This research was supported by grants from the Natural Sciences and Engineering Research Council of Canada (Grant No. ALLRP 570780-2021) and McMaster University.

NOTE: Any steps utilizing international soil samples and/or A. fumigatus spores and mycelia require working within a biosafety cabinet for level 2 organisms (BSCII).
1. Isolation of yeast from soil
<ol>
	<li>Preparation of antibacterial and antifungal solutions
	<ol>
		<li>Suspend chloramphenicol powder in 70% ethanol to prepare a 50 g/L stock solution. Sterilize by syringe filtration and store at 4 &#176;C. 
		&#8203;NOTE: This antibiotic will prevent the growth of most bacteria during soil yeast isolation. As chloramphenicol-resistant bacteria may still grow, colony morphology must be carefully taken into consideration when distinguishing yeasts from bacteria. Additional antibiotics may be added to media when working with soil suspected of containing antibiotic-resistant bacterial strains. Bacterial contamination in chloramphenicol-supplemented media was not an issue encountered when isolating yeasts from environmental soils.</li>
		<li>Suspend benomyl powder in DMSO to prepare a 5 g/L stock solution. Sterilize by syringe filtration and store at 4 &#176;C. 
		NOTE: This selective antifungal drug prevents the growth of most filamentous fungi without affecting yeast growth during soil yeast isolation26,27.</li>
	</ol>
	</li>
	<li>Preparation of culture media and sterile equipment
	<ol>
		<li>To prepare YEPD (Yeast Extract-Peptone-Dextrose) broth, add 10 g of Yeast Extract, 20 g of peptone, and 20 g of dextrose to 1 L of double-distilled water. Stir until well-mixed and autoclave for 40 min at 121 &#176;C. Store at room temperature until use.</li>
		<li>YEPD solid agar medium
		<ol>
			<li>Mix 10 g of yeast extract, 20 g of peptone, 20 g of dextrose, and 20 g of agar in 1 L of water. Stir well to mix and autoclave for 40 min at 121 &#176;C.</li>
			<li>Once sufficiently cooled, add 1 mL of chloramphenicol and benomyl from stock solutions to bring the final concentrations of the two antimicrobials to 50 mg/L and 5 mg/L, respectively.</li>
			<li>Mix well by stirring and pour into 10 cm diameter Petri dishes. Leave at room temperature overnight to set and store at 4 &#176;C until use. 
			NOTE: From 1 L of YEPD, approximately 40 plates can be poured.</li>
		</ol>
		</li>
		<li>Sterilize wooden plain-tipped applicator sticks and reusable cell spreaders by autoclaving and store at room temperature.</li>
	</ol>
	</li>
	<li>Incubation of soil in liquid broth
	<ol>
		<li>Prepare a set of sterile 13 mL culture tubes by labeling them with soil sample ID.</li>
		<li>Using a serological pipette, add 5 mL of YEPD broth supplemented with chloramphenicol and benomyl into each tube.</li>
		<li>Working in a BSCII, transfer ~0.1 g of soil into the appropriate culture tube using a sterile, wooden plain-tipped applicator. 
		NOTE: Use a fresh applicator for each soil sample and discard immediately upon use to avoid cross-contamination between samples.</li>
		<li>Cap the tube securely to the first stop to prevent spillage but still allow air exchange during incubation. Incubate the culture tubes in a roller drum for 24 h at a temperature deemed optimum for maximizing yeast growth. 
		NOTE: The incubation temperature should be decided based on the mean annual temperature of the soil samples&#39; country of origin. For example, when isolating soil yeasts from Iceland, the culture tubes were incubated at 14 &#176;C, whereas soils from Saudi Arabia were incubated at 30 &#176;C. Due to slower yeast growth at lower temperatures, incubation time might have to be extended for up to 72 h.</li>
	</ol>
	</li>
	<li>Transfer the supernatant to the solid medium.
	<ol>
		<li>Using the set of YEPD + chloramphenicol + benomyl agar plates prepared in Step 1.2, label them with the soil sample ID.</li>
		<li>Remove the culture tubes prepared in Step 1.3 from the roller drum. Working in a BSCII, briefly vortex the tube to draw soil particles and cells that may have settled at the bottom back into suspension.</li>
		<li>Using a micropipette, transfer 100 &#181;L of the supernatant onto a plate. Use a sterile, reusable cell spreader to spread the liquid thoroughly and evenly over the agar surface. 
		NOTE: Working in sets of 10 samples can significantly speed up this process. Pipette the supernatant onto 10 plates first and then perform spreading. Use a fresh spreader for each sample to avoid cross-contamination between samples.</li>
		<li>Stack the plates in plastic bags, seal, and incubate upside down for 2-3 days at the same temperature used previously for liquid broth incubation until microbial growth is visible.</li>
	</ol>
	</li>
	<li>Detection of yeasts and streaking for single colonies
	<ol>
		<li>After allowing for sufficient incubation time (typically 2-3 days, but may take longer at lower temperatures), inspect the plates in a BSCII for any yeast growth. Look for creamy, round, matte-like yeasts that are easily distinguished from bacterial and mold colonies. 
		NOTE: Some yeasts produce colored pigments and may appear black/brown, yellow, or red, but their overall colony texture and shape would be similar to non-pigmented yeasts.</li>
		<li>Select one yeast-like colony from each plate for further processing. 
		NOTE: If more than one type of morphology is observed on a single plate, select one representative colony for each morphological type.</li>
		<li>Using sterile, wooden plain-tipped applicator sticks, transfer each selected colony onto a fresh YEPD + chloramphenicol + benomyl plate and streak for single colonies. Perform three separate streaks.
		<ol>
			<li>Streak back and forth over a third of the plate using an applicator stick. Begin the second and third streak by streaking the applicator across the preceding streak once. Use a new applicator stick for every streak. 
			NOTE: Use one plate per isolate. Discard applicators immediately upon use to avoid cross-contamination between samples.</li>
		</ol>
		</li>
		<li>Stack the plates in plastic bags, seal, and incubate upside down for 2-3 days at the same temperature used previously until single colonies become visible.</li>
	</ol>
	</li>
	<li>Identification of yeast species via ITS sequencing
	<ol>
		<li>Select a well-separated, single colony per soil isolate and subculture onto a fresh YEPD + chloramphenicol + benomyl plate to obtain more cells. Incubate for 2-3 days at the same temperature used previously.</li>
		<li>Harvest the freshly grown cells and suspend them in -80 &#176;C freezer tubes containing 1 mL of sterilized 30% glycerol in double-distilled water to create cell suspensions. Maintain these suspensions at -80 &#176;C as stock solutions.</li>
		<li>Use fresh cells to perform colony PCR (polymerase chain reaction) with primers ITS1 (5&#39; TCCGTAGGTGAACCTGCGG 3&#39;) and ITS4 (5&#39; TCCTCCGCTTATTGATATGC 3&#39;) to amplify the fungal barcoding gene, ITS9. Use the following thermocycling conditions: an initial denaturation step at 95 &#176;C for 10 min followed by 35 cycles of (i) 95 &#176;C for 30 s, (ii) 55 &#176;C for 30 s, and (iii) 72 &#176;C for 1 min. 
		NOTE: Colony PCR has a high success rate and a faster turnaround time than DNA extraction followed by PCR.</li>
		<li>If colony PCR repeatedly fails for a strain, extract DNA using the protocol of choice and perform ITS PCR using extracted genomic DNA as template (use same thermocycling conditions as above). 
		NOTE: A relatively inexpensive chloroform-based DNA extraction is recommended28.</li>
		<li>Perform Sanger sequencing to determine the DNA sequence of the amplified ITS region for each strain.</li>
		<li>Compare the obtained ITS sequence of the yeast strains to sequences deposited in public databases such as NCBI GenBank and UNITE to establish species identity.</li>
	</ol>
	</li>
</ol>
2. Isolation of Aspergillus fumigatus from soil
<ol>
	<li>Prepare 1 mL of sterile Sabouraud dextrose broth (SDB) supplemented with the antibiotic chloramphenicol per soil sample.
	<ol>
		<li>Add 10 g of peptone and 20 g of dextrose to 1 L of distilled water. Autoclave at 121 &#176;C for 40 min.</li>
		<li>Allow the SDB to cool to ~50 &#176;C, add 1 mL of 50 g/L chloramphenicol to bring the concentration to 50 mg/L. 
		NOTE: Chloramphenicol is prepared the same as described above for yeast isolation. Aside from inhibiting bacterial growth, chloramphenicol also prevents the production of gas from bacteria that will cause the tubes to open during the incubation step detailed in Step 2.2.</li>
		<li>Aseptically aliquot 1 mL of SDB into a 1.5 mL microcentrifuge tube per soil sample using a mechanical pipette.</li>
	</ol>
	</li>
	<li>Add soil to 1.5 mL microcentrifuge tubes.
	<ol>
		<li>Lay bench coat or absorbent padding inside a BSCII to aid in the disposal of spilt soil.</li>
		<li>Using autoclaved applicator sticks, transfer approximately 0.1 g of soil into a 1.5 mL microcentrifuge tube containing 1 mL of SBD. Close the tube and vortex. Incubate the suspended soil at 50 &#176;C for 3 days. 
		NOTE: Shaking during incubation is not required.</li>
	</ol>
	</li>
	<li>Mycelial harvest of soil-inoculated broth
	<ol>
		<li>Prepare malt extract agar (MEA) plates.
		<ol>
			<li>Per liter of MEA: add 20 g of malt extract, 20 g of dextrose, 6 g of peptone, and 15 g of agar to 1 L of distilled water. Autoclave at 121 &#176;C for 40 min.</li>
			<li>Allow the MEA to cool to ~50 &#176;C, then add 1 mL of 50 g/L chloramphenicol to bring to a final concentration of 50 mg/L.</li>
		</ol>
		</li>
		<li>Transfer the mycelia from the soil-inoculated broth onto MEA plates.
		<ol>
			<li>Identify soil inoculums that have visible mycelial growth at the SDB to air boundary.</li>
			<li>Use sterilized wooden plain-tipped applicator sticks to transfer the mycelia to the center of a MEA plate. Incubate the MEA plates at 37 &#176;C for 3 days.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Selection of mycelia with A. fumigatus morphological properties.
	<ol>
		<li>Identify mold colonies that have characteristic A. fumigatus morphological properties (green suede like growth).</li>
		<li>Working in a BSCII, use sterilized wooden plain-tipped applicator sticks or an inoculation loop to harvest conidia/mycelia by scraping the surface once. Transfer the spores/mycelia to the center of a MEA plate by streaking onto the agar for single colonies. Incubate at 37 &#176;C for 2 days. 
		NOTE: As multiple A. fumigatus strains and/or other fungi may be present on the plate, it is important to streak for single colonies. The single-colony streaking protocol in Step 1.5.3 in the yeast isolation protocol can be used.</li>
		<li>Using a sterile applicator stick or inoculation loop, subculture a single colony generated in Step 2.4.1.2 onto MEA by streaking the colony once. Spread the harvested spores into the center of the plate. Incubate at 37 &#176;C for 2 days.</li>
	</ol>
	</li>
	<li>Harvesting of A. fumigatus spores/mycelia for culture storage
	<ol>
		<li>Prepare a sterile 30% glycerol solution (for a 100 mL solution, add 30 mL of 100% glycerol mixed with 70 mL of double-distilled water, sterilized at 121 &#176;C for 40 min).</li>
		<li>Working in a BSCII, use a p1000 pipette to aspirate 1 mL of the 30% glycerol solution. Dispense the 1 mL of glycerol solution onto the A. fumigatus colony to harvest spores/mycelia.
		<ol>
			<li>Due to the hydrophobicity of A. fumigatus spores/mycelia, use the pipette tip to scratch a densely sporulated region of the plate. 
			NOTE: When glycerol is dispensed in the scratch, the glycerol would adhere to the scratch area rather than rolling over the agar.</li>
			<li>Slowly dispense the glycerol onto the scratch area to dislodge the spores and suspend them in the glycerol solution.</li>
			<li>Once fully dispensed, lightly tip the plate and aspirate the glycerol spore/mycelia suspension. 
			NOTE: Approximately 750 to 800 &#181;L will be aspirated.</li>
			<li>Transfer the aspirate to a sterile freezer tube and store at -80 &#176;C. If required, create working stock by repeating steps 2.5.2.1 to 2.5.2.4.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Phenotypic identification of A. fumigatus strains
	<ol>
		<li>Using the spore stock created from step 2.5.2, create a 100x dilution in water.
		<ol>
			<li>Aspirate 10 &#181;L of the mycelial and spore stocks and dispense in 990 &#181;L of water. Vortex the suspension.</li>
		</ol>
		</li>
		<li>Dispense 10 &#181;L of the diluted spore suspension onto a standard microscope slide.</li>
		<li>OPTIONAL: Stain the mycelial and spore suspension with methylene blue.
		<ol>
			<li>To stain with methylene blue, fix the conidia and conidiophores to the slide by passing the slide over a Bunsen burner until dry.</li>
			<li>Apply methylene blue for 1-2 min and wash off with water.</li>
			<li>Dry the slide with blotting paper.</li>
		</ol>
		</li>
		<li>Using a compound microscope at 400x magnification, view the suspension and locate conidiophores. Compare the observed conidiophore morphology with A. fumigatus conidiophore morphology.</li>
	</ol>
	</li>
	<li>Molecular identification of A. fumigatus strains
	<ol>
		<li>Extract DNA from each isolate following common fungal DNA extraction protocols.</li>
		<li>Using primers specific to the Aspergillus&#160;&#946;-tubulin genes (&#946;-tub1 and &#946;-tub4), run PCR and obtain the sequence for the amplified products, following protocols described by Alcazar-Fuoli et al.17.
		<ol>
			<li>Compare the obtained sequences to sequences deposited in public databases such as NCBI GenBank using BLAST.</li>
			<li>Confirm the strain sequences are a top match to A. fumigatus sequences in the database.</li>
		</ol>
		</li>
		<li>Alternative to step 2.7.2, run a multiplex PCR reaction targeting the A. fumigatus mating types MAT1-1 and MAT1-229.
		<ol>
			<li>Use the following three primer sequences in the multiplex PCR reaction: AFM1: 5&#39;-CCTTGACGCGATGGGGTGG-3&#39;; AFM2: 5&#8242;-CGCTCCTCATCAGAACAACTCG-3&#8242;; AFM3: 5&#8242;-CGGAAATCTGATGTCGCCACG-3&#8242;.</li>
			<li>Use the following thermocycler parameters: 5 min at 95 &#176;C, 35 cycles of 30 s at 95 &#176;C, 30 s at 60 &#176;C, and 1 min at 72 &#176;C before a final 5 min at 72 &#176;C.</li>
			<li>Run gel electrophoresis to identify the products; look for 834 bp MAT-1 or 438 bp MAT1-2. Use A. fumigatus strains that have confirmed mating type amplification as positive and negative controls.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Microsatellite genotyping of A. fumigatus strains through fragment analysis 
	NOTE: Although the steps listed below broadly cover genotyping A. fumigatus at nine microsatellite (STR) loci, only a few important considerations have been highlighted. For details on A. fumigatus STR genotyping, refer to De Valk et al.24,30.
	<ol>
		<li>Prepare three PCR multiplex master mixes using the STRAf primers previously described by De Valk et al.24.
		<ol>
			<li>Fluorescently label forward primers to determine fragment size through capillary electrophoresis. Ensure that the concentration of the forward primers is half (0.5 &#956;M) that of the reverse primers (1 &#956;M) within the master mix. 
			NOTE: For the best results, use fluorescent labels that have absorbance wavelengths that match those of the chosen dye standard used during capillary electrophoresis</li>
			<li>Use hot start polymerase for best results.</li>
			<li>Use a DNA concentration of 0.1 ng per reaction.</li>
		</ol>
		</li>
		<li>Run the multiplex PCR for each strain using the following PCR program: 95 &#176;C for 10 min, 40 cycles of 95 &#176;C for 30 s, 60 &#176;C for 30 s, and 72 &#176;C for 60 s, followed by 72 &#176;C for 10 min and a hold at 4 &#176;C.</li>
		<li>Check for amplified products through gel electrophoresis.</li>
		<li>Dilute the products to the desired level (typically ~50x) as recommended by fragment analyses specialists and run capillary electrophoresis. Perform three runs for each strain, with each run covering three multiplexed reactions with three different fluorescent probes.</li>
		<li>To determine the correct fragment size for each of the nine STR loci, use software capable of fragment analysis.
		<ol>
			<li>Retrieve the raw data obtained from capillary electrophoresis. Score the fragment sizes based on the largest peak using the fragment analysis software (e.g., Osiris).</li>
			<li>Convert the fragment sizes to repeat numbers for each of the nine loci. Use the fragment sizes of the repeat numbers of the reference strain Af293 as previously described by De Valk et al.24. 
			NOTE: Slight variations in fragment sizes may occur between different capillary electrophoresis platforms. Thus, it is important to include a common reference strain (and an internal ladder) with known fragment size for each of the nine loci for genotyping strains.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frac, M., Hannula, S. E., Belka, M., J&#553;dryczka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fungal+biodiversity+and+their+role+in+soil+health.">Fungal biodiversity and their role in soil health.</a> Frontiers in Microbiology. 9, 707 (2018).</li><li>Tedersoo, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+diversity+and+geography+of+soil+fungi.">Global diversity and geography of soil fungi.</a> Science. 346 (6213), 1256688 (2014).</li><li>Egidi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+few+Ascomycota+taxa+dominate+soil+fungal+communities+worldwide.">A few Ascomycota taxa dominate soil fungal communities worldwide.</a> Nature Communications. 10 (1), 1-9 (2019).</li><li>Yurkov, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeasts+of+the+soil+-+obscure+but+precious.">Yeasts of the soil - obscure but precious.</a> Yeast. 35 (5), 369-378 (2018).</li><li>Botha, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+importance+and+ecology+of+yeasts+in+soil.">The importance and ecology of yeasts in soil.</a> Soil Biology and Biochemistry. 43 (1), 1-8 (2011).</li><li>Connell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+soil+yeasts+isolated+from+South+Victoria+Land,+Antarctica.">Diversity of soil yeasts isolated from South Victoria Land, Antarctica.</a> Microbial Ecology. 56 (3), 448-459 (2008).</li><li>Vishniac, H. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multivariate+analysis+of+soil+yeasts+isolated+from+a+latitudinal+gradient.">A multivariate analysis of soil yeasts isolated from a latitudinal gradient.</a> Microbial Ecology. 52 (1), 90-103 (2006).</li><li>Kurtzman, C., Fell, J. W., Boekhout, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Yeasts: A Taxonomic Study. , (2011).</li><li>Samarasinghe, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+in+culturable+soil+yeast+diversity.">Global patterns in culturable soil yeast diversity.</a> iScience. 24 (10), 103098 (2021).</li><li>Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fungal+DNA+barcoding.">Fungal DNA barcoding.</a> Genome. 59 (11), 913-932 (2016).</li><li>Samarasinghe, H., Aljohani, R., Jimenez, C., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fantastic+yeasts+and+where+to+find+them:+the+discovery+of+a+predominantly+clonal+Cryptococcus+deneoformans+population+in+Saudi+Arabian+soils.">Fantastic yeasts and where to find them: the discovery of a predominantly clonal Cryptococcus deneoformans population in Saudi Arabian soils.</a> FEMS Microbiology Ecology. 95 (9), 122 (2019).</li><li>Aljohani, R., Samarasinghe, H., Ashu, T., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+and+relationships+among+strains+of+culturable+yeasts+in+agricultural+soils+in+Cameroon.">Diversity and relationships among strains of culturable yeasts in agricultural soils in Cameroon.</a> Scientific Reports. 8 (1), 1-11 (2018).</li><li>Carini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relic+DNA+is+abundant+in+soil+and+obscures+estimates+of+soil+microbial+diversity.">Relic DNA is abundant in soil and obscures estimates of soil microbial diversity.</a> Nature Microbiology. 2 (3), 1-6 (2016).</li><li>Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fungal+species+concepts+in+the+genomics+era.">Fungal species concepts in the genomics era.</a> Genome. 63 (9), 459-468 (2020).</li><li>Brakhage, A. A., Langfelder, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Menacing+mold:+The+molecular+biology+of+Aspergillus+fumigatus.">Menacing mold: The molecular biology of Aspergillus fumigatus.</a> Annual Review of Microbiology. 56 (1), 433-455 (2002).</li><li>Bongomin, F., Gago, S., Oladele, R., Denning, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+and+multi-national+prevalence+of+fungal+diseases-Estimate+precision.">Global and multi-national prevalence of fungal diseases-Estimate precision.</a> Journal of Fungi. 3 (4), 57 (2017).</li><li>Alcazar-Fuoli, L., Mellado, E., Alastruey-Izquierdo, A., Cuenca-Estrella, M., Rodriguez-Tudela, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspergillus+section+Fumigati:+Antifungal+susceptibility+patterns+and+sequence-based+identification.">Aspergillus section Fumigati: Antifungal susceptibility patterns and sequence-based identification.</a> Antimicrobial Agents and Chemotherapy. 52 (4), 1244-1251 (2008).</li><li>Rocchi, S., Godeau, C., Scherer, E., Reboux, G., Millon, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One+year+later:+The+effect+of+changing+azole-treated+bulbs+for+organic+tulips+bulbs+in+hospital+environment+on+the+azole-resistant+Aspergillus+fumigatus+rate.">One year later: The effect of changing azole-treated bulbs for organic tulips bulbs in hospital environment on the azole-resistant Aspergillus fumigatus rate.</a> Medical Mycology. 59 (7), 741-743 (2021).</li><li>Chowdhary, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonal+expansion+and+emergence+of+environmental+multiple-triazole-resistant+Aspergillus+fumigatus+strains+carrying+the+TR34/L98H+mutations+in+the+cyp51A+gene+in+India.">Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR34/L98H mutations in the cyp51A gene in India.</a> PLoS ONE. 7 (12), 52871 (2012).</li><li>Kwon-Chung, K. J., Sugui, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspergillus+fumigatus-what+makes+the+species+a+ubiquitous+human+fungal+pathogen.">Aspergillus fumigatus-what makes the species a ubiquitous human fungal pathogen.</a> PLoS pathogens. 9 (12), 1003743 (2013).</li><li>Sewell, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonrandom+distribution+of+azole+resistance+across+the+global+population+of+Aspergillus+fumigatus.">Nonrandom distribution of azole resistance across the global population of Aspergillus fumigatus.</a> mBio. 10 (3), 00392 (2019).</li><li>Ashu, E. E., Hagen, F., Chowdhary, A., Meis, J. F., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+population+genetic+analysis+of+Aspergillus+fumigatus.">Global population genetic analysis of Aspergillus fumigatus.</a> mSphere. 2 (1), 00019 (2017).</li><li>Heo, S. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+in+vitro+ausceptibility+patterns+of+Aspergillus+to+triazoles+and+correlation+with+aspergillosis+outcome+in+a+tertiary+care+cancer+center,+1999-2015.">Changes in in vitro ausceptibility patterns of Aspergillus to triazoles and correlation with aspergillosis outcome in a tertiary care cancer center, 1999-2015.</a> Clinical Infectious Diseases. 65 (2), 216-225 (2017).</li><li>de Valk, H. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+novel+panel+of+nine+short+tandem+repeats+for+exact+and+high-resolution+fingerprinting+of+Aspergillus+fumigatus+isolates.">Use of a novel panel of nine short tandem repeats for exact and high-resolution fingerprinting of Aspergillus fumigatus isolates.</a> Journal of Clinical Microbiology. 43 (8), 4112-4120 (2005).</li><li>Yurkov, A. M., Kemler, M., Begerow, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+yeast+diversity+in+soils+under+different+management+regimes.">Assessment of yeast diversity in soils under different management regimes.</a> Fungal Ecology. 5 (1), 24-35 (2012).</li><li>Calhelha, R. C., Andrade, J. V., Ferreira, I. C., Estevinho, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toxicity+effects+of+fungicide+residues+on+the+wine-producing+process.">Toxicity effects of fungicide residues on the wine-producing process.</a> Food Microbiology. 23 (4), 393-398 (2006).</li><li>Thomas, J. H., Neff, N. F., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+mutations+in+the+&#914;-tubulin+gene+of+Saccharomyces+cerevisiae.">Isolation and characterization of mutations in the &#914;-tubulin gene of Saccharomyces cerevisiae.</a> Genetics. 111 (4), 715-734 (1985).</li><li>Xu, J., Ramos, A. R., Vilgalys, R., Mitchell, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonal+and+spontaneous+origins+of+fluconazole+resistance+in+Candida+albicans.">Clonal and spontaneous origins of fluconazole resistance in Candida albicans.</a> Journal of Clinical Microbiology. 38 (3), 1214 (2000).</li><li>Paoletti, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+sexuality+in+the+opportunistic+fungal+pathogen+Aspergillus+fumigatus.">Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus.</a> Current Biology. 15 (13), 1242-1248 (2005).</li><li>De Valk, H. A., Meis, J. F. G. M., De Pauw, B. E., Donnelly, P. J., Klaassen, C. H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+two+highly+discriminatory+molecular+fingerprinting+assays+for+analysis+of+multiple+Aspergillus+fumigatus+isolates+from+patients+with+invasive+aspergillosis.">Comparison of two highly discriminatory molecular fingerprinting assays for analysis of multiple Aspergillus fumigatus isolates from patients with invasive aspergillosis.</a> Journal of Clinical Microbiology. 45 (5), 1415-1419 (2007).</li><li>Bates, D., M&#228;chler, M., Bolker, B. M., Walker, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fitting+linear+mixed-effects+models+using+lme4.">Fitting linear mixed-effects models using lme4.</a> Journal of Statistical Software. 67 (1), 1-48 (2015).</li><li>Camacho, C., Madden, T., Tao, T., Agarwala, R., Morgulis, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+&#174;+Command+Line+Applications+User+Manual.">BLAST &#174; Command Line Applications User Manual.</a> National Center for Biotechnology Information. , 1-95 (2022).</li><li>Ashu, E. E., Korfanty, G. A., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+of+unique+genetic+diversity+in+Aspergillus+fumigatus+isolates+from+Cameroon.">Evidence of unique genetic diversity in Aspergillus fumigatus isolates from Cameroon.</a> Mycoses. 60 (11), 739-748 (2017).</li><li>Korfanty, G. A., Dixon, M., Jia, H., Yoell, H., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+diversity+and+dispersal+of+Aspergillus+fumigatus+in+Arctic+soils.">Genetic diversity and dispersal of Aspergillus fumigatus in Arctic soils.</a> Genes. 13 (1), 19 (2021).</li><li>Snelders, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Possible+environmental+origin+of+resistance+of+Aspergillus+fumigatus+to+medical+triazoles.">Possible environmental origin of resistance of Aspergillus fumigatus to medical triazoles.</a> Applied and Environmental Microbiology. 75 (12), 4053-4057 (2009).</li><li>Wang, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mechanisms+and+genetic+relatedness+of+the+human+pathogenic+fungus+Aspergillus+fumigatus+exhibiting+resistance+to+medical+azoles+in+the+environment+of+Taiwan.">mechanisms and genetic relatedness of the human pathogenic fungus Aspergillus fumigatus exhibiting resistance to medical azoles in the environment of Taiwan.</a> Environmental Microbiology. 20 (1), 270-280 (2018).</li></ol>

The authors have no conflicts of interest to declare.

The protocol developed for isolating yeasts and A. fumigatus from soil is a fast and efficient method for high-throughput soil processing and fungal isolation. The protocol only requires a small amount of soil (0.1-0.2 g) per sample, allowing for more sites to be sampled with similar effort. The quick turnaround time ensures that results can be obtained within a short timeframe and allows time for troubleshooting and repeating experiments if necessary. This protocol can be easily replicated across many laboratory settings using standard microbiology and cell culturing equipment. However, when isolating yeast or molds from international soil, extra precautionary measures are required. All non-disposable plastic equipment, such as plastic trays and cell spreaders, should be sterilized by submersion in 10% bleach, followed by autoclaving. The used bench coat should be sealed in a plastic bag and sterilized in an autoclave prior to discarding.
To note, the number and identity of yeasts isolated using the protocol above can be limited by the incubating conditions and media used. For example, 24 h incubation in the roller drum can favor the isolation of fast-growing aerobic yeasts over slow-growing species. In addition, the use of nutrient-rich YEPD medium for yeast isolation may have excluded yeast species with different nutrient requirements and preferences. Furthermore, most locations sampled here experience seasonal variations in temperature and other climatic conditions throughout the year. If time and resources permit, the same soil samples can be processed under a range of different temperatures to allow for isolation of a broader range of yeasts that inhabit these soils.
While culture-independent methods are crucial for elucidating large-scale patterns in environmental fungal diversity, they fail to be sufficiently informative for targeted groups of fungi such as yeasts. The use of culture-dependent isolation allowed for a comprehensive investigation of global soil yeast diversity and its predictors9. While the metagenomics study conducted by Tedersoo and colleagues identified global predictors and patterns in soil fungal diversity, the extent to which these findings apply specifically to yeast diversity could not be elucidated2. Tedersoo and colleagues identified mean annual precipitation as a major climatic driver of soil fungal diversity worldwide2. This study found a similar correlation between mean annual precipitation and culturable yeast diversity in global soils, highlighting that culture-dependent methods can complement and expand on findings of high-throughput sequencing approaches9.
The addition of chloramphenicol is an important step in the preparation of both solid and liquid media to prevent fungal growth interference by bacteria. The addition of chloramphenicol to liquid media is crucial as the lack of antibiotics will allow the bacteria present in the soil to ferment. This will lead to the production of gases that will forcibly open microcentrifuge tubes or 13 mL culture tubes used during soil incubation in the protocol. If bacterial contamination in chloramphenicol containing agar/broth is an issue, chloramphenicol may be substituted or supplemented with stronger antibiotics. When isolating A. fumigatus from soil, SD broth may be substituted with a Tween 20 solution (0.2 M NaCl with 1% Tween 20) to help suspend the hydrophobic A. fumigatus conidia35,36. Following suspension, 100 &#181;L can be plated onto SD agar and incubated at 50 &#176;C.
Aspergillus fumigatus grows quickly and sporulates abundantly when incubated alone on both SD agar and MEA media between 22 &#176;C and 50 &#176;C. However, depending on what other thermotolerant species are present in the soil sample, A. fumigatus growth and sporulation may be hindered (Figure 3A,D). Under such a situation, one to several subculturing steps may be required to obtain a pure colony for subsequent harvest and characterization.
The fragment analysis of A. fumigatus strains in Figure 5 was conducted using the program Osiris. Several PCR artifacts have been highlighted in Figure 5C and are discussed in detail by De Valk et al.30. B-1 stutter peaks that have shorter repeat values are caused by strand slippage during the synthesis of the antisense strand by the DNA polymerase. N-1 peaks occur if the DNA concentration is too high during PCR. The recommended DNA concentration is 0.1 ng as stated in the protocol above. Another artifact is dye bleeding that can be remediated using fluorescent labels with non-overlapping absorbance wavelengths. For example, the fluorescent labels 6-FAM, HEX, and ATTO550, as well as the LIZ600 dye standard, generate distinct fragment peaks (Figure 5). Lastly, to prevent off-scale peaks, dilute each PCR reaction (in this case, it was ~50x dilution) prior to capillary electrophoresis. To further reduce fluorescence of the unused forward primers in the reaction mixture, halve the forward primer concentrations relative to the reverse primers when creating the master mix.
The high throughput and conservative nature of this protocol allows for a relatively quick and easy acquisition of many yeasts and molds from soils. However, there are two main limitations present with the sampling methodology. First, the morphological characteristics of yeast colonies grown from soil were used to select for unique species. These were then subcultured and used for species identification via ITS sequencing. This was done to maximize the representation of yeast species present. However, yeast species that shared similar or identical morphologies to the selected colonies may fail to be subcultured. Second, during A. fumigatus isolation,&#160;as only one individual colony is selected per soil sample, the presence of multiple individuals within the soil sample will be missed. This may lead to an underrepresentation of the true genetic diversity present within the sample population, as unique genotypes present within the same soil sample will not be collected. To mitigate this issue, during the streak for single colony step following the first culturing on solid media, several single colonies can be collected to obtain additional genotypes. The small volume of soil used per sample helps minimize this sampling limitation when compared to methods that used larger quantities of soil per sample.
The use of this high-throughput and labor-efficient protocol for the isolation of yeast and mold will increase the number of individuals within soil population while using less effort per sample. The increase in statistical power will provide a better picture of culturable yeast communities within the soil and help characterize soil populations of A. fumigatus.

Fungi in soil ecosystems play essential roles in organic matter decomposition, nutrient cycling, and soil fertilization1. Both culture-independent (i.e., high-throughput sequencing) and culture-dependent approaches are widely used in the study of soil fungi2,3. While the large amount of data generated by high-throughput metabarcode sequencing is useful for elucidating broad-scale patterns in community structure and diversity, the culture-dependent approach can provide highly complementary information on the taxonomic and functional structures of fungal communities, as well as more specific profiles of individual organisms through downstream diversity and functional analyses due to the availability of pure fungal cultures.
Despite rarely exceeding thousands of cells per gram of soil, yeasts, broadly defined as unicellular fungi, are essential decomposers and food sources for other soil dwellers4,5. In fact, yeasts may be the predominant soil fungi in cold biospheres such as continental Antarctica6,7. Soil is also a primary reservoir of medically relevant yeasts that cause serious opportunistic infections in humans and other mammals8. Despite morphological similarities, yeast species are phylogenetically diverse and occur among filamentous fungi in two major phyla, Ascomycota and Basidiomycota, within the fungal kingdom9. Yeasts lack a defining DNA signature at the fungal barcoding gene, the internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene cluster10, making them indistinguishable from other fungi in metagenomics investigations and thus necessitating the use of culture-dependent methods to isolate yeast species.
The protocol below was implemented to characterize soil yeast communities of nine countries and identify global trends and patterns in soil yeast diversity9,11,12. Metagenomics approaches are of limited use when studying targeted groups of organisms such as yeasts2,3. Due to their phylogenetic diversity, yeasts cannot be distinguished from other fungi based on DNA sequence alone. Thus, studying yeast populations requires the continued use of culture-dependent isolation. However, culturing is often significantly more time-consuming and requires more personnel to perform the experiments. Therefore, the protocol has been optimized and streamlined for faster processing with limited personnel. The main advantage of culturing is that the yeast species identified are living yeasts and not dead ones, and thus are more likely to be true soil dwellers rather than transient cells present in the soils. It has been estimated that approximately 40% of fungal DNA in soil are either contaminants from other environments, extracellular, or come from cells that are no longer intact, causing high-throughput sequencing approaches to overestimate fungal richness by as much as 55%13. Culture-dependent isolation can readily confirm yeast species identity with the added benefit of securing pure culture to be used in downstream analyses. Indeed, pure cultures of 44 putative new yeast species were identified using this soil isolation protocol that allowed the use of a range of methods to study their taxonomic and functional properties in detail14.
The protocol below can also be used to isolate molds present within soil, such as A. fumigatus. Aspergillus fumigatus is a thermophilic and saprophytic mold with a wide, global distribution in soil15.&#160;It has been isolated from numerous clinical and non-clinical environments. Non-clinical sampling commonly includes air, organic debris (compost, saw dust, tulip bulb waste), and soil (agricultural, garden, and natural soils)16,17,18,19. Aspergillus fumigatus is a human opportunistic pathogen causing a range of infections collectively termed aspergillosis, affecting over 8 million people worldwide16,20. Approximately 300,000 people around the globe suffer from invasive aspergillosis, which is the most severe form of aspergillosis16. Depending on factors such as the patient population, site of infection, and efficacy of antifungal therapy, mortality rate can be as high as 90%. Over the past several decades, resistance to antifungal therapies has increased, requiring global surveillance efforts in both clinical and environmental populations to track these resistance genotypes21,22,23. Given its ability to grow at temperatures upward of 50 &#176;C, this temperature can be exploited to select for A. fumigatus isolates from soil using culture-dependent methods. Aspergillus fumigatus isolates are commonly genotyped at nine highly polymorphic short tandem repeat (STR) loci, shown to have high discriminatory power between strains24. These STR genotypes can be compared to other previously surveyed populations to track the spread of A. fumigatus genotypes, including drug-resistance genes, around the world.
Below we describe a protocol for the speedy isolation of yeasts and A. fumigatus from soil samples in a culture-dependent manner. Depending on the amount of soil obtained per sample, the soil samples can be shared between the two protocols. In comparison to similar methods that isolate yeast and A. fumigatus from soil, this protocol uses 10x less soil per isolate obtained. Studies attempting to isolate A. fumigatus from soil require between 1 and 2 g of soil per isolate, whereas this protocol requires only 0.1-0.2 g of soil18,19,25. This protocol utilizes smaller plastics and containers that facilitate its high-throughput design. Therefore, a larger number of samples can be processed using less space for equipment such as incubators and roller drums. Soil samples can be fully processed to obtain isolates in as little as 7 days. This protocol has been optimized to allow processing of up to 150-200 samples per day per person.

<table><tbody><tr><td>1.5 mL microcentrifuge tube</td><td>Sarstedt Inc</td><td>72.690.001</td><td></td></tr><tr><td>Benomyl powder&amp;nbsp;</td><td>Toronto Research Chemicals</td><td>B161380</td><td></td></tr><tr><td>Chloramphenicol powder&amp;nbsp;</td><td>Sigma-Aldrich</td><td>SKU: C0378-5G</td><td></td></tr><tr><td>Dextrose</td><td>Sigma-Aldrich</td><td>SKU: D9434-500G</td><td></td></tr><tr><td>Fragment Analysis Software</td><td>NCBI&#039;s Osiris</td><td></td><td>https://www.ncbi.nlm.nih.gov/osiris/</td></tr><tr><td>ITS sequence database</td><td>NCBI GenBank&amp;nbsp;</td><td></td><td>https://www.ncbi.nlm.nih.gov/genbank/</td></tr><tr><td>ITS sequence database</td><td>UNITE&amp;nbsp;</td><td></td><td>https://unite.ut.ee/</td></tr><tr><td>Peptone</td><td>Sigma-Aldrich</td><td>SKU: P5905-500G</td><td></td></tr><tr><td>Reusable cell spreaders&amp;nbsp;</td><td>Fisher Scientific</td><td>08-100-12</td><td></td></tr><tr><td>Sterile 10 cm diameter Petri dishes&amp;nbsp;</td><td>Sarstedt Inc</td><td>83.3902</td><td></td></tr><tr><td>Sterile 13 mL culture tubes&amp;nbsp;</td><td>Sarstedt Inc</td><td>62.515.006</td><td></td></tr><tr><td>Wooden plain-tipped applicator sticks&amp;nbsp;</td><td>Fisher Scientific</td><td>23-400-112</td><td></td></tr><tr><td>Yeast extract</td><td>Sigma-Aldrich</td><td>SKU: Y1625-250G</td><td></td></tr></tbody></table>

isolation of culturable yeasts and molds from soils to investigate fungal population structure

Soil is host to an incredible amount of microbial life, with each gram containing up to billions of bacterial, archaeal, and fungal cells. Multicellular fungi such as molds and unicellular fungi, broadly defined as yeasts, fulfill essential roles in soil ecosystems as decomposers of organic material and as food sources for other soil dwellers. Fungal species diversity in soil is dependent on a multitude of climatic factors such as rainfall and temperature, as well as soil properties including organic matter, pH, and moisture. Lack of adequate environmental sampling, especially in regions of Asia, Africa, South America, and Central America, hinders the characterization of soil fungal communities and the discovery of novel species. 
We characterized soil fungal communities in nine countries across six continents using ~4,000 soil samples and a protocol developed in the laboratory for the isolation of yeasts and molds. This protocol begins with separate selective enrichment for yeasts and the medically relevant mold Aspergillus fumigatus, in liquid media while inhibiting bacterial growth. Resulting colonies are then transferred to solid media and further processed to obtain pure cultures, followed by downstream genetic characterization. Yeast species identity is established via sequencing of their internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene cluster, while global population structure of A. fumigatus is explored via microsatellite marker analysis. 
The protocol was successfully applied to isolate and characterize soil yeast and A. fumigatus populations in Cameroon, Canada, China, Costa Rica, Iceland, Peru, New Zealand, and Saudi Arabia. These findings revealed much-needed insights on global patterns in soil yeast diversity, as well as global population structure and antifungal resistance profiles of A. fumigatus. This paper presents the method of isolating both yeasts and A. fumigatus from international soil samples.

Yeast isolation from soil 
The above yeast isolation protocol was implemented to culture yeasts from soil samples originating from 53 locations in nine countries9,12. In total, 1,473 yeast strains were isolated from 3,826 soil samples. Given the different climatic conditions of the nine originating countries, the best incubation temperature for each country was determined based on its mean annual temperature (Table 1). Given the slower yeast growth at 14 &#176;C, soil samples from Iceland were incubated on a roller drum for an additional 48 h (96-120 h total). Following 2-3 days of incubation on solid medium, microbial growth was visible on plates for all samples (Figure 1A). A randomly selected colony for each yeast morphology present on a plate was streaked for single colonies on fresh plates (Figure 1B).
The rate of successful yeast isolation differed between countries (Table 1). For example, 97 yeast strains were cultured from 562 Saudi Arabian soil samples (17.3%), whereas 261 yeasts were cultured from 300 Canadian soil samples (87%). A rarefaction analysis should be performed to determine if sufficient soil sampling has been conducted to obtain accurate estimates of the true yeast diversity in sampled locations. An example rarefaction analysis for each country was preformed where the Shannon diversity index was used as a measure of soil yeast diversity (Figure 2). The resulting rarefaction curves approached the saturation asymptote indicating that additional sampling was not likely to have yielded more yeast diversity.
Sequencing of the ITS region revealed that the 1,473 yeast isolates can be categorized into 134 distinct species. This included 90 known species and 44 potentially novel species. We applied a mixed-effects model to identify predictors of global culturable soil yeast diversity, as quantified by the Shannon diversity index31. In this model, mean annual precipitation, mean annual temperature, elevation, and distance to equator of the sampling locations were fitted as fixed effects, while sampling country was set as a random effect9. This model identified mean annual precipitation to be significantly correlated with the Shannon diversity index (p = 0.012), while no significant correlations were found between other predictor variables and the Shannon diversity index9.
To compare this culture-based protocol to culture-independent methods, we compared these findings to a previous study by Tedersoo and colleagues that investigated global diversity of soil fungi using metagenomics2. Tedersoo and colleagues performed high-throughput sequencing of the ITS region on DNA directly extracted from soil samples of 39 countries, four of which, namely Cameroon, Canada, China, and New Zealand, were also sampled in this study. We performed BLAST searches to identify ITS sequences present in both datasets32, and found 26% of the ITS sequences had a significant match (&#62;98.41% nucleotide identity) in the metagenomics dataset. However, &#60;3% matched a fungal sequence from the same country, while the remaining 23% matched a fungal sequence found in a different country9. We were more successful than the metagenomics study in annotating the ITS sequences with yeast species identity. Tedersoo and colleagues reported a total of 50,589 fungal operational taxonomic units (OTUs), with the number of yeast OTUs not known. Of these fungal OTUs, 33% were merely annotated as environmental_sequence (724, 1.4%), uncultured_soil_fungus (2,405, 4.8%), uncultured_ectomycorrhizal_fungus (1,407, 2.8%), or uncultured_fungus (11,898, 23.5%).
Aspergillus fumigatus isolation from soil 
After 3 days of soil incubation at 50 &#176;C in 1 mL of SDB in a microcentrifuge tube, mycelia may be found growing within the SDB, on the SDB to air boundary, and/or on the inside walls. Aspergillus fumigatus mycelia are typically found growing on the SDB to air boundary but can also be harvested from just below the SDB surface. After this step, the mycelia are transferred to MEA and grown for 3 days at 37 &#176;C. Mycelial growth on plates may only form the green suede morphology typical of A. fumigatus (Figure 3A). More commonly, other thermotolerant molds may be present within the same soil and grow with A. fumigatus on the same plate or by themselves (Figure3B-D). Aspergillus fumigatus isolation rates may vary between geographic locations, similar to what has been found for soil yeasts. For example, within Vancouver, Canada, 251 isolates were obtained through this method from 540 soil samples (46.5%) (unpublished results). By contrast, within Cameroon, 51 A. fumigatus isolates were harvested from 495 soil samples (10.3%)33.
A. fumigatus conidiophore structure can be viewed and identified using light microscopy. Conidiophores have a ball on stick morphology (Figure 4). Additionally, A. fumigatus conidiophores are uniseriate, where the phialides, attached to the conidia chains, are attached directly to the spherical vesicle. In other Aspergillus species, conidiophores are biseriate, where the phialides are connected to metulae attached to the vesicle.
Several software programs are available to perform fragment analysis of the raw data from capillary electrophoresis, converting the capillary electrophoresis spectrum to fragment sizes. Figure 5 is a chromatogram generated by the program Osiris. The three channels visualizing the fragment lengths of A. fumigatus dinucleotide (2A, 2B, and 2C), trinucleotide (3A, 3B, and 3C), and tetranucleotide (4A, 4B, and 4C) STR loci are shown. In addition, PCR artifacts that occur if the sample DNA concentration during PCR is too high are also shown. The highest peaks of each color represent the fragment sizes of the three STR loci in this plot.
The genetic variation present between A. fumigatus STR genotypes can be visualized using the R package poppr. The R script bruvo.msn creates a pairwise Bruvo&#39;s genetic distances matrix between each pair of genotypes. This matrix is then used to generate a minimum spanning network (MSN). A high-quality MSN can then be generated using the R script plot_poppr_msn or imsn (Figure 6). A discriminatory analysis of principal components (DAPC) is another method to visualize the genetic relationships among strains (Figure 7). The R script dapc in the R package adegenet is used to perform DAPC and can be used with known or unknown group priors. With unknown group priors, it uses K-means clustering to identify the likely number of groups of individuals.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63396/63396fig01.jpg" /> 
Figure 1: Yeast isolation from soil samples. (A) Microbial growth is visible on solid agar following 2-3 days of incubation. Yeast colonies can be seen interspersed among other fungal/bacterial colonies. One representative yeast colony for each morphological type on a plate is selected to streak for single colonies. (B)&#160;Three streaks are performed to obtain single colonies of yeast isolates. One plate was used to obtain each soil isolate. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63396/63396fig02.jpg" /> 
Figure 2: Rarefaction analysis of soil sampling. In each of the nine sampled countries, soil yeast diversity, as quantified by the Shannon diversity index, approaches saturation as the number of soil sample increases. This figure was adapted from 9. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63396/63396fig03.jpg" /> 
Figure 3: Aspergillus fumigatus morphology on Sabouraud dextroseagar. (A) Green suede-like A. fumigatus growth morphology. (B-D) A. fumigatus growth with other thermophilic molds present within the soil sample. A. fumigatus conidiation is visibly reduced in B and D. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63396/63396fig04.jpg" /> 
Figure 4: Photo of an Aspergillus fumigatus conidiophore under a light microscope. Scale bar = 10 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63396/63396fig05.jpg" /> 
Figure 5: Osiris output of nine microsatellite loci from an Aspergillus fumigatus strain. The outputs correspond to the (A) Dinucleotide (2A, 2B, and 2C), (B) trinucleotide (3A, 3B, and 3C), and (C) tetranucleotide (4A, 4B, and 4C) STR loci. Forward primer 5` fluorescent labels are: A = 6-FAM; B = HEX; C = ATTO550. Multiplex reaction products were diluted 30x prior to capillary electrophoresis. The LIZ600 dye standard was used during capillary electrophoresis. Raw data was analyzed using the peak analysis software Osiris identifying potential peaks between 60 and 400 bp. Several PCR artifacts are off-scale peaks that cause fluorescence bleeding, stutter peaks, and N-1 peaks (C). Abbreviations: 6-FAM = 6-carboxyfluorescein; HEX = hexachlorofluorescein; STR = short tandem repeats; RFU = relative fluorescence units; BPS = base pairs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/63396/63396fig06.jpg" /> 
Figure 6: Minimum-spanning network showing the genetic relationship between MLGs of A. fumigatus from Iceland and Northwest Territories in Canada. Each node represents one MLG, where node size corresponds to the number of strains for each MLG. Nodes that are more genetically similar have darker and thicker edges, whereas nodes genetically distant have lighter and thinner edges. This figure was adapted from 34. Abbreviations: ISL = Iceland; NWT = Northwest Territories in Canada; MLG = multilocus genotype. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/63396/63396fig07.jpg" /> 
Figure 7: Genetic clustering using Discriminant Analysis of Principal Components (DAPC) of Iceland, NWT, Eurasian, North American, and Oceanian A. fumigatus populations. Isolates were genotyped at nine microsatellite loci and clone-corrected, totaling 1,703 unique multilocus genotypes. Genotypes were colored according to geographic origins. This figure was adapted from 34. Abbreviations: DAPC = discriminant analysis of principal components; NWT = Northwest Territories; ISL = Iceland; CMR = Cameroon; CAN = Hamilton, Ontario, Canada; BEL = Belgium; FRA = France; DEU = Germany; IND = India; NLD = Netherlands; NOR = Norway; NZL = New Zealand; ESP = Spain; CHE = Switzerland; USA = United States. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63396/63396fig07large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Country</td>
			<td>Incubation temperature (&#176;C)</td>
			<td>Soil samples</td>
			<td>Yeast isolates</td>
			<td>Known species/ Novel species</td>
		</tr>
		<tr>
			<td>Cameroon</td>
			<td>30</td>
			<td>493</td>
			<td>110</td>
			<td>&#160;10/9</td>
		</tr>
		<tr>
			<td>Canada</td>
			<td>23</td>
			<td>300</td>
			<td>261</td>
			<td>34/12</td>
		</tr>
		<tr>
			<td>China</td>
			<td>23</td>
			<td>340</td>
			<td>230</td>
			<td>23/5</td>
		</tr>
		<tr>
			<td>Costa Rica</td>
			<td>30</td>
			<td>388</td>
			<td>95</td>
			<td>20/2</td>
		</tr>
		<tr>
			<td>France</td>
			<td>23</td>
			<td>327</td>
			<td>175</td>
			<td>&#160;12/2</td>
		</tr>
		<tr>
			<td>Iceland</td>
			<td>14</td>
			<td>316</td>
			<td>211</td>
			<td>&#160;11/0</td>
		</tr>
		<tr>
			<td>New Zealand</td>
			<td>23</td>
			<td>610</td>
			<td>155</td>
			<td>14/4</td>
		</tr>
		<tr>
			<td>Peru</td>
			<td>23</td>
			<td>490</td>
			<td>139</td>
			<td>30/9</td>
		</tr>
		<tr>
			<td>Saudi Arabia</td>
			<td>30</td>
			<td>562</td>
			<td>97</td>
			<td>&#160;8/1</td>
		</tr>
		<tr>
			<td>Total</td>
			<td></td>
			<td>3826</td>
			<td>1473</td>
			<td>90/44</td>
		</tr>
	</tbody>
</table>
Table 1: Soil yeast isolation from nine countries in six continents. Incubation temperature for soil samples from each country was determined based on its mean annual temperature. Results presented here are adapted from 9, 12.

Watch this Scientific Journal Video about Isolation of Culturable Yeasts and Molds from Soils to Investigate Fungal Population Structure at JoVE.com

Isolation of Culturable Yeasts and Molds from Soils to Investigate Fungal Population Structure

This protocol is an effective, speedy method of culturing yeasts and the mold Aspergillus fumigatus from large sets of soil samples in as little as 7 days. The methods can be easily modified to accommodate a range of incubation media and temperatures as needed for experiments.

Soil is host to an incredible amount of microbial life, with each gram containing up to billions of bacterial, archaeal, and fungal cells. Multicellular ...

isolation-culturable-yeasts-molds-from-soils-to-investigate-fungal

Nanyang Technological University

Research

JoVE Journal

Biology

5.2K Views.  McMaster University. This protocol is an effective, speedy method of culturing yeasts and the mold Aspergillus fumigatus from large sets of soil samples in as little as 7 days. The methods can be easily modified to accommodate a range of incubation media and temperatures as needed for experiments. 

Video: Isolation of Culturable Yeasts and Molds from Soils to Investigate Fungal Population Structure

Transformation of Probiotic Yeast and Their Recovery from Gastrointestinal Immune Tissues Following Oral Gavage in Mice

Development of recombinant oral therapy would allow for more direct targeting of the mucosal immune system and improve the ability to combat gastrointestinal disorders. Adapting probiotic yeast in particular for this approach carries several advantages. These strains have not only the potential to synthesize a wide variety of complex heterologous proteins but are also capable of surviving and protecting those proteins during transit through the intestine. Critically, however, this approach requires expertise in many diverse laboratory techniques not typically used in tandem. Furthermore, although individual protocols for yeast transformation are well characterized for commonly used laboratory strains, emphasis is placed here on alternative approaches and the importance of optimizing transformation for less well characterized probiotic strains. Detailing these methods will help facilitate discussion as to the best approaches for testing probiotic yeast as oral drug delivery vehicles and indeed serve to advance the development of this novel strategy for gastrointestinal therapy.

Presented here is a unified description of techniques that can be used to develop, transform, administer, and test heterologous protein expression of the probiotic yeast Saccharomyces boulardii.

Development of recombinant oral therapy would allow for more direct targeting of the mucosal immune system and improve the ability to combat ...

Immunology and Infection

Yeast Colony Embedding Method

Patterning of different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms also display patterns of cell types. For example, in the yeast S. cerevisiae, sporulated cells and pseudohyphal cells are not uniformly distributed in colonies. The functional importance of patterning and the molecular mechanisms that underlie these patterns are still poorly understood.
One challenge with respect to investigating patterns of cell types in fungal colonies is that unlike metazoan tissue, cells in colonies are relatively weakly attached to one another. In particular, fungal colonies do not contain the same extensive level of extracellular matrix found in most tissues . Here we report on a method for embedding and sectioning yeast colonies that reveals the interior patterns of cell types in these colonies. The method can be used to prepare thick sections (0.5 &mu;) useful for light microscopy and thin sections (0.1 &mu;) suitable for transmission electron microscopy. Asci and pseudohyphal cells can easily be distinguished from ovoid yeast cells by light microscopy , while the interior structure of these cells can be visualized by EM.
The method is based on surrounding colonies with agar, infiltrating them with Spurr's medium, and then sectioning. Colonies with a diameter in the range of 1-2 mm are suitable for this protocol. In addition to visualizing the interior of colonies, the method allows visualization of the region of the colony that invades the underlying agar.

A method for embedding yeast colonies allowing sectioning for light and electron microscopy. This protocol allows determination of the distribution of sporulated cells and pseudohyphal cells within colonies providing a new tool toward understanding the organization of cell types within a fungal community.

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

High Throughput Yeast Strain Phenotyping with Droplet-Based RNA Sequencing

The powerful tools available to edit yeast genomes have made this microbe a valuable platform for engineering. While it is now possible to construct libraries of millions of genetically distinct strains, screening for a desired phenotype remains a significant obstacle. With existing screening techniques, there is a tradeoff between information output and throughput, with high-throughput screening typically being performed on one product of interest. Therefore, we present an approach to accelerate strain screening by adapting single cell RNA sequencing to isogenic picoliter colonies of genetically engineered yeast strains. To address the unique challenges of performing RNA sequencing on yeast cells, we culture isogenic yeast colonies within hydrogels and spheroplast prior to performing RNA sequencing. The RNA sequencing data can be used to infer yeast phenotypes and sort out engineered pathways. The scalability of our method addresses a critical obstruction in microbial engineering.

A bottleneck in the &#8216;design-build-test&#8217; cycle of microbial engineering is the speed at which we can perform functional screens of strains. We describe a high-throughput method for strain screening applied to hundreds to thousands of yeast cells per experiment that utilizes droplet-based RNA sequencing.

The powerful tools available to edit yeast genomes have made this microbe a valuable platform for engineering. While it is now possible to construct ...

Bioengineering

Microfluidic Tools for Probing Fungal-Microbial Interactions at the Cellular Level

Filamentous fungi are successful inhabitants of soil and play a major role in soil ecosystems, such as in the decomposition of organic and inorganic matter, as well as regulation of nutrient levels. There they also find numerous opportunities to interact with a variety of other microbes such as bacteria or other fungi. Studying fungal interactions at the cellular level, however, can be challenging owing to the black box-like nature of soil. New microfluidic tools are being developed for the study of fungal interactions; two platforms designed to study bacterial-fungal and fungal-fungal interactions are highlighted. Within these microchannels, fungal-microbial interactions can be monitored in controlled physico-chemical environments at higher temporal and spatial resolution than previously possible. Application of these tools have yielded numerous novel biological insights, such as the observation of bacterial polar attachment to hyphae or revealing uncharacterised fungal-fungal antagonisms. A key feature of these methodologies regards the ease of use of this tool by non-experts, yielding highly translatable technologies for use in microbiology labs.

Owing to the opacity of soil, interactions between its constituent microbes cannot easily be visualised with cellular resolution. Here, two microfluidic tools are presented, which offer new opportunities for investigating fungal-microbial interactions. The devices are versatile and simple to use, enabling high spatiotemporal control and high-resolution imaging at the cellular level.

Filamentous fungi are successful inhabitants of soil and play a major role in soil ecosystems, such as in the decomposition of organic and inorganic ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Protocol for Co-Culturing Sucrose-Secreting Cyanobacteria with Fungal Partners

Assembly and Quantification of Co-Cultures Combining Heterotrophic Yeast with Phototrophic Sugar-Secreting Cyanobacteria

With the increasing demand for sustainable biotechnologies, mixed consortia containing a phototrophic microbe and heterotrophic partner species are being explored as a method for solar-driven bioproduction. One approach involves the use of CO2-fixing cyanobacteria that secrete organic carbon to support the metabolism of a co-cultivated heterotroph, which in turn transforms the carbon into higher-value goods or services. In this protocol, a technical description to assist the experimentalist in the establishment of a co-culture combining a sucrose-secreting cyanobacterial strain with a fungal partner(s), as represented by model yeast species, is provided. The protocol describes the key prerequisites for co-culture establishment: Defining the media composition, monitoring the growth characteristics of individual partners, and the analysis of mixed cultures with multiple species combined in the same growth vessel. Basic laboratory techniques for co-culture monitoring, including microscopy, cell counter, and single-cell flow cytometry, are summarized, and examples of nonproprietary software to use for data analysis of raw flow cytometry standard (FCS) files in line with FAIR (Findable, Accessible, Interoperable, Reusable) principles are provided. Finally, commentary on the bottlenecks and pitfalls frequently encountered when attempting to establish a co-culture with sugar-secreting cyanobacteria and a novel heterotrophic partner is included. This protocol provides a resource for researchers attempting to establish a new pair of co-cultured microbes that includes a cyanobacterium and a heterotrophic microbe.

This protocol provides a comprehensive guideline for the setup and quantitative monitoring of co-cultures, including photoautotrophic sugar-secreting cyanobacteria and heterotrophic yeasts.

With the increasing demand for sustainable biotechnologies, mixed consortia containing a phototrophic microbe and heterotrophic partner species are being ...

Investigating Teliospore Germination Using Microrespiration Analysis and Microdissection

Smut fungi are the etiological agents of several devastating agricultural diseases. They are characterized by the production of teliospores, which are thick-walled dispersal agents. Teliospores can remain dormant for decades. The dormancy is characterized by low metabolic rates, paused macromolecular biosynthesis and greatly reduced levels of respiration. Upon receiving required environmental signals, teliospores germinate to produce haploid cells, which can initiate new rounds of infection. Teliospore germination is characterized by the resumption of macromolecular biosynthesis, increased respiration and dramatic morphological changes. In order to precisely measure changes in cellular respiration during the early stages of germination, we have developed a simple protocol employing a Clark-type respirometer. The later stages of germination are distinguished by specific morphological changes, but germination is asynchronous. We developed a microdissection technique that enables us to collect teliospores at distinct germination stages.

Smut fungi cause many devastating agricultural diseases. They are dispersed as dormant teliospores that germinate in response to environmental cues. We outline two methods to investigate molecular changes during germination: measuring respiration increase to detect metabolic activation and assessing changing molecular events by isolating teliospores at distinct morphological stages.

Smut fungi are the etiological agents of several devastating agricultural diseases. They are characterized by the production of teliospores, which are ...

Isolation and Screening from Soil Biodiversity for Fungi Involved in the Degradation of Recalcitrant Materials

Environmental pollution is an increasing problem, and identifying fungi involved in the bioremediation process is an essential task. Soil hosts an incredible diversity of microbial life and can be a good source of these bioremediative fungi. This work aims to search for soil fungi with bioremediation potential by using different screening tests. Mineral culture media supplemented with recalcitrant substances as the sole carbon source were used as growth tests. First, soil dilutions were plated on Petri dishes with mineral medium amended with humic acids or lignocellulose. The growing fungal colonies were isolated and tested on different substrates, such as complex mixtures of hydrocarbons (petrolatum and used motor oil) and powders of different plastic polymers (PET, PP, PS, PUR, PVC). Qualitative enzymatic tests were associated with the growth tests to investigate the production of esterases, laccases, peroxidases, and proteases. These enzymes are involved in the main degradation processes of recalcitrant material, and their constitutive secretion by the examined fungal strains could have the potential to be exploited for bioremediation. More than 100 strains were isolated and tested, and several isolates with good bioremediation potential were found. In conclusion, the described screening tests are an easy and low-cost method to identify fungal strains with bioremediation potential from the soil. In addition, it is possible to tailor the screening tests for different pollutants, according to requirements, by adding other recalcitrant substances to minimal culture media.

Here, we present a protocol for screening soil biodiversity to look for fungal strains involved in the degradation of recalcitrant materials. First, fungal strains able to grow on humic acids or lignocellulose are isolated. Their activity is then tested both in enzymatic assays and on pollutants such as hydrocarbons and plastics.

Environmental pollution is an increasing problem, and identifying fungi involved in the bioremediation process is an essential task. Soil hosts an ...

Isolation, Characterization, and Total DNA Extraction to Identify Endophytic Fungi in Mycoheterotrophic Plants

Mycoheterotrophic plants present one of the most extreme forms of mycorrhizal dependency, having totally lost their autotrophic capacity. As essential as any other vital resource, the fungi with which these plants intimately associate are essential for them. Hence, some of the most relevant techniques in studying mycoheterotrophic species are the ones that enable the investigation of associated fungi, especially those inhabiting roots and subterranean organs. In this context, techniques for identifying culture-dependent and culture-independent endophytic fungi are commonly applied. Isolating fungal endophytes provides a means for morphologically identifying them, analyzing their diversity, and maintaining inocula for applications in the symbiotic germination of orchid seeds. However, it is known that there is a large variety of non-culturable fungi inhabiting plant tissues. Thus, culture-independent molecular identification techniques offer a broader cover of species diversity and abundance. This article aims to provide the methodological support necessary for starting two investigation procedures: a culture-dependent and an independent one. Regarding the culture-dependent protocol, the processes of collecting and maintaining plant samples from collection sites to laboratory facilities are detailed, along with isolating filamentous fungi from subterranean and aerial organs of mycoheterotrophic plants, keeping a collection of isolates, morphologically characterizing hyphae by slide culture methodology, and molecular identification of fungi by total DNA extraction. Encompassing culture-independent methodologies, the detailed procedures include collecting plant samples for metagenomic analyses and total DNA extraction from achlorophyllous plant organs using a commercial kit. Finally, continuity protocols (e.g., polymerase chain reaction [PCR], sequencing) are also suggested for analyses, and techniques are presented here.

The current article aims to provide detailed and adequate protocols for the isolation of plant-associated endophytic fungi, long-term preservation of isolates, morphological characterization, and total DNA extraction for subsequent molecular identification and metagenomic analyses.

Mycoheterotrophic plants present one of the most extreme forms of mycorrhizal dependency, having totally lost their autotrophic capacity. As essential as ...

Isolating Nucleic Acids from Yeast

One of the many advantages to using yeast as a model system is that large quantities of biomacromolecules, including nucleic acids (DNA and RNA), can be purified from the cultured cells.
This video will address the steps required to carry out nucleic acid extraction. We will begin by briefly outlining the growth and harvest, and lysis of yeast cells, which are the initial steps common to the isolation of all biomacromolecules. Next, we will discuss two unique purification methods for the separation of nucleic acids: column binding and phase separation. Additionally, we will demonstrate several ways in which these methods are applied in the laboratory, including the preparation of nucleic acids for molecular biology techniques such as PCR and southern blotting, quantification of gene expression in response to environmental stimuli, and purification of large amounts of recombinant proteins.

Isolation and Purification of Nucleic Acids from Yeast

One of the many advantages to using yeast as a model system is that large quantities of biomacromolecules, including nucleic acids (DNA and RNA), can be ...