Biz Ron Davis, Adam Deutschbauer, ve tüm HIP HOP laboratuar Toronto Üniversitesi&#39;nde tartışmalar ve öneriler için teşekkür ederim. CN, Ulusal İnsan Genomu Araştırma Enstitüsü (Grant Numarası HG000205), RO1 HG003317 CIHR MOP-84.305, ve Kanada Kanser Derneği (020.380) hibe ile desteklenmektedir. JO Stanford Genom Eğitim Programı (Hibe Numarası T32 HG00044 Ulusal İnsan Genomu Araştırma Enstitüsü) ve Ulusal Sağlık Enstitüleri (Hibe Numarası P01 GH000205) tarafından desteklenmiştir. GG, Kanadalı Dr Yenilik Vakfı hibe tarafından kısmen desteklenen NHGRI RO1 HG003317 ve Kanada Kanser Derneği, Grant # 020.380, TD ve Donnelly Sıralama Merkezi tarafından desteklenmektedir. Brenda Andrews ve Jack Greenblatt. AMS, Toronto açın Bursu bir Üniversitesi tarafından desteklenmektedir.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

Çıkar çatışması ilan etti.

Burada, biz Etiketli mutant koleksiyonları oluşturmak için farklı mikroorganizmaların barkodlu mutant koleksiyonları mevcut koleksiyonları geniş bir yelpazede kolayca adapte edilebilir, mütevazı bir değişiklik ile bir protokol sıraladı. Patojenik maya C etiketli transposon mutagenez bir protokol bildirdin Biz vurgulamak albicans, çok benzer bir protokol, tek hücreli mantarlar geniş bir yelpazede adapte olabilir . Modifiye Bu protokol, bakteri 13 iyi çalışıyor ve şu anda ek fungal ve bakteriyel genomların bir dizi koleksiyonları yapım aşamasındadır . Şu anda, bu testte, gen-küçük molekül etkileşimleri için tek kapsamlı, genom tarafsız ekran sağlar. Testinin özellikle ikna edici bir özelliği gen ya da küçük molekül hiçbir ön bilgi gerekli olmasıdır. Bu testlerin kapsam ve gücüne rağmen, diğer laboratuarlara aktarılabilirliği sonuçların analizi için başlangıç ​​sermayesi yatırım ve bilişim araçları ile biraz engellemiştir. Analizi için güçlü araçlar ile birlikte bir sonraki nesil dizisi okuma kabulü ile, onların evlat edinme artmasını bekliyoruz.

<table border="1"><tbody><tr><td> Antibiyotikler </td><td> Satıcı ve katalog numaraları </td></tr><tr><td> Carbenicillin </td><td> Sigma, part # C1613 </td></tr><tr><td> Kanamisin </td><td> Sigma, part # K1876 </td></tr><tr><td> spectinomycin </td><td> Sigma, part # S0692 </td></tr><tr><td> Kloramfenikol </td><td> Sigma, part # C0378 </td></tr><tr><td> DNA Temizlik-up ve konsantrasyon kitleri </td><td></td></tr><tr><td> QIAprep Spin Miniprep Kiti </td><td> Qiagen, part # 27.106 </td></tr><tr><td> HiSpeed ​​Plazmid Maxi Seti </td><td> Qiagen, part # 12.663 </td></tr><tr><td> QIAquick PCR Arıtma Kiti </td><td> Qiagen, parçası # 28106 </td></tr><tr><td> QIAquick Jel Ekstraksiyon Seti </td><td> Qiagen, part # 28.704 </td></tr><tr><td> PCR ve elektroforez reaktifler </td><td></td></tr><tr><td> Taq DNA Polimeraz (Mg-serbest) Tampon </td><td> New England Biolabs, part # M0320L </td></tr><tr><td> Deoksinükleotid Çözüm Mix </td><td> New England Biolabs, part # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, part # 63.036 </td></tr><tr><td> Agaroz yükleme, boya, ve nükleik asit jel elektroforezi için uygun leke </td><td> Çeşitli </td></tr><tr><td> 10X TAE tampon </td><td> Sigma, part # T8280 </td></tr><tr><td> 1 Kb Plus DNA Ladder </td><td> Invitrogen, parçası # 10787026 </td></tr><tr><td> YPD suyu </td><td></td></tr><tr><td> 10 g maya özü </td><td> Sigma, part # Y1625 </td></tr><tr><td> 20 g Bacto pepton </td><td> BD Biosciences, part # 211.677 </td></tr><tr><td> 20 g dekstroz </td><td> Sigma, part # D9434 </td></tr><tr><td> Laboratuvar </td><td></td></tr><tr><td> Çok kanallı pipetler (1000, 200, ve 20 mcL) </td><td> Çeşitli </td></tr><tr><td> Tek kullanımlık pipetleme rezervuarları </td><td> Çeşitli </td></tr><tr><td> 15 ve 50 ml santrifüj tüplerine </td><td> Çeşitli </td></tr><tr><td> 96 - ve 384-Eh Derin Şey Tabaklar </td><td> Axygen Bilimsel parçası # P-2ml-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> 96-ve 384-iyi PCR plakaları ve mühür filmi </td><td> Çeşitli </td></tr><tr><td> Plaka silindir, conta çok iyi plakaları için </td><td> Sigma, part # R1275 </td></tr><tr><td> 30 ° C ve 37 ° C plakalar üzerinde bakteri ve maya büyüyen ve tüpler sallayarak inkübatörler </td><td> Çeşitli </td></tr><tr><td> In vitro transpozon mutagenez </td><td></td></tr><tr><td> EZ-Tn5 Transposase </td><td> Epicentre Biyoteknoloji, part # TNP92110 </td></tr><tr><td> Yüksek verim dönüşüm </td><td></td></tr><tr><td> Seqprep 96 HT Plazmid Hazırlık Seti </td><td> Kenar Biosystems, part # 84.359 </td></tr><tr><td> polietilen glikol, moleküler ağırlığı 3350 </td><td> Çeşitli </td></tr><tr><td> Lityum asetat </td><td> Sigma, part # 517.992 </td></tr><tr><td> Steril, tabak 6-iyi </td><td> Corning, part # 3335 </td></tr><tr><td> 50 mg / ml üridin </td><td> Sigma, part # U3750 </td></tr><tr><td> 100X Tris-EDTA tampon çözelti </td><td> Sigma, part # T9285 </td></tr><tr><td> 1x TE/0.1M LiOAc </td><td> Çeşitli </td></tr><tr><td> somon testis DNA </td><td> Sigma, part # 1626 </td></tr><tr><td> Barkodlu koleksiyonları Büyüme </td><td></td></tr><tr><td> 48 kuyucuğu; plakalar kültürlerin büyüyen eğer </td><td> Greiner, part # M9437 </td></tr><tr><td> Yapışkan levha contaları </td><td> ABgene, kısmen # AB-0580 </td></tr><tr><td> 200 mL kültür matara </td><td> Çeşitli </td></tr><tr><td> Absorbans yetenekli Spektrofotometre </td><td> Çeşitli </td></tr><tr><td> 250 ml&#39;lik şişeler veya sallayarak spektrofotometre ısı kontrollü çalkalayıcı </td><td> Çeşitli </td></tr><tr><td> Güvenli-Lock Mikrosantrifüj Tüp, 2 mL </td><td> Eppendorf, kısmen # 0030 120.094 </td></tr><tr><td> Hibridizasyon ekipman </td><td></td></tr><tr><td> Hibridizasyon Fırını 640 </td><td> Affymetrix, part # 800.138 </td></tr><tr><td> GeneChip akışkan İstasyonu 450 </td><td> Affymetrix, parça # 00-0079 </td></tr><tr><td> GeneArray Tarayıcı 3000 </td><td> Affymetrix, parça # 00-0212 </td></tr><tr><td> Kayan kabinle birlikte Kaynar su banyosu </td><td> Çeşitli </td></tr><tr><td> Hibridizasyon sarf </td><td></td></tr><tr><td> Genflex Etiket 16K Dizi v2 </td><td> Affymetrix, part # 511.331 </td></tr><tr><td> Denhardt Çözüm 50X konsantre </td><td> Sigma, part # D2532 </td></tr><tr><td> Streptavidin, Ar-fikoeritrin konjuge (SAPE) </td><td> Invitrogen, part # S866 </td></tr><tr><td> Güvenli-Lock Mikrosantrifüj Tüp, 0,5 mL </td><td> Eppendorf, kısmen # 0030 123.301 </td></tr><tr><td> Ufacık Tough-Spotlar </td><td> Çeşitlendirilmiş Biotech, part # LTTM-1000 </td></tr><tr><td> 0.5 M EDTA </td><td> BioRad, part # 161-0729 </td></tr><tr><td> 10% Tween </td><td> Sigma, part # T2700 </td></tr><tr><td> MES serbest asit monohidrat </td><td> Sigma, part # M5287 </td></tr><tr><td> MES sodyum tuzu </td><td> Sigma, part # M5057 </td></tr><tr><td> 5 M NaCl </td><td> Sigma, part # 71.386 </td></tr><tr><td> 20X SSPE </td><td> Sigma, part # S2015 </td></tr><tr><td> Moleküler biyoloji notu suyu </td><td> Sigma, part # W4502 </td></tr><tr><td> Hibridizasyon Astarlar </td><td> Çeşitli tedarikçileri (standart tuzsuzlaştırma) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;biotin GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;biotin GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;biotin CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;3 GTCGACCTGCAGCGTACG&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 3 5&#39;CTACGAGACCGACACCG &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Sıralama Astarlar: Illumina Platformu </td><td> Çeşitli tedarikçilerden </td></tr><tr><td> UpTag İleri (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T GAT GTC CAC GAG GTC TCT 3&#39; </td></tr><tr><td> UpTag Ters (100uM) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT TTK CTA CAC GAC GCT CTT CCG ATC T nnnnn GTC GAC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> DownTag İleri (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T GAA AAC GAG CTC GAA TTC ATC G 3&#39; </td></tr><tr><td> DownTag Ters (100uM) </td><td> 5 &#39;AAT GAT ACG GCG ACC ACC GAC ACT CTT TTK CTA CAC GAC GCT CTT CCG ATC T nnnnn CGG TGT CGG TCT CGT AG, 3 ` </td></tr><tr><td> 1 okuyun UP-tag sıra astar (100uM) </td><td> 5 &#39;GTC GAC CTG CAG CGT ACG 3&#39; </td></tr><tr><td> 1 AŞAĞI-etiket sıra astar (100uM) </td><td> 3 5 &#39;CGG TGT CGG TCT CGT AG&#39; </td></tr><tr><td> 2 Endeksi Sıralama astar (standart Illumina R1 astar) (100uM) </td><td> 5 &#39;AC ACT CTT TTK CTA CAC GAC GCT CTT CCG ATC T 3&#39; </td></tr><tr><td> Ek Sıralama Reaktifler / Ekipman </td><td></td></tr><tr><td> Qiagen MinElute 96 UF PCR arıtma Takımı </td><td> Qiagen, part # 29.051 </td></tr><tr><td> Vakum pompası </td><td> Herhangi bir satıcı </td></tr><tr><td> Macherey-Nagel Vakum Manifold </td><td> Macherey-Nagel, kısmen # 740 681 </td></tr><tr><td> Invitrogen Quant-iT dsDNA BR Assay Kit </td><td> Invitrogen, part # Q32853 </td></tr><tr><td> Invitrogen Qubit tahlil tüpleri </td><td> Invitrogen, part # Q32856 </td></tr><tr><td> % 40 akrilamid artı% 1 N, N&#39;-metilen-bis-akrilamid, 37.5:1 </td><td> Bio Rad, part # 161-0148 </td></tr><tr><td> Tris Base </td><td> Sigma, part # T1503-1KG </td></tr><tr><td> Borik Asit </td><td> Sigma, part # B6768-500G </td></tr><tr><td> 0,5 M EDTA, pH 8.0 </td><td> Teknova, part # E0306 </td></tr><tr><td> Amonyum persulfate </td><td> Sigma, part # A3678-25G </td></tr><tr><td> TEMED </td><td> Bioshop, part # TEM001.25 </td></tr><tr><td> Ethidium Bromür Çözümü </td><td> Bioshop, part # ETB444.10 </td></tr><tr><td> 0,5 M amonyum asetat </td><td> Teknova, part # A2000 </td></tr><tr><td> 10mM Magnezyum asetat tetrahidrat </td><td> Sigma, part # M0631-100G </td></tr><tr><td> 1mm EDTA, pH 8.0 </td><td> 0,5 M EDTA, pH 8.0 </td></tr><tr><td> Etanol </td><td> Çeşitli </td></tr><tr><td> Sodyum asetat, pH 5.2 </td><td> Teknova, part # S0297 </td></tr><tr><td> Hız vakum </td><td> Çeşitli </td></tr><tr><td> Tek-Read Küme Üretimi Kiti </td><td> Illumina, kısmen # GD-300-1001 </td></tr><tr><td> V4 36C Sıralama Seti </td><td>Illumina, part # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> 10x TBE tarifi <table border="1"><tbody><tr><td> Tutarlar </td><td> Reaktifler </td></tr><tr><td> 108 gram </td><td> Tris Base </td></tr><tr><td> 55 gram </td><td> Borik Asit </td></tr><tr><td> 40ml </td><td> 0,5 M EDTA (pH 8.0) </td></tr><tr><td colspan="2"> DH 2 O 1L işareti </td></tr></tbody></table> % 12 Poliakrilamid jel tarifi <table border="1"><tbody><tr><td> Hacimleri </td><td> Reaktifler </td></tr><tr><td> 5.8 ml </td><td> % 40 akrilamid artı% 1 N, N&#39;-metilen-bis-akrilamid, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> 10X TBE </td></tr><tr><td> 140 ul </td><td> % 10 amonyum persülfat </td></tr><tr><td> Toplam hacmi: 20ml </td><td></td></tr></tbody></table> Uptag astar karışımı: Süspanse edin Uptag ve GKD 2 O Buptagkanmx4 her 100 mcM, daha sonra her biri 50 mcM nihai bir konsantrasyon 1:1 oranında karıştırın . -20 ° C&#39;de muhafaza Downtag astar karışımı: Süspanse edin Dntag ve Bdntagkanmx4 her biri 100 mcM GKD 2 O, sonra 50 mcM her son bir konsantrasyon için 1:1 oranında karıştırın . -20 ° C&#39;de muhafaza Karışık oligonükleotidler: 100 mcM GKD 2 O her aşağıdaki sekiz oligos (standart desalted) süspanse edin: Uptag,,, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. 12.5 mcM her son bir konsantrasyon için sekiz oligonükleotidler bir eşit miktarda karıştırın. 12X MES stok: 10 ml için 0.7 g MES serbest asit monohidrat ve 1.93 g MES sodyum tuzu, 8 ml moleküler biyoloji notu su çözülür. Iyi karıştırıldıktan sonra, pH ve pH 6,5-6,7 gerekirse ayarlayabilirsiniz. Toplam hacim 10 ml su ekleyin. Sterilize Filtre ve 4 saklamak ° C ışığı (örneğin, folyo tüp sarın) karşı korumalıdır. Çözüm, gözle görülür bir şekilde sarı veya 6 ay sonra hale gelmesi durumunda değiştirin. 2X Hibridizasyon tamponu: 50 ml, 8.3 ml (2.9.14) 12X (MES) hisse senetleri, 5 M NaCl, 4.0, 0.5 M EDTA, 0.1 ml% 10 Tween 20 (hacim / hacim) ml, ve 19.9 ml GKD süzülmüş 17.7 ml karıştırmak 2 O. Sterilize Filtresi. A Yıkama: Mix 300 ml 20X SSPE, 1 ml% 10 Tween (hacim / hacim), 699 ml GKD 2 O. Sterilize Filtresi. Yıkama B: Mix 150 ml 20X SSPE, 1 ml% 10 Tween (hacim / hacim), 849 ml GKD 2 O. Sterilize Filtresi. Barkod sıralama primerler UP-etiket astar dizileri 5 &#39;kuyruk (kalın), F ve R astar dahil Illumina belirli bir bağdaştırıcı dizileri . Değişken dizisi (italik), dizin / çoğullama okuma kullanılan 5-mer indeksleme etiketi temsil eder . 3 &#39;kuyruk (altı çizili) uptag barkod kuşatan ortak astar temsil eder ve maya barkod yükseltmek için gereklidir. AŞAĞI-tag astar 5 Ancak, 3 &#39;kuyruk (altı çizili) yükseltmek için kullanılan ortak primerler ile değiştirilir, UP-tag primerler (Illumina dizisi) kuyruk kuyruk 5 özdeş&#39; dizileri AŞAĞI etiketi barkod.

competitive genomic screens of barcoded yeast libraries

Yeni nesil sıralama teknolojilerindeki gelişmeler sayesinde, neredeyse her gün yeni gen dizilimlerini erişimi var. Bu gelişmelerin temposu hızlanıyor, daha fazla derinlik ve genişlik umut verici. Bu olağanüstü gelişmelerin ışığında, genin işlevini tanımlamak için hızlı, paralel yöntemleri için ihtiyaç her zamankinden daha önemli hale gelir. Maya ve E. genom silme mutantlar koleksiyonları coli gen fonksiyon fonksiyonel karakterizasyonu için beygirleri olarak hizmet etmiş, ancak bu yaklaşım ölçeklenebilir değildir, mevcut gen silme yaklaşımları silinir ve doğrulanabilir bir genomu oluşturan genlerin her biri binlerce gerektirir. Bu çalışma tamamlandıktan sonra, biz yüksek verim fenotipleme takip edebilirsiniz. Geçtiğimiz on yıl boyunca, laboratuar, rekabetçi, minyatür, yüksek verimli genomu paralel olarak yapılabilir testleri geniş bir portföy rafine vardır. Bu paralelizasyon barkod mutasyonu için bir vekil olarak hizmet, çünkü DNA &#39;etiketler&#39;, ya da her bir mutant haline &#39;barkod&#39; dahil edilmesi mümkündür ve bir mutant spor değerlendirmek için barkod bolluk ölçebilirsiniz. Bu çalışmada, DNA dizisi ve barkodlu mutant koleksiyonları arasındaki boşluğu doldurmak için çalışırlar. Bunu başarmak için yeni dizisi paralel barkod deneyleri kadar açılır, ancak zayıf mikropların karakterize bir kombine transposon kesintisiz barkodlama yaklaşımı tanıtmak. Bu yaklaşım göstermek için yeni bir Candida albicans barkodlu bozulması koleksiyonunu sergilemek ve hem mikroarray tabanlı ve yeni nesil sıralama tabanlı platformlar 10,000 toplamak için nasıl kullanılabileceğini tarif - 1.000.000, gen-gen ve ilaç-gen etkileşimleri tek bir deney .

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Biz gen-ilaç ve gen-çevre etkileşimleri anlamak için kapsamlı, tarafsız genom ekranlar geliştirdik. Bu mutant koleksiyonlarını tarama yöntemleri sunulmaktadır.

Barkodlu Maya Kütüphaneler Rekabet Genomik Ekranlar

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

competitive-genomic-screens-of-barcoded-yeast-libraries

Nanyang Technological University

Research

JoVE Journal

Biology

18.2K Görüntüleme.  University of Toronto. Biz gen-ilaç ve gen-çevre etkileşimleri anlamak için kapsamlı, tarafsız genom ekranlar geliştirdik. Bu mutant koleksiyonlarını tarama yöntemleri sunulmaktadır.

Video: Competitive Genomic Screens of Barcoded Yeast Libraries

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing high-throughput short-read DNA sequencing. The resulting sequence datasets can not only track what genes in a population that are enriched during selection for positive yeast 2-hybrid interactions, but also give detailed information about the relevant subdomains of proteins sufficient for interaction. Here, we describe a full suite of stand-alone software programs that allow non-experts to perform all the bioinformatics and statistical steps to process and analyze DNA sequence fastq files from a batch yeast 2-hybrid assay. The processing steps covered by these software include: 1) mapping and counting sequence reads corresponding to each candidate protein encoded within a yeast 2-hybrid prey library; 2) a statistical analysis program that evaluates the enrichment profiles; and 3) tools to examine the translational frame and position within the coding region of each enriched plasmid that encodes the interacting proteins of interest.

Deep sequencing of yeast populations selected for positive yeast 2-hybrid interactions potentially yields a wealth of information about interacting partner proteins. Here, we describe the operation of specific bioinformatics tools and customized updated software to analyze sequence data from such screens.

Sıralı veri--dan toplu Maya 2-hibrid perde Bilişim Analizi

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

Genetik

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Maya Overexpression çiftleşme tabanlı Kütüphane tarama

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

A Yeast 2-Hybrid Screen in Batch to Compare Protein Interactions

Screening for protein-protein interactions using the yeast 2-hybrid assay has long been an effective tool, but its use has largely been limited to the discovery of high-affinity interactors that are highly enriched in the library of interacting candidates. In a traditional format, the yeast 2-hybrid assay can yield too many colonies to analyze when conducted at low stringency where low affinity interactors might be found. Moreover, without a comprehensive and complete interrogation of the same library against different bait plasmids, a comparative analysis cannot be achieved. Although some of these problems can be addressed using arrayed prey libraries, the cost and infrastructure required to operate such screens can be prohibitive. As an alternative, we have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing a strategy termed DEEPN (Dynamic Enrichment for Evaluation of Protein Networks), which incorporates high-throughput DNA sequencing and computation to follow the evolution of a population of plasmids that encode interacting partners. Here, we describe customized reagents and protocols that allow a DEEPN screen to be executed easily and cost-effectively.

Batch processing of yeast 2-hybrid screens allows for direct comparison of the interaction profiles of multiple bait proteins with a highly complex set of prey fusion proteins. Here, we describe refined methods, new reagents, and how to implement their use for such screens.

Bir Maya 2-melez ekran Protein etkileşimleri karşılaştırmak için bir toplu iş

Screening for protein-protein interactions using the yeast 2-hybrid assay has long been an effective tool, but its use has largely been limited to the ...

Biyokimya

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

Fisyon mayası Schizosaccharomyces pombe derin sıralama yoluyla, kendiliğinden bastırıcı ekran

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

High-throughput Yeast Plasmid Overexpression Screen

The budding yeast, Saccharomyces cerevisiae, is a powerful model system for defining fundamental mechanisms of many important cellular processes, including those with direct relevance to human disease. Because of its short generation time and well-characterized genome, a major experimental advantage of the yeast model system is the ability to perform genetic screens to identify genes and pathways that are involved in a given process. Over the last thirty years such genetic screens have been used to elucidate the cell cycle, secretory pathway, and many more highly conserved aspects of eukaryotic cell biology 1-5. In the last few years, several genomewide libraries of yeast strains and plasmids have been generated 6-10. These collections now allow for the systematic interrogation of gene function using gain- and loss-of-function approaches 11-16. Here we provide a detailed protocol for the use of a high-throughput yeast transformation protocol with a liquid handling robot to perform a plasmid overexpression screen, using an arrayed library of 5,500 yeast plasmids. We have been using these screens to identify genetic modifiers of toxicity associated with the accumulation of aggregation-prone human neurodegenerative disease proteins. The methods presented here are readily adaptable to the study of other cellular phenotypes of interest.

Here we describe a plasmid overexpression screen in Saccharomyces cerevisiae, using an arrayed plasmid library and a high-throughput yeast transformation protocol with a liquid handling robot.

Yüksek verim Maya Plazmid overekspresyonu Ekran

The budding yeast, Saccharomyces cerevisiae, is a powerful model system for defining fundamental mechanisms of many important cellular processes, ...

Biyoloji

A Quantitative Fitness Analysis Workflow

Quantitative Fitness Analysis (QFA) is an experimental and computational workflow for comparing fitnesses of microbial cultures grown in parallel1,2,3,4. QFA can be applied to focused observations of single cultures but is most useful for genome-wide genetic interaction or drug screens investigating up to thousands of independent cultures. The central experimental method is the inoculation of independent, dilute liquid microbial cultures onto solid agar plates which are incubated and regularly photographed. Photographs from each time-point are analyzed, producing quantitative cell density estimates, which are used to construct growth curves, allowing quantitative fitness measures to be derived. Culture fitnesses can be compared to quantify and rank genetic interaction strengths or drug sensitivities. The effect on culture fitness of any treatments added into substrate agar (e.g. small molecules, antibiotics or nutrients) or applied to plates externally (e.g. UV irradiation, temperature) can be quantified by QFA.
The QFA workflow produces growth rate estimates analogous to those obtained by spectrophotometric measurement of parallel liquid cultures in 96-well or 200-well plate readers. Importantly, QFA has significantly higher throughput compared with such methods. QFA cultures grow on a solid agar surface and are therefore well aerated during growth without the need for stirring or shaking.
QFA throughput is not as high as that of some Synthetic Genetic Array (SGA) screening methods5,6. However, since QFA cultures are heavily diluted before being inoculated onto agar, QFA can capture more complete growth curves, including exponential and saturation phases3. For example, growth curve observations allow culture doubling times to be estimated directly with high precision, as discussed previously1.
Here we present a specific QFA protocol applied to thousands of S. cerevisiae cultures which are automatically handled by robots during inoculation, incubation and imaging. Any of these automated steps can be replaced by an equivalent, manual procedure, with an associated reduction in throughput, and we also present a lower throughput manual protocol. The same QFA software tools can be applied to images captured in either workflow.
We have extensive experience applying QFA to cultures of the budding yeast S. cerevisiae but we expect that QFA will prove equally useful for examining cultures of the fission yeast S. pombe and bacterial cultures.

Quantitative Fitness Analysis (QFA) is a complementary series of experimental and computational methods for estimating microbial culture fitnesses. QFA estimates the effect of genetic mutations, drugs or other applied treatments on microbe growth. Experiments scaling from focussed analysis of single cultures to thousands of parallel cultures can be designed.

Kantitatif Spor Analizi İş Akışı

Quantitative Fitness Analysis (QFA) is an experimental and computational workflow for comparing fitnesses of microbial cultures grown in parallel1,2,3,4. ...

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Determining the mode of action of bioactive chemicals is of interest to a broad range of academic, pharmaceutical, and industrial scientists. Saccharomyces cerevisiae, or budding yeast, is a model eukaryote for which a complete collection of ~6,000 gene deletion mutants and hypomorphic essential gene mutants are commercially available. These collections of mutants can be used to systematically detect chemical-gene interactions, i.e. genes necessary to tolerate a chemical. This information, in turn, reports on the likely mode of action of the compound. Here we describe a protocol for the rapid identification of chemical-genetic interactions in budding yeast. We demonstrate the method using the chemotherapeutic agent 5-fluorouracil (5-FU), which has a well-defined mechanism of action. Our results show that the nuclear TRAMP RNA exosome and DNA repair enzymes are needed for proliferation in the presence of 5-FU, which is consistent with previous microarray based bar-coding chemical genetic approaches and the knowledge that 5-FU adversely affects both RNA and DNA metabolism. The required validation protocols of these high-throughput screens are also described.

Rapid Identification of Chemical Genetic Interactions in Saccharomyces cerevisiae

Here we present a cost-effective method for defining chemical-genetic interactions in budding yeast. The approach is built on fundamental techniques in yeast molecular biology and is well suited for the mechanistic interrogation of small to medium collections of chemicals and other media environments.

Kimyasal Genetik Etkileşimleri Hızlı Kimlik<em&gt; Saccharomyces cerevisiae</em

Determining the mode of action of bioactive chemicals is of interest to a broad range of academic, pharmaceutical, and industrial scientists. ...

Directed Evolution Method in Saccharomyces cerevisiae: Mutant Library Creation and Screening

Directed evolution in Saccharomyces cerevisiae offers many attractive advantages when designing enzymes for biotechnological applications, a process that involves the construction, cloning and expression of mutant libraries, coupled to high frequency homologous DNA recombination in vivo. Here, we present a protocol to create and screen mutant libraries in yeast based on the example of a fungal aryl-alcohol oxidase (AAO) to enhance its total activity. Two protein segments were subjected to focused-directed evolution by random mutagenesis and in vivo DNA recombination. Overhangs of ~50 bp flanking each segment allowed the correct reassembly of the AAO-fusion gene in a linearized vector giving rise to a full autonomously replicating plasmid. Mutant libraries enriched with functional AAO variants were screened in S. cerevisiae supernatants with a sensitive high-throughput assay based on the Fenton reaction. The general process of library construction in S. cerevisiae described here can be readily applied to evolve many other eukaryotic genes, avoiding extra PCR reactions, in vitro DNA recombination and ligation steps.

Directed Evolution Method in Saccharomyces cerevisiae: Mutant Library Creation and Screening

We present a detailed protocol to construct and screen mutant libraries for directed evolution campaigns in Saccharomyces cerevisiae.

Evrim Yöntemi yönettiği<em&gt; Saccharomyces cerevisiae</em&gt;: Mutant Kütüphane Oluşturma ve Tarama

Directed evolution in Saccharomyces cerevisiae offers many attractive advantages when designing enzymes for biotechnological applications, a process that ...

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived inheritance encoded in protein conformation (rather than sequence) has long been viewed as paradigm-shifting but rare. The best characterized examples of such epigenetic elements are prions, which possess a self-assembling behavior that can drive the heritable manifestation of new phenotypes. Many archetypal prions display a striking N/Q-rich sequence bias and assemble into an amyloid fold. These unusual features have informed most screening efforts to identify new prion proteins. However, at least three known prions (including the founding prion, PrPSc) do not harbor these biochemical characteristics. We therefore developed an alternative method to probe the scope of protein-based inheritance based on a property of mass action: the transient overexpression of prion proteins increases the frequency at which they acquire a self-templating conformation. This paper describes a method for analyzing the capacity of the yeast ORFeome to elicit protein-based inheritance. Using this strategy, we previously found that &gt;1% of yeast proteins could fuel the emergence of biological traits that were long-lived, stable, and arose more frequently than genetic mutation. This approach can be employed in high throughput across entire ORFeomes or as a targeted screening paradigm for specific genetic networks or environmental stimuli. Just as forward genetic screens define numerous developmental and signaling pathways, these techniques provide a methodology to investigate the influence of protein-based inheritance in biological processes.

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

This protocol describes a high-throughput methodology to functionally screen for protein-based inheritance in S. cerevisiae.

S. cerevisiae Protein bazlı miras için yüksek üretilen iş tarama

The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived ...

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

Identification of genetic interactions is a powerful tool to decipher the functions of gene(s) by providing insights into their functional relationships with other genes and organization into biological pathways and processes. Although the majority of the genetic screens were initially developed in Saccharomyces cerevisiae, a complementary platform for carrying out these genetic screens has been provided by Schizosaccharomyces pombe. One of the common approaches used to identify genetic interactions is by overexpression of clones from a genome-wide, high-copy-number plasmid library in a loss-of-function mutant, followed by selection of clones that suppress the mutant phenotype.
This paper describes a protocol for carrying out this &#39;multicopy suppression&#39;-based genetic screen in S. pombe. This screen has helped identify multicopy suppressor(s) of the genotoxic stress-sensitive phenotype associated with the absence of the Ell1 transcription elongation factor in S. pombe. The screen was initiated by transformation of the query ell1 null mutant strain with a high-copy-number S. pombe cDNA plasmid library and selecting the suppressors on EMM2 plates containing 4-nitroquinoline 1-oxide (4-NQO), a genotoxic stress-inducing compound. Subsequently, plasmid was isolated from two shortlisted suppressor colonies and digested by restriction enzymes to release the insert DNA. Plasmids releasing an insert DNA fragment were retransformed into the ell1 deletion strain to confirm the ability of these suppressor plasmid clones to restore growth of the ell1 deletion mutant in the presence of 4-NQO and other genotoxic compounds. Those plasmids showing a rescue of the deletion phenotype were sequenced to identify the gene(s) responsible for suppression of the ell1 deletion-associated genotoxic stress-sensitive phenotype.

Genetic Screen for Identification of Multicopy Suppressors in Schizosaccharomyces pombe

This work describes a protocol for a multicopy suppressor genetic screen in Schizosaccharomyces pombe. This screen uses a genome-wide plasmid library to identify suppressor clone(s) of a loss-of-function phenotype associated with a query mutant strain. Novel genetic suppressors of the ell1 null mutant were identified using this screen.

Şizosakkaromices pombe'de Multicopy Suppressorların Tanımlanması için Genetik Ekran

Identification of genetic interactions is a powerful tool to decipher the functions of gene(s) by providing insights into their functional relationships ...

Barkodlu Maya Kütüphaneler Rekabet Genomik Ekranlar

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler