin oranı koloni oluşturan birim (CFU) ertesi gün sayılması ile belirlenmiştir. Şekil 4, kloramfenikol direnç fenotipi Srna aracılı susturma etkisini göstermektedir. fagemit mKate2 hedeflemesi ile enfekte enfekte olmamış hücreleri, ya da hücreler, dirençli olduğutest edilen bütün konsantrasyonlarda kloramfenikol. Bunun aksine, hücre fagemit hedefleme CAT ile enfekte düşük kloramfenikol konsantrasyonlarında hayatta azalma görülmüştür ve yaklaşık% 99 daha yüksek konsantrasyonlarda öldürme. ampisilin eklenmesi, fagemit taşıyan bakterinin sadece seçmek için, tespit edilemez seviyelere kloramfenikol hayatta azaltmıştır. Bu faj enfeksiyonu o kaçış gösteren 10 susturmak kaçmak için ortak bir yol olduğunu daha önceki çalışmaları ile tutarlıdır. <img alt="Şekil 1" src="/files/ftp_upload/53618/53618fig1.jpg" /> Şekil 1: E. gen susturma Srna ifade kasetleri ile E. coli M13 fajı tarafından getirilen Srna kaseti 4 modülden oluşmaktadır. pR promoteri (bakteriyofaj lambda türetilmiş bir kurucu promoter), 24 bp&#39;lik bir hedefleme domeni, bir Hfq bağlama alanı MICC çıkarılır ve bir transkripsiyonel terminatör 8 </&gt; Sup. Kaset M13 f1 replikasyon orijini ihtiva eden bir fajmid dahil edilebilir ve yardımcı faj M13KO7 kullanılarak M13 kapsid paketlenir. Ambalajlı fajmidler E. enfekte edebiliyoruz E. coli Srna ifade başlar F Pilus dile getirdi. Srna sonra (kırmızı tasvir) Hfq proteinini acemi ve translasyonel baskı ve mRNA bozulması sonucu, ribozom bağlanma yeri yakınındaki bir antisens mRNA hedef bağlar. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53618/53618fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53618/53618fig2.jpg" /> Şekil 2:. Primer tasarımı ve Srna hedef bölgeye Site-directed mutagenesis iki primer, mevcut bir Srna kasetine kısmi homolojisi ile tasarlanmıştır. ileri primer, ardından 5 &#39;ucunda PR promoterinin, 20 bp homologu içerenYeni kılavuz sekansı temsil 24 bp 3 &#39;ucunda Hfq bağlanma alanı ile, daha sonra 18 bp homologu. ters primer yeni KILAVUZU dizisinin ters tamamlayıcı yan mevcut Srna kasetine homoloji bölgeleri ile ileri primer tam ters tamamlayıcısıdır. Tam primer sekansları, Tablo 3&#39;te verilmiştir. İleri ve geri primerler ile ayrı tek primeri PCR reaksiyonları istenen tadil edilmiş dizi ile lineer, tek sarmallı DNA üretir. Protokol açıklandığı gibi temiz-up ardından ileri tavlama ve reaksiyon ürünlerini ters istenen modifiye Srna kaseti taşıyan çift sarmallı plazmid DNA sonuçları. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53618/53618fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53618/53618fig3.jpg" /> Şekil 3: KBir kromozomal olarak entegre mKate2 Floresan Reporter nockdown. E. mKate2 ifade coli MG1655 K12 vardı ya sol tedavi edilmezse (kırmızı çizgiler ve barlar), bir anti-mKate2 fajmid (yeşil çizgiler ve çubuklar) ile enfekte veya bir kontrol fajmid hedefleyen CAT (mavi çizgiler ve barlar) ile enfekte. (A) muamele edilmemiş E. koli faj enfeksiyona metabolik maliyeti gösteren yüksek doygunluk yoğunluklarına büyüdü. Noktalı çizgiler 3 çoğaltır standart sapmaları göstermektedir. (B) mKate2 sinyal anti mKate2 yakın düzeylere düşürülmüştür ancak kontrol suşunun, suş işlemden geçirildi. Ayrıca, fajmid tarafından taşınan (C), GFP floresans, sadece fagemit ile tedavi edilen kontrollere saptanabildi. (D, E) büyüme 24 saat OD normalize edildikten sonra Final floresan okumaları. GFP sinyali, fagemit enfeksiyonu gösteren muamele edilmemiş kontrollere yoktu, ama aynı zamanda esas olarak, anti-CAT p aşağıdaki düşükhagemid tedavisi. Bu fajemidin hedef dışı etkiler gösterebilir. mKate2 sinyali muamele edilmemiş kontroller ile karşılaştırıldığında, anti-mKate2 fagemit tedavi azaltılmıştır. CAT-hedefli kontrol fajmid mKate2 floresan üzerinde bir etki göstermemiştir. Hata çubukları 3 çoğaltır standart sapmasını temsil eder. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53618/53618fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 4," src="/files/ftp_upload/53618/53618fig4.jpg" /> Şekil 4: CAT demonte bir Genetiği Dayanıklı Nüfus Kloramfenikol Hassasiyet döndürür E.. Bir kromozomal olarak entegre CAT genini ifade eden E. coli MG1655 K12 mKate2 (yeşil çubuklar) hedefleyen bir kontrol fajmid, tedavi edilmeden (kırmızı çubuklar) sola ya da bir anti-CAT Srna (mavi sütunlar) eksprese eden bir fajmid ile muamele edilmiştir. belirtilen karıncanın 1 enfeksiyonu saat, canlılığı sonraibiotics seri seyreltme ve kaplama ile değerlendirildi. Kontrol tedavi etkilenmemiştir ise, anti-CAT fajmid ile muamele suşlar önemli ölçüde daha yüksek konsantrasyonlarda kloramfenikol ile (&gt;% 90) öldü. kültür plakalarına ekleme ampisilin olumlu fagemit enfeksiyon için seçer ve bulaşmamış hücreleri ortadan kaldırır. Bu koşullar altında, herhangi bir kloramfenikol dirençli koloniler, anti-CAT tedaviden sonra gözlenmiştir. Bu en kurtulan enfeksiyon bir başarısızlık yerine susturma bir arıza temsil ettiğini gösterir. Hata çubukları 3 çoğaltır standart sapmasını temsil eder. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53618/53618fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> CAT hedef sekans </td><td> 5 &#39;- ATGGAGAAAAAAATCACTGGATAT - 3&#39; </td></tr><tr><td> CAT KILAVUZU dizisi </td><td> 5 &#39;- ATATCCAGTGATTTTTTTCTCCAT - 3&#39; </td></tr></tbody></table> Tablo 1:. CAT gen için bir örnek olarak, hedef ve rehber sekans ters tamamlayıcı ilişkiyi not edin. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> pR promoterinin </td><td colspan="5"> TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC </td></tr><tr><td> rehber sekans </td><td colspan="5"> ATATCCAGTGATTTTTTTCTCCAT </td></tr><tr><td> Hfq bağlama alanı </td><td colspan="5"> TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGTCGTCCGGGCTTTTTT TCTCGAG </td></tr><tr><td> T1 / TE sonlandırıcı </td><td colspan="5"> CTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAA CGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA </td></tr></tbody></table>Tablo 2:. Srna Kaset sırası Bileşenleri Her dizisi 5&#39;-3 &#39;yazılır. tam kaset için bu 4 element birleştirme ve 292 bp içermektedir. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> İleri Astar </td><td> 5 &#39;- CTGGCGGTGATAATGGTTGC [REHBER] TTTCTGTTGGGCCATTGC - 3&#39; </td></tr><tr><td> Ters Primer </td><td> 5 &#39;- GCAATGGCCCAACAGAAA [HEDEF] GCAACCATTATCACCGCCAG - 3&#39; </td></tr></tbody></table> Tablo 3: Primer tasarımı, mevcut kılavuz elemanları Alter ileri primer Pr arttırıcının içinden son 20 bp, yeni rehber sekans ve Hfq bağlayıcı alan ilk 18 bp içerir.. HEDEF dizisi KILAVUZU dizisinin tam ters tamamlayıcısıdır. ters primer ileri primer tam ters tamamlayıcısıdır. </p&gt; <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> hacim </td></tr><tr><td> Şablon plazmit </td><td> 500 ng </td></tr><tr><td> 10 mM oncul </td><td> 2.5 ul </td></tr><tr><td> 10 mM dNTP </td><td> 0.4 ul </td></tr><tr><td> Yüksek sadakat Polimeraz (2 U / ul) </td><td> 0.5 ul </td></tr><tr><td> 5x PCR Tampon </td><td> 10 ul </td></tr><tr><td> Toplam ses </td><td> 50 ul </td></tr></tbody></table> Tablo 4: Tek Primer mutajenik PCR için önerilen koşullar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Adım </td><td> Sıcaklık </td><td> Zaman </td></tr><tr><td> ilk denatürasyon </td><td> 98 ° C </td><td> 30 sn </td></tr><tr><td rowspan="3"> 30 döngü </td><td> 98 ° C </td><td> 10 sn </td></tr><tr><td> 55 ° C </td><td> 30 sn </td></tr><tr><td> 72 ° C </td><td> 120 sn </td></tr><tr><td> nihai Uzatma </td><td> 72 ° C </td><td> 300 sn </td></tr><tr><td> Depolama </td><td> 10 ° C </td><td></td></tr></tbody></table> Tablo 5: Tek Primer mutajenik PCR için Termosikler Protokolü önerdi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> hacim </td></tr><tr><td> Şablon DNA, </td><td> 1 ul </td></tr><tr><td> 10 uM Düz Primer </td><td> 0.5 ul </td></tr><tr><td> 10 uM Ters Primer </td><td> 0.5 ul </td></tr><tr><td> Taq 2X Master Mix </td><td> 25 ul </td></tr><tr><td> Nukleazsız water </td><td> 23 ul </td></tr><tr><td> Toplam ses </td><td> 50 ul </td></tr></tbody></table> Tablo 6: Dizi Doğrulama PCR için önerilen koşullar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Adım </td><td> Sıcaklık </td><td> Zaman </td></tr><tr><td> ilk denatürasyon </td><td> 95 ° C </td><td> 30 sn </td></tr><tr><td rowspan="3"> 30 döngü </td><td> 95 ° C </td><td> 30 sn </td></tr><tr><td> 55 ° C </td><td> 30 sn </td></tr><tr><td> 68 ° C </td><td> 30 sn </td></tr><tr><td> nihai Uzatma </td><td> 68 ° C </td><td> 300 sn </td></tr><tr><td> Depolama </td><td> 10 ° C </td><td></td></tr></tbody></table> Tablo 7: Termosikler Pro ÖnerilenDizi Doğrulama PCR için tokol.

Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Hedeflenen Srna faj aracılı teslim Gen İfade Knock Down için oluşturur<em&gt; E. E. coli</em

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

phage-mediated-delivery-targeted-srna-constructs-to-knock-down-gene

Nanyang Technological University

Research

JoVE Journal

Biology

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

12.5K Görüntüleme.  Institut National de la Santé et de la Recherche Médicale (INSERM), Université Paris Descartes. We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Video: Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Hazırlık Elektroporasyon murin Kemik İliği itibaren İlköğretim Hematopoetik Hücre Kültürleri

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Biyoloji

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

Yüksek Verimli Primer Hücre Transfect Gen Verici MXcell Elektroporasyon Sistemi

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, compromising downstream analyses. Considering the complex and dynamic cellular associations existing within many tissues, in order to recapitulate the in vivo interactions thorough molecular analysis one must be able to analyze specific cell populations within their native context. Laser-mediated microdissection can achieve this goal, allowing unambiguous identification and successful harvest of cells of interest under direct microscopic visualization while maintaining molecular integrity. We have applied this technology to analyse gene expression within defined areas of the developing Drosophila wing disc, which represents an advantageous model system to study growth control, cell differentiation and organogenesis. Larval imaginal discs are precociously subdivided into anterior and posterior, dorsal and ventral compartments by lineage restriction boundaries. Making use of the inducible GAL4-UAS binary expression system, each of these compartments can be specifically labelled in transgenic flies expressing an UAS-GFP transgene under the control of the appropriate GAL4-driver construct. In the transgenic discs, gene expression profiling of discrete subsets of cells can precisely be determined after laser-mediated microdissection, using the fluorescent GFP signal to guide laser cut. 
Among the variety of downstream applications, we focused on RNA transcript profiling after localised RNA interference (RNAi). With the advent of RNAi technology, GFP labelling can be coupled with localised knockdown of a given gene, allowing to determinate the transcriptional response of a discrete cell population to the specific gene silencing. To validate this approach, we dissected equivalent areas of the disc from the posterior (labelled by GFP expression), and the anterior (unlabelled) compartment upon regional silencing in the P compartment of an otherwise ubiquitously expressed gene. RNA was extracted from microdissected silenced and unsilenced areas and comparative gene expression profiling determined by quantitative real-time RT-PCR. We show that this method can effectively be applied for accurate transcriptomics of subsets of cells within the Drosophila imaginal discs. Indeed, while massive disc preparation as source of RNA generally assumes cell homogeneity, it is well known that transcriptional expression can vary greatly within these structures in consequence of positional information. Using localized fluorescent GFP signal to guide laser cut, more accurate transcriptional analyses can be performed and profitably applied to disparate applications, including transcript profiling of distinct cell lineages within their native context.

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Laser microdissection was applied to analyse gene expression profiling in specific compartments of Drosophila wing disc subjected to localised RNAi in vivo. RNA extracted from equivalent areas of silenced and unsilenced compartments was analysed by quantitative RT-PCR to determine comparative gene expression profiling within the context of native tissue microecology.

Lazer Diseksiyon hücreleri Altküme Kaynak gösterilmeden Uygulanan Drosophila Kanat Disk

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

Gen İfadesi Çalışmaları basitleştirin Otomatik Hücre Sayıcı kullanma: Namalwa Hücreler IL-4 Bağımlı Gen İfadesi siRNA demonte

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

Proteinlerin Yönetmen Evolution Mutagenez ve Fonksiyonel Seçim Protokolleri E. coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Active T. in vitro Sulandırma castaneum Telomeraz

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

Ününüz Aşağıdaki Tek Hücre Düzeyinde Küresel RNA Sentezi Analizi

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

Üretilen Rekombinant Disülfid zengin Venom Proteinler Uygulanan Yüksek Randımanlı Sayısal Anlatım Tarama ve Arıtma<em&gt; E. coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Transient Expression of Proteins by Hydrodynamic Gene Delivery in Mice

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past years, hydrodynamic gene delivery (HGD) has emerged as a simple, fast, safe and effective method for delivering transgenes into rodents. This technique relies on the force generated by the rapid injection of a large volume of physiological solution to increase the permeability of cell membranes of perfused organs and thus deliver DNA into cells. One of the main advantages of HGD is the ability to introduce transgenes into mammalian cells using naked plasmid DNA (pDNA). Introducing an exogenous gene using a plasmid is minimally laborious, highly efficient and, contrary to viral carriers, remarkably safe. HGD was initially used to deliver genes into mice, it is now used to deliver a wide range of substances, including oligonucleotides, artificial chromosomes, RNA, proteins and small molecules into mice, rats and, to a limited degree, other animals. This protocol describes HGD in mice and focuses on three key aspects of the method that are critical to performing the procedure successfully: correct insertion of the needle into the vein, the volume of injection and the speed of delivery. Examples are given to show the application of this method to the transient expression of two genes that encode secreted, primate-specific proteins, apolipoprotein L-I (APOL-I) and haptoglobin-related protein (HPR).

In vivo transfection of naked DNA by hydrodynamic gene delivery introduces genes into the tissue of an animal with minimal inflammatory response. Sufficient amounts of gene product are generated such that gene function and regulation as well as protein structure and function can be analyzed.

Farelerde Hidrodinamik Gen Taşıyıcı Proteinlerin Geçici İfadesi

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Kültür Memeli Hücrelerde Biyolojik tanımında ubikitin ve Ubiquitin benzeri Sistemi Regülatörleri tanımak siRNA Eleme

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...