Method Article
Linear-amplification mediated (LAM)-PCR is a method developed to identify the exact positions of integrating viral vectors in the genome. The technique has evolved to be the superior method to study clonal dynamics in gene therapy patients, biosafety of novel vector technologies, T-cell diversity, cancer stem cell models, etc.
Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3’- and 5’- sequences adjacent to the integrated lentiviral vector.
Linear-amplification mediated PCR (LAM-PCR) allows identifying and characterizing unknown flanking DNA adjacent to known DNA of any origin. More specifically, LAM-PCR has been developed to localize viral vector integration sites (IS) within the host genome1,2. Genetic elements like retroviruses or transposons integrate their genome into the host genome in a (semi-) random manner3-6. In many cases it is decisive to know exactly the position where these vectors integrated. LAM-PCR has been proven to be superior to alternative techniques like ligation-mediated PCR7 and its variants or inverse PCR8. The sensitivity and robustness of this method arises from the initial preamplification of the vector-genome junctions and magnetic selection of amplified PCR products. Like the alternative methods mentioned, LAM-PCR relies on the use of restriction enzymes, introducing a bias into retrieval capacity of IS9-11. Thus, only a subset of the IS repertoire (the integrome) can be detected in one reaction. This bias is minimized by the parallel analysis of a given sample using optimal combinations of restriction enzymes9. Recently, a variant of the technology termed non-restrictive LAM-PCR (nrLAM-PCR) has been developed that circumvents the use of restriction enzymes and allows unbiased genome-wide analysis of a sample in a single reaction9,12.
In the past, LAM-PCR has been used to identify the causative retroviral IS giving rise to leukemia in a few patients in clinical gene therapy trials13-15. Since then, LAM-PCR has been adapted to identify IS from other integrating vectors (lentiviral vectors, transposons) and also to identify integration patterns of passively integrating vectors like adeno-associated vectors (AAV) or integrase-defective lentiviral vectors (IDLV)16-21. Applications of LAM-PCR are wide spread: traditionally, the technique is widely used to study the clonal composition of gene modified cells in patients that have undergone gene therapy or to assess the biosafety of novel vector systems by unraveling their integration behavior15,16,22-24. Recently, LAM-PCR enabled determining specificity and off-target activity of designer nucleases by an IDLV trapping assay25.
Moreover, LAM-PCR allows to easily follow the fate of a transduced cell over time in an organism. This allows to identify proto-oncogenes as well as tumor suppressor genes and also to study hematopoiesis or cancer stem cell biology26-28. Last but not least, LAM-PCR was adapted to study T-cell receptor diversity in humans29 (and unpublished data).
The intrinsic power of the technology is reinforced by linking the method to deep sequencing technologies that allow characterizing millions of unknown flanking DNA with single nucleotide resolution in whole genomes. In the following protocol, we describe step-by step the amplification and identification of flanking unknown DNA exemplarily to identify lentiviral vector IS. Oligonucleotides used in the protocol are listed in Table 1. Extracted DNA or cDNA of any source can be used as DNA template for LAM-PCR and nrLAM-PCR.
1. Preparation of Linker Cassettes (LC)
2. Preamplification of Vector Genome Junctions
3. Magnetic Separation of PCR Product
4. LAM-Procedure
5. nrLAM-Procedure
6. Exponential Amplification I
7. Magnetic Separation of PCR Product
8. Exponential Amplification II
9. Preparation for High-throughput Sequencing
LAM-PCR results in amplification of vector genome junctions with a defined fragment size for each junction. The size of individual PCR fragments depends on the distance between the location of the known DNA in the genome and the closest restriction enzyme recognition site. This allows visualizing the diversity of amplified junctions in analyzed samples by gel electrophoresis, e.g., if only single (monoclonal), several (oligoclonal), or multiple (polyclonal) bands are present on the gel. The results of LAM-PCR are best viewed by high resolution electrophoresis gels (Figure 2A) but can also be visualized on 2% agarose gels (Figure 2B). nrLAM-PCR results in PCR fragments of various length for each individual junction. Thus monoclonal, oligoclonal or polyclonal samples appear as a smear by electrophoresis and cannot be distinguished visually. Visualizing the nrLAM-PCR product on 2% agarose gel is sufficient to determine success of the protocol (Figure 2C). After sequencing the recovered genomic DNA can be aligned to the respective host genome to identify exact positions of the location of the vector (Figure 3A). Annotation of the genome allows to analyze the IS repertoire for different vector specific features like preference for integration into gene coding regions (Figure 3B) or close to transcription start sites (Figure 3C).
Figure 1. Schematic outline of LAM-PCR and nrLAM-PCR. A) Both methods start with an initial preamplification of vector genome junctions using biotinylated primers hybridizing close to the end of the known DNA sequence (here long terminal repeat (LTR) of a retroviral vector). Preamplification results in biotinylated ssDNA of different size for identical or different vector genome junctions. Biotinylated ssDNA is captured on magnetic particles. B) For LAM PCR, enzymatic reaction steps composed of dsDNA synthesis, restriction digest and ligation of a known linker DNA generate products of different sizes with known sequences on both ends of the product. Due to restriction length polymorphism each amplified junction has a characteristic length. After denaturation the LAM-PCR product is amplified by nested PCR with linker and vector specific primers. C) For nrLAM a ssDNA linker sequence is directly ligated to the unknown end of the preamplified ssDNA from A) allowing exponential amplification by nested PCR with linker and vector specific primers. This figure has been modified from 2,12. Please click here to view a larger version of this figure.
Figure 2. Representative results of LAM- PCR and nrLAM-PCR. A, B) LAM-PCR analysis of isolated DNA from peripheral blood of gene therapy treated patients. The number of bands on the gel corresponds to the number of IS present in the sample. High-resolution gels (B) are better suited to visualize clonality of analyzed samples than 2% agarose gels (A). C) nrLAM-PCR analysis of lentiviral vector transduced single cell clones or bulk cells. Independent of the number of amplified insertion sites a smear is seen on the gel after electrophoresis. M, 100 bp ladder; MC, monoclonal; OC, oligoclonal; PC, polyclonal. This figure has been modified from 2,9.
Figure 3. Representative examples for IS analysis by LAM-PCR and subsequent high-throughput sequencing. IS distribution in two patients from gammaretroviral (blue) or lentiviral (green) clinical gene therapy trials. After sequencing and mapping of LAM-PCR products to the respective genome IS can be evaluated e.g.: A) Genome-wide distribution of IS. B) Difference according to the preference for insertion into gene coding regions between gammaretroviral and lentiviral vectors and C) preference for insertion close to transcription start sites. Please click here to view a larger version of this figure.
Purpose | Name | Sequence (5'-3') |
LK-universal | LC1 | GACCCGGGAGATCTGAATTCAGTGGCACAG CAGTTAGG |
LK-AATT | LC2 (AATT) | AATTCCTAACTGCTGTGCCACTGAATTCA GATC |
LK-CG | LC2 (CG) | CGCCTAACTGCTGTGCCACTGAATTCAGATC |
LK-TA | LC2 (TA) | TACCTAACTGCTGTGCCACTGAAATCAGATC |
LK-nrLAM-PCR | ssLC | (P)CCTAACTGCTGTGCCACTGAATTCAGATC TCCCGGGTddC |
Preamplification | LTR-I (3'-direction) | (B)AGTAGTGTGTGCCCGTCTGT |
LTR-I (5'-direction) | (B)TTAGCCAGAGAGCTCCCAGG | |
Exponential amplification I | LTR-II (3'-direction) | (B)GTGTGACTCTGGTAACTAGAG |
LTR-II (5'-direction) | (B)GATCTGGTCTAACCAGAGAG | |
LC-I | GACCCGGGAGATCTGAATTC | |
Exponential amplification II | LTR-III (3'-direction) | GATCCCTCAGACCCTTTTAGTC |
LTR-III (5'-direction) | CCCAGTACAAGCAAAAAGCAG | |
LC-II | GATCTGAATTCAGTGGCACAG |
Table 1. Oligonucleotides for LAM- and nrLAM-PCR to amplify lentiviral IS. ssLC is phosphorylated at the 5’-end (P) and has at 3’ didesoxycytidin (ddC) to avoid multimerization of the ssLC during ligation. In general, (nr)LAM-PCR primers should consist of 18-25 nucleotides and should not align to the host genome. Primers for preamplification should be placed as close as possible (≤120 bp) to the 5′ or 3′ end of the vector. Two additional primers for Exponential PCR I and II need to be placed between the primer used for preamplification and the vector end. Primers for preamplification and Exponential PCR I need to be 5’-phosphorylated (P).
Reagent | Volume (µl) | Concentration | PCR Parameters | Temperature | Time | |
H2O | 43 - x | Initial denaturation | 95 °C | 5 min | ||
Buffer | 5 | 10 x | Denaturation | 95 °C | 45 sec | |
dNTP | 1 | 10 mM (LAM); 0.5 µM (nrLAM) | Annealing | 60 °C | 45 sec | 2 x 50 Cycles |
LTR-I | 0.5 | 0.17 µM | Elongation | 72 °C | 60 sec (LAM); 10 sec (nrLAM) | |
Taq Polymerase | 0.5 | 2.5 U/µl | Final Elongation | 72 °C | 5 min (only LAM) |
Table 2. PCR-Conditions for preamplification of vector genome junctions (step 2). Columns 1-3 show the PCR reagents used for amplification of a single DNA sample. Columns 4-6 exemplify the PCR program to preamplify vector genome junctions.
Reagent | Volume (µl) | Concentration | PCR Parameters | Temperature | Time | |
H2O | 40.5 | Initial denaturation | 95 °C | 5 min | ||
Buffer | 5 | 10 x | Denaturation | 95 °C | 45 sec | |
dNTP | 1 | 10 mM | Annealing | 60 °C | 45 sec | 35 Cycles |
LTR-II | 0.5 | 16.7 µM | Elongation | 72 °C | 60 sec (LAM); 5 sec (nrLAM) | |
LC-I | 0.5 | 16.7 µM | Final Elongation | 72 °C | 5 min (only LAM) | |
Taq Polymerase | 0.5 | 2.5 U/µl |
Table 3. PCR-Conditions for exponential Amplification I (step 6). Columns 1-3 show the PCR reagents used for exponential amplification of a single DNA sample. Columns 4-6 exemplify the PCR program used to exponentially amplify one sample after Ligation of linker sequence.
Reagent | Volume (µl) | Concentration | PCR Parameters | Temperature | Time | |
H2O | 40.5 | Initial denaturation | 95 °C | 5 min | ||
Buffer | 5 | 10 x | Denaturation | 95 °C | 45 sec | |
dNTP | 1 | 10 mM | Annealing | 60 °C | 45 sec | 35 Cycles |
LTR-III | 0.5 | 16.7 µM | Elongation | 72 °C | 60 sec (LAM); 5 sec (nrLAM) | |
LC-II | 0.5 | 16.7 µM | Final Elongation | 72 °C | 5 min | |
Taq Polymerase | 0.5 | 2.5 U/µl |
Table 4. PCR-Conditions for exponential Amplification I (step 8). Columns 1-3 show the PCR reagents used for nested exponential amplification of a single sample. Columns 4-6 exemplify the PCR program used for nested exponential amplification of vector genome junctions from one sample.
Reagent | Volume (µl) | Concentration | PCR Parameters | Temperature | Time | |
H2O | 42.5 - x | Initial denaturation | 95 °C | 2 min | ||
Buffer | 5 | 10 x | Denaturation | 95 °C | 45 sec | |
dNTP | 1 | 10 mM | Annealing | 58 °C | 45 sec | 12 Cycles |
Fusionprimer A | 0.5 | 10 µM | Elongation | 72 °C | 60 sec | |
Fusionprimer B | 0.5 | 10 µM | Final Elongation | 72 °C | 5 min | |
Taq Polymerase | 0.5 | 2.5 U/µl |
Table 5. PCR-Conditions for Fusionprimer-PCR (step 9.2). Columns 1-3 show the PCR reagents used for introduction of sequencing adaptors to (nr)LAM-PCR products. Columns 4-6 exemplify the PCR program used for Fusionprimer-PCR.
The LAM-PCR technique allows identifying unknown DNA sequences that flank a known DNA region. Because of the high sensitivity resulting from preamplification of the junctions with specific primers hybridizing in the known DNA sequence, it is possible to amplify and detect even rare junctions down to the single cell level. Contrary, in a polyclonal situation LAM-PCR is able to amplify thousands of different junctions in one single reaction.
However, due to the use of restriction enzymes only a subfraction of the integrome can be analyzed by LAM-PCR for the presence of junctions with every particular restriction enzyme. Thus, repeated analysis of the same sample with different enzymes is recommended9. If no LAM-PCR amplicons are present on the gel, most likely the distance between the location of the known DNA fragment and the closest recognition site of the chosen restriction enzyme is too large to result in LAM-PCR products9. In this case other enzymes should be used to amplify the junction.
nrLAM is independent of the use of restriction enzymes and therefore represents a highly valuable method to comprehensively characterize sequences flanking a known DNA sequence. Omitting restriction digest from the protocol results in the loss of specific restriction fragment length polymorphism characterizing each amplified junction. Instead every amplified junction is represented by PCR products of various sizes resulting in a smear on the gel after electrophoresis, independent of the diversity of amplified junctions.
Both LAM- and nrLAM-PCR products are perfectly suited for downstream high-throughput sequencing. High-throughput sequencing of (nr)LAM-PCR products and mapping of retrieved raw sequences to the corresponding genome allows characterizing unknown flanking DNA or identifying the exact localization of vector-genome junctions30. By introducing barcode sequences into the fusionprimers several hundreds of LAM-and nrLAM-PCR products can be sequenced in one sequencing run30.
Due to high sensitivity, LAM-PCR is prone to contamination if executed inattentively. Thus, a PCR-grade environment and special attention to clean handling of the protocol is of utmost importance to successfully amplify the unknown flanking DNA without contaminating samples. Therefore, including untransduced genomic DNA and a water control for every PCR reaction as negative controls into the LAM-PCR protocol is strongly recommended. If control samples indicate that cross-contamination occurred during the protocol, the products from every pause point can be used to repeat parts of the protocol. When bands are still present, it is recommended to discard all reagents (e.g., primers, dNTPs, polymerases, etc.) and repeating the (nr)LAM-PCR protocol with new aliquots.
The authors have nothing to disclose.
Funding was provided by the Deutsche Forschungsgemeinschaft (SPP1230, grant of the Tumor Center Heidelberg/Mannheim), by the Bundesministerium für Bildung und Forschung (iGene), by the VIth + VIIth Framework Programs of the European Commission (CONSERT, CLINIGENE and PERSIST). We thank Ina Kutschera for demonstrating the protocol technique in the video.
Name | Company | Catalog Number | Comments |
Taq DNA Polymerase | Genaxxon Bioscience GmbH | M3001.5000 | Alternative Taq Polymerases may be used |
PCR Buffer | Qiagen | 201203 | Use of this buffer is recommended |
dNTP-Mixture | Genaxxon Bioscience GmbH | M3015.4020 | or any other dNTPs |
Oligonucleotides (Primers) | MWG Biotech | HPLC purified | |
Dynabeads M-280 Streptavidin | Invitrogen | 11206D | |
PBS | Gibco | 14190-086 | 0.1% wt/vol BSA |
6 M LiCl | Roth | 3739.1 | 10 mM Tris-HCl (pH 7.5)/1 mM EDTA |
Tris-HCl, pH 7.5 | USB Corporation | 22637 | or any other supplier |
EDTA | Applichem | A1103,0250 | or any other supplier |
Klenow Polymerase | Roche Diagnostics | 10104523001 | |
Hexanucleotide mixture | Roche Diagnostics | 11277081001 | |
Restriction endonuclease | NEB | or any other supplier | |
Fast-Link DNA ligation kit | Epicentre Biotechnologies | LK11025 | |
CircLigase ssDNA Ligase Kit | Epicentre Biotechnologies | CL4111K | |
NaOH | Sigma-Aldrich | 72068 | or any other supplier |
Agarose LE | Roche Diagnostics | 11685660001 | or any other supplier |
TBE buffer | Amresco | 0658 | or any other supplier |
Ethidium bromide | Applichem | A2273,0005 | Ethidium bromide is mutagenic |
100 bp DNA Ladder | Invitrogen | 15628-050 | or any other DNA ladder |
20 mM NaCl | Sigma-Aldrich | 71393-1L | or any other supplier |
Magna-Sep Magnetic Particle Separator | Life Technologies | K158501 | for use with 1.5 ml Tubes |
Magna-Sep Magnetic Particle Separator | Life Technologies | K158696 | for use with 96-well plates |
Amicon Ultra-0.5, Ultracel-30 membrane | Millipore | UFC503096 | |
PerfectBlue Gelsystem Midi S | PeqLab | 40-1515 | or other electrophoresis system |
TProfessional 96 | Biometra | 050-551 | or other Thermocycler for 96-well plates |
Orbital shaker KS 260 basic | IKA | 2980200 | or other horizontal shaker |
PCR softtubes 0.2 ml | Biozym Scientific GmbH | 711082 | or other 0.2 ml PCR tubes |
1.5 ml tubes | Eppendorf | 12682 | or other 1.5 ml tubes |
Gel documentation system | PeqLab | or any other gel documentation system | |
Nanodrop ND-1000 spectrophotometer | Thermo Scientific | ND-1000 | |
Spreadex EL1200 precast gel | Elchrom Scientific | 3497 | |
Submerged gel electrophoresis apparatus SEA 2000 | Elchrom Scientific | 2001E | |
2100 Electrophoresis Bioanalyzer | Agilent Technologies | G2939AA |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved