We acknowledge Chi-Chung Chen from the Department of Medical Research, Chi Mei Medical Center (Tainan, Taiwan) for the help in mouse infection, and the support from the laboratory animal center of National Cheng Kung University. This work is supported by the Minister of Science and Technology (MOST) grants (MOST 104-2321-B-006-019, 105-2321-B-006 -011, and106-2321-B-006 -005) to CC.

Caution: EHEC O157:H7 is a biosafety level 2 (BSL-2) pathogen according to the Centers for Disease Control and Prevention (CDC) biosafety instruction (https://www.cdc.gov/). Therefore, all experimental procedures involving EHEC must be performed in a BSL-2 facility. Wear lab coats and gloves while performing the experiment. Work in a certified biosafety cabinet (BSC). Disinfect the experimental bench before and after the experimental procedure with 70% ethanol. All instruments or equipment that contact (or potentially contact) EHEC should be disinfected with 70% ethanol or bleach. Contaminated (or potentially contaminated) wastes should be sealed and autoclaved carefully. Wear a mask, eye protection, double gloves or a jumpsuit, if necessary. The 6-week-old C57BL/6 female mice were purchased and maintained at the Laboratory Animal Center of National Cheng Kung University (NCKU). The animal experiments were approved by the Institutional Animal Care and Use Committee of NCKU (Approval number 104-039).
1. Bioluciferase-labeled EHEC Bacteria Generation
<ol>
	<li>Mix 50 ng deoxyribonucleic acid (DNA), 1 &#956;L each of 10 &#956;M forward and reverse primers, 2 &#956;L 2.5 mM deoxynucleotides (dNTPs), 2 &#956;L 10x&#160;buffer, 0.2 &#956;L DNA polymerase, and sterile double-distilled water (ddH2O) to a final volume of 20 &#956;L to amplify the anti-kanamycin cassette, nptII gene24. The DNA template is from pBSL18024, which is purchased from the National BioResource Project (NBRP). The PCR conditions are listed in Table 1 and the primer sequence is available in Table 2.</li>
	<li>Ligate the PCR products to a commercial cloning vector following the kit protocol (see Table of Materials).</li>
	<li>Excise the nptII gene fragment from the cloning vector by NsiI and SmaI and clone into pBBR1MCS4, which is digested by the NsiI and ScaI from pAKlux29 to create the kanamycin resistant plasmid, pWF27813.</li>
	<li>Excise the luxCDABE operon, from the luciferase expressing plasmid9, pAKlux2, by SpeI-HF and ScaI and clone to SpeI-HF and SmaI digested pWF278 to generate kanamycin resistant and luciferase expressing plasmid, pWF27913. 
	NOTE: For the plasmid extractions and the excised fragment purifications, use the commercial plasmid extraction and the gel extraction kit, respectively. For enzyme digestion, mix 100 ng DNA, 1 &#956;L 10x&#160;buffer, 1 &#956;L of each selected restriction enzyme, and sterile ddH2O to a total volume of 10 &#956;L, and incubate at 37 &#176;C for 2.5 - 3 h.</li>
	<li>Transform the pWF279 plasmid into E. coli O157:H7 EDL933 competent cells by electroporation with 2,500 V for 4 ms.</li>
	<li>Incubate the transformed bacteria cells in 1 mL Luria-Bertani (LB) medium at 37 &#176;C for 1 h.</li>
	<li>Plate the bacteria on an LB agar plate supplemented with 50 &#181;g/mL of kanamycin at 37 &#176;C for 16 - 18 h.</li>
	<li>Check the bioluminescent signal of the plate by an in vivo imaging machine the next day. Pick a single colony from the plate and culture it in 3 mL LB supplemented with 50 &#181;g/mL kanamycin at 37 &#176;C for 16 - 18 h.</li>
	<li>Prepare bacterial stock medium by diluting 100% glycerol in sterile ddH2O to make the 30% glycerol solution.</li>
	<li>Freeze the kanamycin resistant E. coli O157:H7 EDL933 bacteria harboring the luciferase plasmid as a bacterial stock in a screw cap cryovial as a 1:1 ratio of bacteria culture and 30% glycerol solution at -80 &#176;C. The final concentration of glycerol is 15%.</li>
</ol>
2. Bioluminescent EHEC Bacteria Preparation for Oral Inoculation
NOTE: The timeline flowchart of the experimental procedures for EHEC preparation and mouse oral gavage is presented in Figure 1 to aid in experimental preparation.
<ol>
	<li>Streak E. coli O157:H7 EDL933 bacteria harboring luciferase plasmid onto an LB agar plate with 50 &#181;g/mL kanamycin from -80 &#176;C stock. Grow the bacteria for 16 - 18 h at 37 &#176;C.</li>
	<li>Pick a single colony from the overnight plate and culture in 3 mL LB medium with 50 &#181;g/mL kanamycin for 16 - 18 h in a 37 &#176;C incubator at 220 rpm.</li>
	<li>Subculture the bacteria (1:100 dilution) into kanamycin (50 &#181;g/mL) containing LB broth for 2.5 - 3 h in a 37 &#176;C incubator at 200 rpm. (For instance, add 2 mL overnight cultured bacteria to 200 mL LB medium with kanamycin (50 &#181;g/mL) supplemented).</li>
	<li>Incubate the bacteria for 2.5 - 3 h and measure the optical density value at 600 nm (OD600) until the value is between 0.9 to 1. The bacterial cell number is at a density of about 108 colony forming units (CFU)/mL.</li>
	<li>Centrifuge the re-cultured bacteria at 8,000 x g for 30 min, 4 &#176;C.</li>
	<li>Discard the supernatant without agitating the pellet of bacteria and wash the pellet with 100 mL 0.9% sterile normal saline by gentle agitation.</li>
	<li>Repeat steps 2.5 and 2.6 once.</li>
	<li>After the wash, centrifuge the bacterial culture at 8,000 x g for 30 min, 4 &#176;C and discard the supernatant gently.</li>
	<li>Condensate the pellet at 100-fold with 0.9% sterile normal saline. For instance, if 200 mL bacteria are centrifuged, add 2 mL normal saline to suspend the pellet.</li>
	<li>Confirm the bacteria CFU (it should be approximately 109 CFU/100 &#956;L after condensation in normal saline) by plating the concentrated bacteria through a 10-fold serial dilution25.</li>
</ol>
3. Mouse Oral Gavage of EHEC
<ol>
	<li>Treat 6-week-old female C57BL/6 mice with streptomycin water (5 g/L) for 24 h.</li>
	<li>After 24 h, switch to regular drinking water for another 24 h before gavage. After treating with regular water for 24 h, the mice are ready for oral gavage of EHEC.</li>
	<li>Fill the syringe with 100 &#956;L EHEC bacteria by pulling back on the plunger. Ensure no air bubbles are in the syringe. Remove the bubbles by snapping the syringe with fingers.</li>
	<li>Lift the animal gently and place it on the top of cage with care.</li>
	<li>Grasp the mouse by the tail carefully, and the animal will grip the top of cage and attempt to move away.</li>
	<li>Gently restrain the mouse by grasping the loose skin of the neck and back of the animal with thumb and forefinger to prevent the head of the mouse from moving.</li>
	<li>Hold the mouse in a vertical position to insert the gavage needle and ensure the head of mouse is immobilized and vertical.</li>
	<li>Insert the gavage needle into the mouse mouth following the roof of the mouth and move down into esophagus and toward the stomach.</li>
	<li>When the inserted needle is half or two-thirds length in the mouse, inject the 100 &#956;L EHEC bacteria, which contain approximately 109 CFU cells.</li>
</ol>
4. Visualization
<ol>
	<li>After the oral gavage, detect the bioluminescent signals on 1 and 2 days.</li>
	<li>Before examining the bioluminescent signals of animals, anesthetize them by putting them into a chamber of 2.5% isoflurane with 1.5 L/min oxygen.</li>
	<li>Wait for 2 - 5 min until all mice become unconscious and stop moving. Animals are ready for in vivo detection of bioluminescence.</li>
	<li>Detect and image bioluminescent signals of animals by an in vivo imaging system. Please see Section 5 &#34;Data Acquisition&#34; for software operation. During the imaging process, all animals are under a continued supply of 2.5% isoflurane with 1.5 L/min oxygen.
	<ol>
		<li>Click file&#62;live, and manually focus on the mouse.</li>
		<li>Select the exposure time and laser intensity.</li>
		<li>Click acquire&#62;capture.</li>
	</ol>
	</li>
	<li>For ex vivo imaging, euthanize the mice by cervical dislocation and remove the entire intestine of infected mice. Place the intestines in a 9-cm Petri dish and image by the in vivo imaging system. The setting is the same as the in vivo imaging except the Field of View is set as A/B. Please see Section 5 &#34;Data Acquisition&#34; for details. 
	NOTE: Method for cervical dislocation: Restrain the mice on the top of cage by grasping the tail with one hand so that the animals grip the cage. Place a marker pen or the thumb and first finger of the other hand against the back of the neck at the base of the skull. Quickly push forward with the hand or object while restraining the head and pull backward with the hand holding the tail. 
	Check closely to confirm respiratory arrest, and no heartbeat.</li>
</ol>
5. Data Acquisition
NOTE: The software used for data acquisition is listed in the Table of Materials.
<ol>
	<li>For image acquisition, open the Acquisition Control Panel of the software (Figure 2).</li>
	<li>Select &#34;Luminescent,&#34; &#34;Photograph,&#34;&#160;and &#34;Overlay.&#34;</li>
	<li>Set Exposure Time as &#34;Auto.&#34; Set Binning as &#34;Medium.&#34;</li>
	<li>Set &#402;/stop as 1 for luminescent and 8 for photograph. &#402;/stop controls the amount of light received by the CCD detector.</li>
	<li>Set the Field of View based on the field of images that are of interest to acquire. Option &#34;D&#34; can fit five 6-week-old mice and image them all at a time. &#34;C&#34; can image three 6-week-old mice in one field.</li>
	<li>Once the mice/samples are ready for imaging, click &#34;Acquire&#34; for image acquisition.</li>
	<li>Open the image data that was acquired.</li>
	<li>Open the Tool Palette panel (Figure 3).</li>
	<li>Select ROI Tools. We recommend the Circle (the left-most one) to range the bioluminescent area on images (Figure 4).</li>
	<li>Click &#34;Measure ROIs&#34; (pencil icon) to measure the surface bioluminescent intensity (Figure 3). The ROI Measurements panel and the quantification values appear (Figure 5).</li>
	<li>Use the Configure Measurement on the left corner of the ROI Measurements panel to select the values/information needed (Figure 6), otherwise click &#34;Export&#34; to export this data table and save as .csv file (Figure 5).</li>
	<li>Use the values of column &#34;Total Flux (p/s)&#34; as the bioluminescent intensity quantification in the .csv file.</li>
</ol>

<ol>
	<li>Pennington, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+O157.">Escherichia coli O157.</a> Lancet. 376 (9750), 1428-1435 (2010).</li><li>Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga+toxins+and+the+pathophysiology+of+hemolytic+uremic+syndrome+in+humans+and+animals.">Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals.</a> Toxins (Basel). 4 (11), 1261-1287 (2012).</li><li>Tarr, P. I., Gordon, C. A., Chandler, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga-toxin-producing+Escherichia+coli+and+haemolytic+uraemic+syndrome.">Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome.</a> Lancet. 365 (9464), 1073-1086 (2005).</li><li>Obrig, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Shiga+Toxin+Mechanisms+of+Action+in+Renal+Disease.">Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease.</a> Toxins (Basel). 2 (12), 2769-2794 (2010).</li><li>Nguyen, Y., Sperandio, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+(EHEC)+pathogenesis.">Enterohemorrhagic E. coli (EHEC) pathogenesis.</a> Front Cell Infect Microbiol. 2, 90 (2012).</li><li>Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescent+monitoring+of+in+vivo+colonization+and+clearance+dynamics+by+light-emitting+bacteria.">Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria.</a> Methods Mol Biol. 574, 137-153 (2009).</li><li>Hutchens, M., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+bioluminescence+imaging+to+the+study+of+infectious+diseases.">Applications of bioluminescence imaging to the study of infectious diseases.</a> Cell Microbiol. 9 (10), 2315-2322 (2007).</li><li>Rhee, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+spatial+and+temporal+colonization+of+enteropathogenic+E.+coli+and+enterohemorrhagic+E.+coli+in+mice+using+bioluminescent+in+vivo+imaging.">Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging.</a> Gut Microbes. 2 (1), 34-41 (2011).</li><li>Karsi, A., Lawrence, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+fluorescence+and+bioluminescence+expression+vectors+for+Gram-negative+bacteria.">Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria.</a> Plasmid. 57 (3), 286-295 (2007).</li><li>Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+flagella+is+coincident+with+uropathogenic+Escherichia+coli+ascension+to+the+upper+urinary+tract.">Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract.</a> Proc Natl Acad Sci U S A. 104 (42), 16669-16674 (2007).</li><li>Roxas, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+alters+murine+intestinal+epithelial+tight+junction+protein+expression+and+barrier+function+in+a+Shiga+toxin+independent+manner.">Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner.</a> Lab Invest. 90 (8), 1152-1168 (2010).</li><li>Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. , (1999).</li><li>Kuo, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutation+of+the+Enterohemorrhagic+Escherichia+coli+Core+LPS+Biosynthesis+Enzyme+RfaD+Confers+Hypersusceptibility+to+Host+Intestinal+Innate+Immunity+In+vivo.">Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo.</a> Front Cell Infect Microbiol. 6, 82 (2016).</li><li>Wiles, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+specificity,+colonization+and+clearance+dynamics+in+vivo+following+oral+challenges+with+the+murine+pathogen+Citrobacter+rodentium.">Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium.</a> Cell Microbiol. 6 (10), 963-972 (2004).</li><li>Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+bioluminescence+imaging+of+the+murine+pathogen+Citrobacter+rodentium.">In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium.</a> Infect Immun. 74 (9), 5391-5396 (2006).</li><li>Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photonic+detection+of+bacterial+pathogens+in+living+hosts.">Photonic detection of bacterial pathogens in living hosts.</a> Mol Microbiol. 18 (4), 593-603 (1995).</li><li>Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extracellular+replication+of+Listeria+monocytogenes+in+the+murine+gall+bladder.">Extracellular replication of Listeria monocytogenes in the murine gall bladder.</a> Science. 303 (5659), 851-853 (2004).</li><li>Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+Yersinia+enterocolitica+in+Murine+and+Bovine+Feces+on+the+Basis+of+the+Chromosomally+Integrated+luxAB+Marker+Gene.">Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene.</a> Appl Environ Microbiol. 58 (3), 1024-1026 (1992).</li><li>Trcek, J., Fuchs, T. M., Trulzsch, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Yersinia+enterocolitica+invasin+expression+in+vitro+and+in+vivo+using+a+novel+luxCDABE+reporter+system.">Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system.</a> Microbiology. 156 (Pt 9), 2734-2745 (2010).</li><li>Morin, C. E., Kaper, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stabilized+luciferase-expressing+plasmids+to+examine+in+vivo-induced+promoters+in+the+Vibrio+cholerae+vaccine+strain+CVD+103-HgR.">Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR.</a> FEMS Immunol Med Microbiol. 57 (1), 69-79 (2009).</li><li>Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+model+systems+for+studying+enteropathogenic+Escherichia+coli+infections.">In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections.</a> Cold Spring Harb Perspect Med. 3 (3), a009977 (2013).</li><li>Ritchie, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+Models+of+Enterohemorrhagic+Escherichia+coli+Infection.">Animal Models of Enterohemorrhagic Escherichia coli Infection.</a> Microbiol Spectr. 2 (4), EHEC-0022-2013 (2014).</li><li>Chou, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohaemorrhagic+Escherichia+coli+O157:H7+Shiga-like+toxin+1+is+required+for+full+pathogenicity+and+activation+of+the+p38+mitogen-activated+protein+kinase+pathway+in+Caenorhabditis+elegans.">Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans.</a> Cell Microbiol. 15 (1), 82-97 (2013).</li><li>Alexeyev, M. F., Shokolenko, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tnl+0+transposon+derivatives+for+insertion+mutagenesis+and+gene+delivery+into+the+chromosome+of+Gram-negative+bacteria.">Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria.</a> Gene. 160 (1), 59-62 (1995).</li><li>Wiegand, I., Hilpert, K., Hancock, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agar+and+broth+dilution+methods+to+determine+the+minimal+inhibitory+concentration+(MIC)+of+antimicrobial+substances.">Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances.</a> Nat Protoc. 3 (2), 163-175 (2008).</li><li>Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+of+Long-Wavelength+Optical+and+NIR+Imaging+Materials:+Contrast+Agents,+Fluorophores+and+Multifunctional+Nano+Carriers.">Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers.</a> Chem Mater. 24 (5), 812-827 (2012).</li><li>Heim, R., Cubitt, A. B., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+green+fluorescence.">Improved green fluorescence.</a> Nature. 373 (6516), 663-664 (1995).</li><li>Weissleder, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+clearer+vision+for+in+vivo+imaging.">A clearer vision for in vivo imaging.</a> Nat Biotechnol. 19 (4), 316-317 (2001).</li><li>Frangioni, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+near-infrared+fluorescence+imaging.">In vivo near-infrared fluorescence imaging.</a> Current Opinion in Chemical Biology. 7 (5), 626-634 (2003).</li><li>Collins, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Citrobacter+rodentium:+infection,+inflammation+and+the+microbiota.">Citrobacter rodentium: infection, inflammation and the microbiota.</a> Nat Rev Microbiol. 12 (9), 612-623 (2014).</li><li>Mallick, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+murine+infection+model+for+Shiga+toxin-producing+Escherichia+coli.">A novel murine infection model for Shiga toxin-producing Escherichia coli.</a> J Clin Invest. 122 (11), 4012-4024 (2012).</li><li>Petty, N. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Citrobacter+rodentium+genome+sequence+reveals+convergent+evolution+with+human+pathogenic+Escherichia+coli.">The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli.</a> J Bacteriol. 192 (2), 525-538 (2010).</li><li>Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M., Peterson, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Four+new+derivatives+of+the+broad-host-range+cloning+vector+pBBR1MCS,+carrying+different+antibiotic-resistance+cassettes.">Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.</a> Gene. 166 (1), 175-176 (1995).</li><li>Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+Plasmid+Maintenance+in+the+Attenuated+Live+Vector+Vaccine+Strain+Salmonella+typhiCVD+908-htrA.">Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA.</a> Infect Immun. 67 (12), 6424-6433 (1999).</li><li>Francis, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+pneumococcal+infections+in+the+lungs+of+live+mice+using+bioluminescent+Streptococcus+pneumoniae+transformed+with+a+novel+gram-positive+lux+transposon.">Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon.</a> Infect Immun. 69 (5), 3350-3358 (2001).</li><li>Goldwater, P. N., Bettelheim, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+of+enterohemorrhagic+Escherichia+coli+(EHEC)+infection+and+hemolytic+uremic+syndrome+(HUS).">Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS).</a> BMC Med. 10, (2012).</li></ol>

The authors have nothing to disclose.

It has been reported that EHEC transformed with luciferase plasmid has been utilized to examine its localization in hosts or gene expression in vivo8,11,12. The murine model demonstrated here has also been reported to detect the EHEC colonized timing and localization in murine host8. Nevertheless, we provide the detail protocol of how to administer EHEC inoculation to mice intragastrically and how to carefully prepare the bioluminescent bacteria for oral gavage. Notably, for the mouse oral gavage of EHEC (step 3.7), the position of the mouse head is critical when the gavage needle is inserted. If the position is not vertical, it will be difficult to pass the needle, and it could possibly injure the mouse. In step 3.8, when the gavage needle is inside the mouth of the mouse, the tongue will lay outside of the mouth slightly. If resistance is encountered when passing the gavage needle to the esophagus, stop moving the needle forward and withdraw it immediately. Alter the needle position to make sure that the needle is entering the esophagus. The needle could be entering the trachea when resistance occurs, which would lead to injecting bacteria in the lungs instead of the stomach.
Application of green fluorescent protein (GFP) as a biosensor is common in biological experiments. However, using GFP as a reporter to observe the pathogen infection/colonization in live animals by in vivo imaging is not recommended, because the absorbance by hemoglobin, proteins and water are high between 200-650 nm26, which overlaps with GFP (excitation 480 nm, emission 510 nm)27. Therefore, using GFP signal as a reporter for in vivo imaging can be interrupted by hemoglobin, proteins, and water in animals26. The near-infrared (NIR) fluorescence is ideally suited for in vivo imaging because its absorbance window is around 650 - 900 nm28, which is in the region of lowest absorption coefficient of hemoglobin (&#60;650 nm) and water (&#62;900 nm)26,28 . Moreover, when tissue absorbs light, there is a chance to induce autofluorescence. When the wavelengths of excitation and emission range in the GFP window, it induces much more autofluorescence than NIR29. Use of NIR can improve the signal to background ratio compared to that of GFP by eliminating the autofluorescence background29. Bioluminescence does not require energy excitation to generate visible light. It depends on the reaction to catalyze substrate luciferin by its enzyme luciferase and generate light. Since bioluminescence does not require light directly on a sample, the background signal from a sample is very low. Therefore, use of bioluminescence as a reporter is more general and easier for in vivo imaging. In contrast, fluorescence requires light excitation to induce signal light. When tissues absorb light, there is a chance that the fluorescent light will be emitted and induce autofluorescence so that their signal-to-noise is higher compared to that of bioluminescence.
Considering EHEC is naturally less colonized in mice by oral infection2,22, a natural mucosal pathogen of mice, called Citrobacter rodentium, has been utilized to study the colonization mechanism to murine host as a surrogate bacterium22,30. Both of EHEC and C. rodentium colonize the intestinal mucosa and induce the formation of A/E lesions in host22,30. They also contain the LEE pathogenicity island, which encodes a T3SS and several effector proteins that induced A/E lesion22,30. Therefore, the use of luciferase expressing plasmid as a reporter in C. rodentium to detect the colonization pathology and study the colonization mechanism via an in vivo imaging system has also been reported14,15. Nevertheless, while C. rodentium infection of mice is a useful model to investigate the function of T3SS and the mechanism of A/E lesion, C. rodentium does not contain Shiga toxin (Stx)30, which is a dominant virulence factor that causes kidney failure in EHEC, particularly serotype O157:H73. Although a Stx-expressing C. rodentium strain has been constructed recently31, which is more realistic to EHEC infection, it does not include other potential EHEC virulence factors that are crucial for colonization and/or infection. Furthermore, C. rodentium shares 67% of its genes with EHEC32, which suggests that EHEC may use a virulence distinct from C. rodentium during colonization and/or infection.
The luciferase expressing plasmid used in here, pWF27913, was modified from pAKlux29 whose backbone is pBBR1MCS433. Although pBBR1MCS4 have been tested and replicated in various bacteria33, it is crucial to ensure the origin of replication (ORI) of this plasmid is suitable for the bacterial host before using this plasmid-based luciferase system for the experiment and thus confirming that this luciferase expressing plasmid can replicate in the bacterial host. We use antibiotic stress to maintain the stability of plasmid in the bacteria. When bacteria enter animals in the absence of antibiotics, the bioluminescent signal of wild-type EHEC has been detected for at least 2 days. However, we didn&#39;t following infection for longer than 2 days because we had already seen a significant difference in luminescent intensity between EHEC WT and EHEC rfaD (that encodes a gene required for EHEC synthesizing intact LPS) mutant at 2 days. To maintain the plasmid stably in bacteria under the absence of antibiotics, a plasmid pCM1710,34 can be used for this purpose. pCM17 encodes a two-plasmid partitioning system and a post-segregational killing mechanism to ensure the maintenance of the plasmid in bacteria in the absence of antibiotics10,34. The plasmid pCM17 containing the luxCDABE operon driven by the OmpC promoter can be detected by bioluminescent signal for at least 7 days8. An alternative method to obtain a continuous bioluminescent expression bacteria in the absence of antibiotics is to insert luxABCDE gene into the bacterial chromosome35. Francis et al. used transposon inserted the luxABCDE operon and antibiotics cassette randomly inserted into the chromosome of Streptococcus pneumoniae to obtain the bioluminescence stable strain35.
In our previous study13, we utilized this model system to examine EHEC colonization in a host and compare the difference of colonization ability between the EHEC wild type (WT) and mutant13. When mice were administered the bioluminescent EHEC rfaD mutant, the bioluminescent signals diminished dramatically compared to that of WT EHEC after 2 days post infection. It provides evidence that this murine model can analyze the mutation effect of EHEC colonization in the host. Furthermore, therapeutic treatments for reducing the colonization of EHEC is a considered, potential solution to EHEC infection since the use of antibiotics is contraindicated5,36. Therefore, it is worth testing whether this model system can be used to examine the efficacy of anti-colonization drugs/treatments against enterobacteria colonization in the host. We believe that by using this model system, it is possible to examine the timing and location of not merely EHEC, but also other enterobacteria colonization in vivo. By using this animal model, the process of EHEC colonization in mice can be monitored and the colonization burden in the host can be quantified to determine spatial and temporal colonization of EHEC in live animals. The visualization and quantification of enterobacteria colonization by using this model makes it a great tool to investigate and analyze the fine mechanisms of enterobacterial colonization, and thus compensate for the deficiency of colonization research and improve current knowledge.

EHEC O157:H7 is a pathogen that causes diarrhea1, HS2, HUS3, and even acute renal failure4 through contaminated water or food. EHEC is a pathogenic enterobacterium and colonizes to the gastrointestinal tract of humans1. When EHEC first adhere to host intestinal epithelium, they inject the colonization factors into host cells through the type III secretion system (T3SS) that functions as a molecular syringe inducing an attaching and effacing (A/E) lesion subsequently to enforce adhesion (colonization)5. These genes involved in A/E lesion formation are encoded by the locus of enterocyte effacement (LEE) pathogenicity island5.
Bioluminescence is a light-producing chemical reaction, in which luciferase catalyzes its substrate luciferin to generate visible light6. This enzymatic process often requires the presence of oxygen or adenosine triphosphate (ATP)6. Bioluminescence imaging (BLI) allows researchers the visualization and quantization of host-pathogen interactions in live animals7. BLI can characterize the bacterial infection cycle in live animals by following the bioluminescent bacteria as they migrate to and invade different tissues7; this reveals a dynamic progression of infection. Moreover, the bacterial load in animals is related to the bioluminescent signal8; thus, it is a convenient indicator to estimate the pathological conditions of experimental animals in a simple and direct way.
The plasmid used here contained the luciferase operon, luxCDABE, which is from the bacterium Photorhabdus luminescens that encodes its own luciferase substrate7,9. By transforming this luciferase-expressing plasmid into bacteria, the colonization and infection processes can be monitored by observing these bioluminescent bacteria in live animals. Overall, BLI and bioluminescence-labeled bacteria allow researchers to monitor the bacterial numbers and location, bacterial viability with antibiotics/therapy treatment, and bacterial gene expression in infection/colonization6,7. Numerous pathogenic bacteria have been reported that express the luxCDABE operon to examine their infection cycle and/or gene expression in infection. These bacteria, including uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic E. coli (EPEC)8, Citrobacter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, and Vibrio cholerae20, have been documented.
Several experimental models have been developed to facilitate the study of EHEC colonization in vitro and in vivo21,22,23. However, there is a lack of suitable animal models to study the EHEC colonization in vivo, and thus a resulting paucity of details. To facilitate the study of the EHEC colonization mechanism in vivo, it is valuable to build animal models to observe and quantify EHEC colonization in live animals in a non-invasive method.
This manuscript describes a mouse-EHEC colonization model that uses a bioluminescent expressing system to monitor EHEC colonization over time in living hosts. Mice are intragastrically inoculated with bioluminescence-labeled EHEC and the bioluminescent signal is detected in mice with a non-invasive in vivo imaging system13. Mice infected with bioluminescence-labeled EHEC showed significant bioluminescent signals in their intestine after 2 days post infection, which suggested that those bacteria colonized in the host intestine after 2 days post infection. Ex vivo image data showed that this colonization is specifically in the cecum and colon of mice. By using this mouse-EHEC model, the bioluminescent EHEC colonization can be detected in the living host by an in vivo imaging system, to study the detailed mechanisms of enteric bacteria colonization, which may promote further understanding in EHEC-induced physiological and pathological changes.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Shaker incubator</td>
			<td style="width:175px;">YIH DER</td>
			<td style="width:143px;">LM-570R</td>
			<td style="width:167px;">bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Orbital shaking incubator</td>
			<td style="width:175px;">FIRSTEK</td>
			<td style="width:143px;">S300</td>
			<td>bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">pBSL180</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of nptII gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pAKlux2</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of luxCDABE operon</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T&#38;A Cloning Kit</td>
			<td>Yeastern Biotech</td>
			<td style="width:143px;">FYC001-20P</td>
			<td>use for TA cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nsi I</td>
			<td style="width:175px;">NEB</td>
			<td>R0127S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sca I</td>
			<td style="width:175px;">NEB</td>
			<td>R0122S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spe I-HF</td>
			<td style="width:175px;">NEB</td>
			<td>R0133S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sma I&#160;</td>
			<td style="width:175px;">NEB</td>
			<td>R0141S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">T4 ligase</td>
			<td style="width:175px;">NEB</td>
			<td style="width:143px;">M0202S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Ex Taq</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">10X Ex Taq Buffer</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP Mixture&#160;</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">PCR machine</td>
			<td style="width:175px;">applied Biosystem&#160;</td>
			<td style="width:143px;">2720 thermal cycler&#160;</td>
			<td>&#160;for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Glycerol</td>
			<td style="width:175px;">SIGMA</td>
			<td style="width:143px;">G5516-1L</td>
			<td>use for bacteria stocking solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">NaCl</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">31434-5KG-R</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Tryptone</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1612.00</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Yeast Extract powder</td>
			<td style="width:175px;">Affymetrix</td>
			<td style="width:143px;">23547-1 KG</td>
			<td>chemical for making LB medium, 5 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Agar</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1802.00</td>
			<td>chemical for making LB agar</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">kanamycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">K4000-5G</td>
			<td>antibiotics, use for seleciton</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">streptomycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">S6501-100G</td>
			<td>antibiotics, eliminate the microbiota in mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">EDL933 competent cell</td>
			<td style="width:175px;">Homemade</td>
			<td style="width:143px;"></td>
			<td>method is on supplemental document&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporator</td>
			<td style="width:175px;">MicroPulser</td>
			<td style="width:143px;"></td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporation Cuvettes</td>
			<td style="width:175px;">Gene Pulser/MicroPulser</td>
			<td style="width:143px;">1652086</td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">High-speed centrifuge</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">Avanti, J-26S XP</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JA25.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JLA10.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td>Beckman Coulter</td>
			<td>REF357003</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td style="width:175px;">Thermo Fisher scientific</td>
			<td style="width:143px;">3141-0500</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">eppendorf biophotometer plus&#160;</td>
			<td>eppendorf</td>
			<td>AG 22331 hamburg</td>
			<td>for measuring the OD600 value of bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">C57BL/6 mice&#160;</td>
			<td colspan="2">Laboratory Animal Center of NCKU</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">lab coat, gloves</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>for personnel protection&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">isoflurane&#160;</td>
			<td>Panion &#38; BF Biotech Inc.</td>
			<td style="width:143px;">G-8669</td>
			<td>for mice anesthesia, pharmaceutical grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1ml syringe&#160;</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Reusable 22 G ball-tipped feeding needle</td>
			<td style="width:143px;">&#966;0.9 mm X L 50 mm</td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">surgical&#160; scissors&#160;</td>
			<td></td>
			<td style="width:143px;"></td>
			<td>use for mice experiment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Xenogen IVIS 200 imaging system</td>
			<td>Perkin Elmer</td>
			<td>IVIS spectrum</td>
			<td>use for bioluminescent image capture&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Living Image Software</td>
			<td>Perkin Elmer</td>
			<td style="width:143px;">version 4.1</td>
			<td>use for quantifying the image data</td>
		</tr>
	</tbody>
</table>

detection of enterohemorrhagic escherichia coli colonization in murine host by non-invasive in vivo bioluminescence system

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome (HUS), colonize to the intestinal tract of humans. To study the detailed mechanism of EHEC colonization in vivo, it is essential to have animal models to monitor and quantify EHEC colonization. We demonstrate here a mouse-EHEC colonization model by transforming the bioluminescent expressing plasmid to EHEC to monitor and quantify EHEC colonization in living hosts. Animals inoculated with bioluminescence-labeled EHEC show intense bioluminescent signals in mice by detection with a non-invasive in vivo imaging system. After 1 and 2 days post infection, bioluminescent signals could still be detected in infected animals, which suggests that EHEC colonize in hosts for at least 2 days. We also demonstrate that these bioluminescent EHEC locate to mouse intestine, specifically in the cecum and colon, from ex vivo images. This mouse-EHEC colonization model may serve as a tool to advance the current knowledge of the EHEC colonization mechanism.

We administered bioluminescence-labeled EHEC (~ 109 bacterial cells) to 6-week old female C57BL/6 mice by oral gavage. After oral inoculation of EHEC to mice within 1 h, the animals were examined for bioluminescent signal by the in vivo imaging system as shown in Figure 7. The results showed a strong bioluminescent signal in gavage mice with bioluminescence-labeled EHEC. We examined the signals on 2 days post infection. As shown in Figure 8A, the mice inoculated with bioluminescence-labeled wild-type EHEC EDL933 showed intense bioluminescent signals even after 2 days post infection, which suggested EHEC colonized in hosts by 2 days. We also intragastrically infected bioluminescence-labeled EDL933&#916;rfaD (&#916;rfaD) to mice (Figure 8A). This mutant, defected in lipopolysaccharide (LPS), has been shown to reduce colonization in the host in our previous study. As shown in Figure 8A, there is no bioluminescent signal detected in &#916;rfaD-infected mice, which suggests that there are no or less bacteria cells colonized in the mice. Quantification of the fluorescent signal is shown in Figure 8B. Next, the location of these bioluminescence-labeled bacteria was determined. The infected mice were sacrificed humanely and their whole intestine removed. The intestines of mice 2 days post infection were positioned on 9 cm Petri dishes and imaged ex vivo (Figure 9A). The intestinal tissues of bioluminescence-labeled EDL933 infected mice revealed a significant increase in bioluminescent signals in the cecum and colon, which suggest that these bioluminescent EHEC colonized in the cecum and colon of infected mice for 2 days at least. In contrast, mice infected with bioluminescence-labeled &#916;rfaD (Figure 9A), revealed decreased bioluminescent signal in their intestinal tissue, which is consistent with the in vivo image (Figure 8A). Quantification of the fluorescent signal is shown in Figure 9B.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56169/56169fig1.jpg" /> 
Figure 1: Timeline of the experimental preparation flow chart. 
Overview of the timing needed to prepare bioluminescent EHEC bacteria and pretreat mice with streptomycin. (A) EHEC preparation. (B) Mice preparation. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56169/56169fig2.jpg" /> 
Figure 2: In vivo imaging system acquisition control panel. 
Before imaging samples, open IVIS Acquisition Control Panel. Select &#34;Luminescent,&#34; &#34;Photograph,&#34;&#160;and &#34;Overlay.&#34; Set Exposure Time as &#34;Auto.&#34; Set Binning as &#34;Medium.&#34; Set &#402;/stop as 1 for luminescent and 8 for photograph. &#402;/stop controls the amount of light received by the CCD detector. Once samples are ready for imaging, click &#34;Acquire&#34; to acquire images. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56169/56169fig3.jpg" /> 
Figure 3: Tool Palette panel. 
After image acquiring, use the Tool Palette panel for quantifying bioluminescent intensity. Open the Tool Palette panel and image the data. Choose one of the ROI Tools to range the bioluminescent signals on images. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56169/56169fig4.jpg" /> 
Figure 4: Bioluminescent signal from sample for quantification. 
Bioluminescent signal area on images encircled by ROI Tools. All bioluminescent signals shown here are in the red circle. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56169/56169fig5.jpg" /> 
Figure 5: ROI measurements. 
After circling bioluminescent signals and clicking &#34;Measure ROIs&#34; on the Tool Palette panel, values are presented as shown. The values of the column Total Flux (p/s) are used for the bioluminescent intensity quantification. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56169/56169fig6.jpg" /> 
Figure 6: Add different quantification information. 
By clicking on Configure Measurement on the left corner of the ROI Measurements panel, you can select other desired quantification values/information. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56169/56169fig7.jpg" /> 
Figure 7: Representative image of mice after inoculated with bioluminescent EHEC. 
Representative image of mice inoculated with bioluminescent EHEC by oral gavage within 1 h. The color scale represents the radiance (p/s/cm2/sr). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56169/56169fig8.jpg" /> 
Figure 8: Images of mice inoculated with bioluminescence-labeled EHEC after 2 days. 
(A) Represent image of mice inoculated with bioluminescent wild-type EHEC EDL933 and EDL933:&#916;rfaD by oral gavage after 2 days post infection. (B) Quantification of bioluminescence intensity of mice infected with EHEC. Error bars indicate the standard deviations. Representative images are shown.All experiments were conducted independently three times with 2 - 3 animals each time, and error bars indicate the standard deviations. P-values denote the results of statistical analysis by t-test. The color scale represents the radiance (p/s/cm2/sr). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig8large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56169/56169fig9.jpg" /> 
Figure 9: Images of intestinal tissues of infected mice with bioluminescence-labeled EHEC. 
(A) 2 days after inoculation with bioluminescence-labeled EHEC, the mice were euthanized and whole intestinal tissues were removed and imaged ex vivo. Representative images are shown.(B) Quantification of bioluminescence intensity of intestinal tissues from mice infected with EHEC. All experiments were conducted independently three times with 2&#160;- 3 animals each time, and error bars indicate the standard deviations. P-values denote the results of statistical analysis by t-test. The color scale represents the radiance (p/s/cm2/sr). Scale bar represents 1 cm. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig9large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Number of cycles</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95 &#176;C</td>
			<td>30 sec</td>
			<td rowspan="3">35</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>58.4 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>1.5 min</td>
		</tr>
		<tr>
			<td>Final extension</td>
			<td>72 &#176;C</td>
			<td>10 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4 &#176;C</td>
			<td>&#8734;</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 1: Polymerase chain reaction (PCR) conditions
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers name</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>nptII F</td>
			<td>5&#8217;CCTATGCATAATAATTCCGCTAGCTTCACG3&#8217;</td>
		</tr>
		<tr>
			<td>nptII R</td>
			<td>5&#8217;GCTCCACCGATAATATTCCTGAGTCATACT3&#8217;</td>
		</tr>
	</tbody>
</table>
Table 2: Primer sequences used to amplify nptII

Watch this Scientific Journal Video about Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System at JoVE.com

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

A detailed protocol of a mouse model for enterohemorrhagic E. coli (EHEC) colonization by using bioluminescence-labeled bacteria is presented. The detection of these bioluminescent bacteria by a non-invasive in vivo imaging system in live animals can advance our current understanding of EHEC colonization.

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

detection-enterohemorrhagic-escherichia-coli-colonization-murine-host

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

9.4K Views.  National Cheng Kung University. A detailed protocol of a mouse model for enterohemorrhagic E. coli (EHEC) colonization by using bioluminescence-labeled bacteria is presented. The detection of these bioluminescent bacteria by a non-invasive in vivo imaging system in live animals can advance our current understanding of EHEC colonization.

Video: Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists. The value of 2P microscopy is that it provides rich spatiotemporal information regarding cell behaviors within intact tissues and in live mice. Leukocyte recruitment plays a significant role in host defense against infection and when unchecked, can contribute to inflammatory and autoimmune diseases. Studying leukocyte recruitment in vivo is technically challenging since cells are moving rapidly within vessels located deep within light scattering tissues. To date, most intravital imaging studies require surgical preparation to expose the blood vessels and tissues. To avoid the tissue damage and inflammation induced by surgery itself, here, we describe a non-invasive single-cell imaging approach that can be used to study leukocyte trafficking in the mouse footpad and phalanges. We discuss the technical aspects of our 2P imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Here, we describe a non-invasive two-photon (2P) microscopy approach to study leukocyte homing in the mouse footpad. We discuss the technical aspects of our tissue imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists.  The value of 2P microscopy is that it ...

Non-invasive Imaging of Disseminated Candidiasis in Zebrafish Larvae

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 to 40% attributable mortality6. Systemic candidiasis is normally controlled by innate immunity, and individuals with genetic defects in innate immune cell components such as phagocyte NADPH oxidase are more susceptible to candidemia7-9. Very little is known about the dynamics of C. albicans interaction with innate immune cells in vivo. Extensive in vitro studies have established that outside of the host C. albicans germinates inside of macrophages, and is quickly destroyed by neutrophils10-14. In vitro studies, though useful, cannot recapitulate the complex in vivo environment, which includes time-dependent dynamics of cytokine levels, extracellular matrix attachments, and intercellular contacts10, 15-18. To probe the contribution of these factors in host-pathogen interaction, it is critical to find a model organism to visualize these aspects of infection non-invasively in a live intact host. 
The zebrafish larva offers a unique and versatile vertebrate host for the study of infection. For the first 30 days of development zebrafish larvae have only innate immune defenses2, 19-21, simplifying the study of diseases such as disseminated candidiasis that are highly dependent on innate immunity. The small size and transparency of zebrafish larvae enable imaging of infection dynamics at the cellular level for both host and pathogen. Transgenic larvae with fluorescing innate immune cells can be used to identify specific cells types involved in infection22-24. Modified anti-sense oligonucleotides (Morpholinos) can be used to knock down various immune components such as phagocyte NADPH oxidase and study the changes in response to fungal infection5. In addition to the ethical and practical advantages of using a small lower vertebrate, the zebrafish larvae offers the unique possibility to image the pitched battle between pathogen and host both intravitally and in color. 
The zebrafish has been used to model infection for a number of human pathogenic bacteria, and has been instrumental in major advances in our understanding of mycobacterial infection3, 25. However, only recently have much larger pathogens such as fungi been used to infect larva5, 23, 26, and to date there has not been a detailed visual description of the infection methodology. Here we present our techniques for hindbrain ventricle microinjection of prim25 zebrafish, including our modifications to previous protocols. Our findings using the larval zebrafish model for fungal infection diverge from in vitro studies and reinforce the need to examine the host-pathogen interaction in the complex environment of the host rather than the simplified system of the Petri dish5.

The rapid development, small size and transparency of zebrafish are tremendous advantages for the study of innate immune control of infection1-4. Here we demonstrate techniques for infecting zebrafish larvae using the fungal pathogen Candida albicans by microinjection, methodology recently used to implicate phagocyte NADPH oxidase activity in control of fungal dimorphism5.

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal features of the natural infection. This protocol describes procedures for the establishment and evaluation of systemic infection due to neuropathogenic Escherichia coli K1 in the neonatal rat. Colonization of the gastrointestinal tract leads to dissemination of the pathogen along the gut-lymph-blood-brain course of infection and the model displays strong age dependency. A strain of E. coli O18:K1 with enhanced virulence for the neonatal rat produces exceptionally high rates of colonization, translocation to the blood compartment and invasion of the meninges following transit through the choroid plexus. As in the human host, penetration of the central nervous system is accompanied by local inflammation and an invariably lethal outcome. The model is of proven utility for studies of the mechanism of pathogenesis, for evaluation of therapeutic interventions and for assessment of bacterial virulence.

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Here, a procedure is described for the establishment of systemic infection in the neonatal rat with cultures of Escherichia coli K1. This non-invasive procedure permits colonization of the gastrointestinal tract, translocation of the pathogen to the systemic circulation, and invasion of the central nervous system at the choroid plexus.

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. pylori-induced gastric inflammation by activating several innate leukocytes including neutrophils, monocytes, and mast cells. The immunogenic and immunomodulatory properties of HP-NAP make it a potential diagnostic and vaccine candidate for H. pylori and a new drug candidate for cancer therapy. In order to obtain substantial quantities of purified HP-NAP used for its clinical applications, an efficient method to purify this protein with high yield and purity needs to be established.
In this protocol, we have described a method for one-step negative chromatographic purification of recombinant HP-NAP overexpressed in Escherichia coli (E. coli) by using diethylaminoethyl (DEAE) ion-exchange resins (e.g., Sephadex) in batch mode. Recombinant HP-NAP constitutes nearly 70% of the total protein in E. coli and is almost fully recovered in the soluble fraction upon cell lysis at pH 9.0. Under the optimal condition at pH 8.0, the majority of HP-NAP is recovered in the unbound fraction while the endogenous proteins from E. coli are efficiently removed by the resin.
This purification method using negative mode batch chromatography with DEAE ion-exchange resins yields functional HP-NAP from E. coli in its native form with high yield and purity. The purified HP-NAP could be further utilized for the prevention, treatment, and prognosis of H. pylori-associated diseases as well as cancer therapy.

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

A high yield method for one-step negative purification of recombinant Helicobacter pylori neutrophil-activating protein (HP-NAP) overexpressed in Escherichia coli by using diethylaminoethyl resins in batch mode is described. HP-NAP purified by this method is beneficial for the development of vaccines, drugs, or diagnostics for H. pylori-associated diseases.

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo fluorescence optical imaging (OI), in two different mouse models of inflammation: a rheumatoid arthritis (RA) and a contact hypersensitivity reaction (CHR) model. Light with a wavelength in the near infrared (NIR) window (650 - 950 nm) allows a deeper tissue penetration and minimal signal absorption compared to wavelengths below 650 nm. The major advantages using fluorescence OI is that it is cheap, fast and easy to implement in different animal models.
Activatable fluorescent probes are optically silent in their inactivated states, but become highly fluorescent when activated by a protease. Activated MMPs lead to tissue destruction and play an important role for disease progression in delayed-type hypersensitivity reactions (DTHRs) such as RA and CHR. Furthermore, MMPs are the key proteases for cartilage and bone degradation and are induced by macrophages, fibroblasts and chondrocytes in response to pro-inflammatory cytokines. Here we use a probe that is activated by the key MMPs like MMP-2, -3, -9 and -13 and describe an imaging protocol for near infrared fluorescence OI of MMP activity in RA and control mice 6 days after disease induction as well as in mice with acute (1x challenge) and chronic (5x challenge) CHR on the right ear compared to healthy ears.

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper explains the application of fluorescent imaging using an activatable optical imaging probe to visualize the in vivo activity of key matrix metalloproteinases in two different experimental models of inflammation.

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple condensation reactions. DHDDS (dehydrodolichyl diphosphate synthase) is a eukaryotic long-chain cis-PT (forming cis double bonds from the condensation reaction) that catalyzes chain elongation of farnesyl diphosphate (FPP, an allylic diphosphate) via multiple condensations with isopentenyl diphosphate (IPP). DHDDS is of biomedical importance, as a non-conservative mutation (K42E) in the enzyme results in retinitis pigmentosa, ultimately leading to blindness. Therefore, the present protocol was developed in order to acquire large quantities of purified DHDDS, suitable for mechanistic studies. Here, the usage of protein fusion, optimized culture conditions and codon-optimization were used to allow the overexpression and purification of functionally active human DHDDS in E. coli. The described protocol is simple, cost-effective and time sparing. The homology of cis-PT among different species suggests that this protocol may be applied for other eukaryotic cis-PT as well, such as those involved in natural rubber synthesis.

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

A simple protocol for overexpression and purification of codon-optimized, human cis-prenyltransferase, under non-denaturing conditions, from Escherichia coli, is described, along with an enzymatic activity assay. This protocol can be generalized for production of other cis- prenyltransferase proteins in quantity and quality suitable for mechanistic studies.

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of UTI in male and female mice have illustrated the procedures for bacterial inoculation and enumeration in urine and tissues. During an initial bladder infection in C57BL/6 mice, UPEC establish latent reservoirs inside bladder epithelial cells that persist following clearance of UPEC bacteriuria. This model builds on these studies to examine rUTI caused by the emergence of UPEC from within latent bladder reservoirs. The urogenital bacterium Gardnerella vaginalis is used as the trigger of rUTI in this model because it is frequently present in the urogenital tracts of women, especially in the context of vaginal dysbiosis that has been associated with UTI. In addition, a method for in situ bladder fixation followed by scanning electron microscopy (SEM) analysis of bladder tissue is also described, with potential application to other studies involving the bladder.

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

A mouse model of uropathogenic E. coli (UPEC) transurethral inoculation to establish latent intracellular bladder reservoirs and subsequent bladder exposure to G. vaginalis to induce recurrent UPEC UTI is demonstrated. Also demonstrated are the enumeration of bacteria, urine cytology, and in situ bladder fixation and processing for scanning electron microscopy.

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of ...

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration through the blood-brain barrier are indispensable steps for the development of E. coli meningitis. Reactive oxygen species (ROS) represent the major bactericidal mechanisms of neutrophils to destroy the invaded pathogens. In this protocol, the time-dependent intracellular ROS production in neutrophils infected with meningitic E. coli was quantified using fluorescent ROS probes detected by a real-time fluorescence microplate reader. This method may also be applied to the assessment of ROS production in mammalian cells during pathogen-host interactions.

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli is the leading cause of neonatal Gram-negative bacterial meningitis. During the bacterial infection, reactive oxygen species produced by neutrophils play a major bactericidal role. Here we introduce a method to detect the reactive oxygen species in neutrophils in response to meningitis E. coli.

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration ...