We thank Kelli Czarra and Megan Karwan for animal technical assistance, Kathleen Noer and Roberta Matthai for flow cytometry assistance, and Donna Butcher andMiriam R. Anver for pathology analysis. This project was supported by a grant from the Ely and Edythe Broad Foundation (to Scott Durum) and has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. HHSN261200800001E (MRA).

All animals received proper care in accordance with the experimental procedures outlined in the 2011 Guide for Care and Use of Laboratory Animals Committee of Frederick National Laboratory for Cancer Research.
1. Generation of IL-22-tdTomato Reporter Mice by BAC Recombineering
NOTE: The mice should be unconscious and do not move in response to a noxious stimulus. Sterilize the surgical area with 70% ethanol and sterilize all surgical tools using a glass bead sterilizer.
<ol>
	<li>Purify BAC DNA (RP23-401E11, clone length 228391 bps) using an alkaline extraction method10,11. Characterize the BAC clone by SpeI digestion of 5 &#181;g of RP23-401E11 to confirm the correct size of the target gene. NOTE: The BAC DNA was digested into 14 fragments.</li>
	<li>Insert the TdTomato reporter gene into the Not I/Sal I site of the PLD53SC-A-GFP-B shuttle vector11 and replace the GFP gene in the same site. Then, using BAC RP23-401E11 as a template, amplify the homology boxes (A and B) to the first translated exon of Il-22 (exon 1) by PCR (95 &#176;C 2 min; 30 cycles of 95 &#176;C for 30 sec, 55 &#176;C for 30 sec, and 72&#176;C for 30 sec; and a final extension at 72 &#176;C for 10 min). In a 50 &#181;l PCR reaction system, add 50 ng (1 &#181;l) of BAC DNA, 0.5 &#181;l of primers (10 &#181;M), 40 &#181;l of PCR superMix high fidelity, and 8 &#181;l of H2O. 
	NOTE: The primers for the A and B boxes are as follows: A box Forward: 5&#39;- TGGCGCGCCGGAGCTGTGAAGAAAG and Reverse: 5&#39;- CAGAGATCGCACAAGTGTCAAC; B box Forward: 5&#39;- GTTAATTAACTGCCCGTCAACA and Reverse: 5&#39;- TGGCCGGCCTGAGCACCTGCTT CATC10. The sites of the restriction enzymes (Asc I and Pac I) are underlined.</li>
	<li>Ligate 500 ng of Asc I-digested A and 500 ng of Pac I-digested B fragments into 50 ng of PLD53SC-ATB (tdTomato) vector at 16 &#176;C for 1 hr.</li>
	<li>Transform the purified PLD53SC-ATB vector into BAC-competent cells11 and culture them on Luria-Bertani(LB) agar plates with chloramphenicol (20 &#181;g/ml) and ampicillin (30 &#181;g/ml) at 37 &#176;C. Pick two to three colonies of co-integrate from the Ch/Amp master plates.</li>
	<li>Inoculate each colony into 1 ml of LB supplemented with 20 &#181;g/ml chloramphenicol and incubate them for 1 hr at 37 &#176;C and 225 rpm. Spread 100 &#181;l of each mixture on a LB-agar plate (10 g of Peptone 140, 5 g of yeast extract, 12 g of agar, and 1 L of water; pH 7.5) supplemented with chloramphenicol and 4-4.5% of sucrose. Incubate the culture overnight at 37 &#176;C.</li>
	<li>Pick both big and small colonies and replate them on two LB-agar plates with chloramphenicol. Then, expose the plates either with or without UV light for 30 sec and pick the UV-sensitive colonies for further analysis.</li>
	<li>Identify the modified BAC DNA by PCR using tdTomato/IL-22 heterozygous primer (Forward: 5&#39; ACT TgT gCg ATC TCT gAT ggT; Reverse: 5&#39; TgT AAT Cgg ggA TgT Cgg C). The thermocycler conditions are as follows: 95 &#176;C for 2 min; 30 cycles of 95 &#176;C for 30 sec, 56 &#176;C for 30 sec, and 72 &#176;C for 30 sec; and a final extension at 72 &#176;C for 10 min.</li>
	<li>Confirm the sequence of the modified area of the BAC by direct BAC sequencing of large-prep BAC DNA12.</li>
	<li>Anesthetize a recipient mouse with a dose of 0.25% tribromoethanol into the peritoneal cavity when implanting the microinjected zygotes into pseudo-pregnant C57BL/6c mice.</li>
	<li>Linearize the IL-22-tdTomato BAC construct (10 &#181;g) by digestion with 5 &#181;l of restriction endonucleasePi-SceI in 100 &#181;l of the reaction system and microinject the linearized BAC DNA into fertilized eggs of C57BL/6 females at the pronuclear stage13. Screen the transgenic mice by Southern blot analysis of DNA isolated from tail biopsies using standard procedures.</li>
</ol>
2. Single-cell Preparation from Spleens, Thymus, Lymph Nodes, and Peyer&#39;s Patch
NOTE: IL-22-tdTomato reporter mice were maintained at the National Cancer Institute (NCI, Frederick, MD). The euthanasia method conforms to the most recent AVMA Guidelines on Euthanasia. All mice were euthanized using CO2 inhalation14.
<ol>
	<li>Euthanize an IL-22-tdTomato mouse in a CO2 chamber and put it on a clean pad. Sterilize the abdomen skin by spraying 70% alcohol and cut it open. Remove the spleen in the left flank and the thymus behind the sternum.</li>
	<li>To harvest the mesentericlymph nodes (located in the mesenteric tissue) and Peyer&#39;s patches (small lymphoidnodules throughout the ileum region of the small intestine), take the pearly white mesenteric nodes close to the wall of the small intestine using dissect forceps with fine-point serrated tips first and then remove the whole small intestine and colon out of the body. Find the extended oval patches (Peyer&#39;s patches)along the gut and cut them with scissors. Grind these lymphoid tissues (lymph nodes and Peyer&#39;s patches) individually between two frosted slides into a single-cell suspension in PBS/1% fetal bovine serum (FBS) buffer on ice.</li>
	<li>Mince the spleen or thymus tissues using the same method as in step 2.2. Centrifuge the splenic suspension for 8 min at 500 x g and 4 &#176;C. Add 1 ml of ACK lysing buffer per spleen to the cell pellets.</li>
	<li>Mix well and let them stand for 1 min. Add 9 ml of sterile phosphate-buffered saline (PBS) buffer to each sample. Spin down by centrifugation for 8 min at 500 x g and 4 &#176;C to remove the red blood cells. 
	NOTE: Do not add ACK lysing buffer to the thymus cells.</li>
	<li>Resuspend the resulting leukocytes in 5 ml of PBS and pass the cells through a 100 &#181;m cell strainer. Collect the cell pellets by centrifugation at 500 x g for 8 min.</li>
	<li>Resuspend the cells in 5 ml of RPMI media or FACS buffer and count the viable cells using 0.4% trypan blue dye/PBS solution.</li>
</ol>
3. Isolation of Intraepithelial Lymphocytes and Lamina Propria Cells from the Intestines
<ol>
	<li>Open the abdominal skin as in step 2.1, cut the small intestine, from duodenum (next to the stomach) to ileum (close to the appendix), and the whole colon, right above the anus. Remove the extra adipose and mesenteric tissue using forceps. Put the intestines immediately in ice-cold PBS.</li>
	<li>Look for Peyer&#39;s patches (small, rough nodules) along the distal region of the small intestine. Remove the masses using forceps andopen the intestine lengthwise using scissors. Thoroughly flush the intestine with 10 ml of ice-cold PBS.</li>
	<li>Incubate the tissues in 20 ml of pre-digestion buffer (5 mM EDTA and 1 mM dithiothreitol in Hank&#39;s Balanced Salt Solution (HBSS)) for 30 min at 37 &#176;C with slow rotation (50 rpm) in a shaker. After each of 2 incubations, remove the epithelial cell layer, containing the intraepithelial lymphocytes (IELs), by intense vortexing (30 sec at 12,000 rpm) and pass all the tissues through a 100 &#181;m cell strainer.</li>
	<li>Add 20 ml of new EDTA solution to the tissue for second incubation for 30 min at 37 &#176;C. Pass the IEL fractions through a 100 &#181;m cell strainer and pool them with the previous fractions. Keep the remaining intestine fragments on ice to be treated in step 3.9.</li>
	<li>Centrifuge the pooled IEL fractions at 800 x g for 5 min at 4 &#176;C. Wash the pooled IEL fractions with 10 ml of HBSS/5% FBS and spin them down for 5 min at 800 x g and 4 &#176;C.</li>
	<li>Resuspend the cells in 8 mL of 44% colloidal silica medium15 and overlay them with 5 ml of 67% colloidal silica medium. Centrifuge the 44%/67.5% cell mixture gradient for 20 min at room temperature and 1,500 x g.</li>
	<li>Collect the IEL cells from the band at the interface. First, remove the top layer of the supernatant (about 5 ml) using 1 ml pipette. Then, harvest IELs at the interphase of the colloidal silica medium gradient.</li>
	<li>Wash the IELs by adding 10 ml of RPMI medium. Spin the cells down for 5 min at 800 x g and 4 &#176;C. Resuspend the IELs in 5 ml of RPMI for step 3.15.</li>
	<li>For the isolation of the lamina propria lymphocytes (LPLs), mince the intestine tissue fragments from step 3.4 into small pieces using scissors (1 mm) and digest the pieces with 10 ml of digestion buffer (0.05 g of collagenase, 0.05 g of DNaseI, and 0.3 g of dispase II in RPMI/5% FBS) for 15-20 min at 37 &#176;C.</li>
	<li>Filter the mixture through a 70 &#181;m cell strainer. The flow-through supernatant contains the released LPL.</li>
	<li>Fully digest the intestine fragments by repeating steps 3.9-3.10 (normally, they must be repeated 3 times). Each time, pool the supernatants containing the LPLs.</li>
	<li>Collect the cells by centrifugation for 5 min at 1,500 x g and room temperature and resuspend the pellets in RPMI/5% FBS. Pass them through a 40 &#181;m cell strainer.</li>
	<li>Resuspend the cell pellets in 10 ml of the 40% fraction of a 40:80 colloidal silica medium gradient and overlay them on 5 ml of the 80% fraction in a 15 ml tube.</li>
	<li>Perform the density gradient separation by centrifugation for 20 min at 1,500 x g and room temperature15.</li>
	<li>Collect the LPLs, as described in step 3.7. Wash them once with 10 ml of PBS and resuspend the pellets in 1 ml of PBS/1% FBS buffer or RPMI medium.</li>
	<li>Count the viable cells (both IELs and LPLs) using 0.4% trypan blue dye/PBS solution.</li>
</ol>
4. Expression of IL-22-tdTomato in Colitis
<ol>
	<li>Prepare single spleen cell suspensions from IL-22-TdTomato mice at a concentration of 1 x 107 cells/ml in sterile PBS, as described in steps 2.1-2.4.</li>
	<li>Purify the CD4+ T cells using the Mouse CD4 Cell Negative Isolation method10. Label them with anti-CD4-APC (clone RM4-5, 0.5 &#181;l/1 x 106 cells in PBS/1% FBS buffer) and anti-CD45RB-FITC (clone 16A, 0.5 &#181;l/1 x 106 cells in PBS/1% FBS buffer) by incubation at 4 &#176;C for 30 min.</li>
	<li>Spin the cells down for 5 min at 500 x g and 4 &#176;C. Wash the cells with 2 ml of PBS/1% FBS buffer and resuspend them in 1 ml of PBS/1% FBS staining buffer.</li>
	<li>Run the labeled T cells on a flow cytometry machine16. Gate the cells on a T-cell population and sort CD4+CD45RBhigh double-positive cells (the wavelength detected at 488 nm and 633 nm lasers).</li>
	<li>Harvest the sorted cells by centrifugation for 5 min at 500 x g and 4 &#176;C. Resuspend the cell pellets in sterile PBS buffer at 1 x 106 cells/ml. Inject the cells (0.5 x 106) into the peritoneum ofeach Rag1-/- recipient mouse.</li>
	<li>Sacrifice the recipient mice under CO2 at various time points. Harvest the mesenteric lymph nodes and the small and large intestines, as described in steps 2.1 and 2.2. Put each mesenteric lymph node and cut-open intestine (paper/intestine/paper sandwich) in 4% paraformaldehyde (PFA; handle under a fume hood) overnight to fix the tissues. Replace the PFA with 18% sucrose for 16-24 hr and then freeze the tissues for sectioning.</li>
	<li>Use the cryostat machine to cut the tissue17,18,19. Warm the tissue sections to room temperature for approximately 60 min and place them in acetone for 10 min at room temperature. Dry them at room temperature for approximately 5 min.</li>
	<li>Add FBS in excess, remove it by pipette, and add anti-RFP at a 1:200 dilution in 0.1% BSA/1x PBS. Incubate the antibody at 37 &#176;C for 60 min.</li>
	<li>Rinse the sections in 1x PBS for 10 min and apply the corresponding secondary antibody (goat anti-rabbit 568) to the tissue, diluted 1:300 in 1% BSA/1x PBS, for 30 min at room temperature.</li>
	<li>Rinse slides in 1x PBS for 10 min, wipe them dry, and add coverslips.</li>
	<li>Visualize all samples with a fluorescent microscope under consistent illumination (RFP: excitation filter 540-580 nm) using the 40X objective.</li>
</ol>

<ol>
	<li>Awasthi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+IL-23+receptor+gfp+reporter+mice+reveal+distinct+populations+of+IL-17-producing+cells.">Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells.</a> J Immunol. 182, 5904-5908 (2009).</li><li>Price, A. E., Reinhardt, R. L., Liang, H. E., Locksley, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marking+and+quantifying+IL-17A-producing+cells+in+vivo.">Marking and quantifying IL-17A-producing cells in vivo.</a> PLoS One. 7, e39750 (2012).</li><li>Kamanaka, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+interleukin-10+in+intestinal+lymphocytes+detected+by+an+interleukin-10+reporter+knockin+tiger+mouse.">Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.</a> Immunity. 25, 941-952 (2006).</li><li>Sonnenberg, G. F., Fouser, L. A., Artis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Border+patrol:+regulation+of+immunity,+inflammation+and+tissue+homeostasis+at+barrier+surfaces+by+IL-22.">Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22.</a> Nat Immunol. 12, 383-390 (2011).</li><li>Dumoutier, L., Louahed, J., Renauld, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+characterization+of+IL-10-related+T+cell-derived+inducible+factor+(IL-TIF),+a+novel+cytokine+structurally+related+to+IL-10+and+inducible+by+IL-9.">Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.</a> J Immunol. 164, 1814-1819 (2000).</li><li>Cella, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+natural+killer+cell+subset+provides+an+innate+source+of+IL-22+for+mucosal+immunity.">A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity.</a> Nature. 457, 722-725 (2009).</li><li>Sanos, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RORgammat+and+commensal+microflora+are+required+for+the+differentiation+of+mucosal+interleukin+22-producing+NKp46++cells.">RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells.</a> Nat Immunol. 10, 83-91 (2009).</li><li>Spits, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+lymphoid+cells--a+proposal+for+uniform+nomenclature.">Innate lymphoid cells--a proposal for uniform nomenclature.</a> Nat Rev Immunol. 13, 145-149 (2013).</li><li>Mazzucchelli, R. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+identification+of+IL-7+producing+cells+in+reporter+mice.">Visualization and identification of IL-7 producing cells in reporter mice.</a> PLoS One. 4, e7637 (2009).</li><li>Shen, W., Hixon, J. A., McLean, M. H., Li, W. Q., Durum, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22-Expressing+Murine+Lymphocytes+Display+Plasticity+and+Pathogenicity+in+Reporter+Mice.">IL-22-Expressing Murine Lymphocytes Display Plasticity and Pathogenicity in Reporter Mice.</a> Front Immunol. 6, 662 (2015).</li><li>Gong, S., Yang, X. W., Li, C., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+modification+of+bacterial+artificial+chromosomes+(BACs)+using+novel+shuttle+vectors+containing+the+R6Kgamma+origin+of+replication.">Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication.</a> Genome Res. 12, 1992-1998 (2002).</li><li>Shen, W., Huang, Y., Tang, Y., Liu, D. P., Liang, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+to+modify+BACs+to+generate+large+recombinant+DNA+fragments.">A general method to modify BACs to generate large recombinant DNA fragments.</a> Mol Biotechnol. 31, 181-186 (2005).</li><li>Cho, A., Haruyama, N., Kulkarni, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+mice.">Generation of transgenic mice.</a> Curr Protoc Cell Biol. Chapter. Chapter 19, Unit 19 11 (2009).</li><li>Danneman, P. J., Stein, S., Walshaw, S. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humane+and+practical+implications+of+using+carbon+dioxide+mixed+with+oxygen+for+anesthesia+or+euthanasia+of+rats.">Humane and practical implications of using carbon dioxide mixed with oxygen for anesthesia or euthanasia of rats.</a> Lab Anim Sci. 47, 376-385 (1997).</li><li>Omata, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+coccidian+enteroepithelial+stages+of+Toxoplasma+gondii+from+the+intestinal+mucosa+of+cats+by+Percoll+density-gradient+centrifugation.">Isolation of coccidian enteroepithelial stages of Toxoplasma gondii from the intestinal mucosa of cats by Percoll density-gradient centrifugation.</a> Parasitol Res. 83, 574-577 (1997).</li><li>Kumar, N., Borth, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-cytometry+and+cell+sorting:+an+efficient+approach+to+investigate+productivity+and+cell+physiology+in+mammalian+cell+factories.">Flow-cytometry and cell sorting: an efficient approach to investigate productivity and cell physiology in mammalian cell factories.</a> Methods. 56, 366-374 (2012).</li><li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> CSH Protoc. 2008, pdb.prot4991 (2008).</li><li>Hilbe, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+automated+cellular+imaging+system+and+manual+microscopy+for+immunohistochemically+stained+cryostat+sections+of+lung+cancer+specimens+applying+p53,+ki-67+and+p120.">Comparison of automated cellular imaging system and manual microscopy for immunohistochemically stained cryostat sections of lung cancer specimens applying p53, ki-67 and p120.</a> Oncol Rep. 10, 15-20 (2003).</li><li>Suzuki, Y., Furukawa, M., Abe, J., Kashiwagi, M., Hirose, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localization+of+porcine+trappin-2+(SKALP/elafin)+in+trachea+and+large+intestine+by+in+situ+hybridization+and+immunohistochemistry.">Localization of porcine trappin-2 (SKALP/elafin) in trachea and large intestine by in situ hybridization and immunohistochemistry.</a> Histochem Cell Biol. 114, 15-20 (2000).</li><li>Wolk, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+increases+the+innate+immunity+of+tissues.">IL-22 increases the innate immunity of tissues.</a> Immunity. 21, 241-254 (2004).</li><li>Brand, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+is+increased+in+active+Crohn's+disease+and+promotes+proinflammatory+gene+expression+and+intestinal+epithelial+cell+migration.">IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration.</a> Am J Physiol Gastrointest Liver Physiol. 290, G827-G838 (2006).</li><li>Nagalakshmi, M. L., Rascle, A., Zurawski, S., Menon, S., Waal Malefyt, d. e., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22+activates+STAT3+and+induces+IL-10+by+colon+epithelial+cells.">Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.</a> Int Immunopharmacol. 4, 679-691 (2004).</li><li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Andoh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22,+a+member+of+the+IL-10+subfamily,+induces+inflammatory+responses+in+colonic+subepithelial+myofibroblasts.">Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts.</a> Gastroenterology. 129, 969-984 (2005).</li><li>Bhan, A. K., Mizoguchi, E., Smith, R. N., Mizoguchi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colitis+in+transgenic+and+knockout+animals+as+models+of+human+inflammatory+bowel+disease.">Colitis in transgenic and knockout animals as models of human inflammatory bowel disease.</a> Immunol Rev. 169, 195-207 (1999).</li><li>Mombaerts, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+development+of+inflammatory+bowel+disease+in+T+cell+receptor+mutant+mice.">Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice.</a> Cell. 75, 274-282 (1993).</li><li>Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+regulation+in+the+intestine:+a+balancing+act+between+effector+and+regulatory+T+cell+responses.">Immune regulation in the intestine: a balancing act between effector and regulatory T cell responses.</a> Ann N Y Acad Sci. 1029, 132-141 (2004).</li><li>Ahlfors, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+fate+reporter+reveals+origin+and+control+of+IL-22+production+in+homeostasis+and+infection.">IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection.</a> J Immunol. 193, 4602-4613 (2014).</li></ol>

The authors have nothing to disclose.

IL-22 plays an essential role in innate host defense and tissue remodeling. IL-22-producing cells have been identified ex vivo by intracellular staining. However, it still remains difficult to track IL-22 expression in situ, either in the normal state or in inflammatory conditions. This protocol describes a novel method to develop an IL-22 reporter mouse model, which enables us to localize the reporter-expressing cells in vivo. The reporter gene encoding TdTomato was inserted into the IL-22 locus at a site that disrupts the signal sequence. This strategy results in the reporter being trapped in the producing cell, unlike IL-22 which is rapidly secreted, enabling visualization of the producing cell. The engineered IL-22-reporter was contained within a large BAC, with the aim of preserving the regulatory elements, thus conferring fidelity of expression of the reporter corresponding to that of IL-22. The intestinal tissues of transgenic mice displayed homeostatic reporter expression in CD4 T cells and innate lymphocytes in the lamina propria of the small intestine. In induced colitis, CD4 T cells expressed the reporter in the colon.
The role of IL-22 in inflammatory bowel disease has been unclear. By participating in the intestinal mucosal defense and tissue regeneration, IL-22 is capable of eliciting the production of both protective20,21,22 and proinflammatory mediators (e.g., IL-8)23,24. Two models of T cell-driven colitis showed increases in IL-22 in the colon, including TCR &#945; -/- mice25,26 and the CD45RBhi transfer model27. Comparing inflammatory bowel disease models, IL-22 expression in the intestine was higher in a Crohn&#39;s disease modelthan in a model of ulcerative colitis21,24.Here, we transfer CD4CD45RBhi T cells from the reporter mice into Rag1-/- recipients and mimic the pathogenic process of Crohn&#39;s disease. We found that, preceding colitis, IL-22 reporters were visualized in intestinal draining lymph nodes (MLN). The signals then diminished in the MLN and moved to the intestines, especially the distal small intestines and colons, with the development of colitis. Most tdTomato reporters were localized inside the lamina propria mucosa of the intestine.
A different type of reporter for IL-22 has been previously described, in which cells are permanently marked such that they and their daughters continue to express the reporter, whether or not transcription of IL-22 has continued28. As in our study, gut innate lymphocytes were marked under homeostatic conditions, and in colitis, the reporter was localized in T cells from the mesenteric lymph nodes to the intestinal tissue.
The procedures described in this protocol would be applicable for the establishment of other transgene reporter mice, such as IL-17, IL-25, and so on. However, it is crucial to choose suitable BAC clones carrying distal regulatory elements to assure the fidelity of reporter gene expression, since the transgenes are randomly integrated into the mouse genome. The reporter mouse allows for the identification of cells expressing in vivo, as well as for the purification and characterization of live cells. We used tdTomato, an exceptionally bright red fluorescent protein, as a fluorescent reporter gene to make the reporter suitable for live animal imaging studies.

Cell type-specific expression of reporter genes is useful to identify cells actively expressing the target in tissues under homeostatic and perturbed states. It also allows for the purification of these cells, which remain viable, to study their other properties. Reporter mice have been utilized in elucidating the mechanism of action for specific cytokines, transcription factors, and regulatory elements. Previous strategies1,2,3 have largely relied on knocking the reporter into the target locus in the mouse chromosome, a time-consuming and costly procedure. Thus, a simpler method for the generation of reporter mice is desirable.
Cytokines are a broad class of small, secreted proteins/peptides that regulate immune responses through intercellular signaling. Interleukin 22 (IL-22) is a cytokine with many reported activities, including barrier function, tissue repair, and inflammation4. Although IL-22 was initially discovered as a T-cell product5, subsequent reports demonstrated its expression in natural killer (NK) cells in humans6 and mice7 and in other classes of innate lymphocytes8. Despite extensive observation of IL-22-producing cells, visualization of IL-22 previously required ex vivo stimulation and permeabilization to stains with antibodies. Therefore, novel IL-22 reporter mice would be a very useful tool to investigate the function of IL-22 in homeostatic and pathogenic processes.
Here, we developed a simplified transgenic reporter mouse model to observe the IL-22-producing cells in vivo and in vitro. Using a BAC recombineering method9, we inserted the tdTomato cDNA sequence with Poly A signal fragments into the IL-22 locus and replaced exon 1. The other untranslated regions, exons, and regulatory elements were not perturbed, since we would like to mimic the natural regulation of IL-22 as much as possible. The site of reporter insertion disrupts the signal sequence, resulting in the accumulation of the reporter inside the producing cells, unlike IL-22 itself, which is rapidly secreted. This new method can also be applied to the generation of reporter mice for other secreted proteins.

<table border="0" cellpadding="0" cellspacing="0" width="775">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">RP23-401E11 BAC</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">RPCI23.C</td>
			<td style="width:345px;">Need gene ID: 50929</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">NucleoBond BAC 100</td>
			<td style="width:151px;">Takara Clontech</td>
			<td style="width:116px;">740579</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PCR SuperMix High Fidelity</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">10790020</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PI-SceI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0696S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">SpeI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0133S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LB Broth</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">10855-001</td>
			<td style="width:345px;">1L: 10 g SELECT Peptone 140, 5 g SELECT Yeast Extract, 5 g sodium chloride&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD3</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0031</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD4</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">17-0041</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">MCD4530</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45RB</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0455</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse RFP</td>
			<td style="width:151px;">Abcam</td>
			<td style="width:116px;">Ab62341</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">HBSS, no calcium, no magnesium, no phenol red</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">14175145</td>
			<td style="width:345px;">KCl, KH2PO4, Na2HPO4, NaHCO3, NaCl, D-Glucose</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Dnase I</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">10104159001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">ACK lysing buffer</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">A1049201</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Percoll</td>
			<td style="width:151px;">GE healthcare life sciences</td>
			<td style="width:116px;">17-0891-01</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Collagenase D</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">11088858001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Dispase II (neutral protease, grade II)</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">4942078001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">IX70 inverted fluorescence microscope</td>
			<td style="width:151px;">Olympus</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Nikon Eclipse 80i microscope</td>
			<td style="width:151px;">Nikon</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">Dynal shaker</td>
			<td style="width:151px;">Electron Microscopy Science</td>
			<td style="width:116px;">61050-10</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">FACSAria</td>
			<td style="width:151px;">BD Bioscience</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LSRII SORP/flow cytometry</td>
			<td style="width:151px;">Becton, Dickinson and Company&#160;</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
	</tbody>
</table>

visualization of il-22-expressing lymphocytes using reporter mice

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new transgenic reporter mouse model. We chose to visualize interleukin (IL) 22 gene expression because this cytokine has important activities in the intestine, where it contributes to repair tissues damaged by inflammation. Reporter systems offer considerable advantages over other methods of identifying products in vivo. In the case of IL-22, other studies had first isolated cells from tissues and then re-stimulated the cells in vitro. IL-22, which is normally secreted, was trapped inside cells using a drug, and intracellular staining was used to visualize it. This method identifies cells capable of producing IL-22, but it does not determine whether they were doing so in vivo. The reporter design includes inserting a gene for a fluorescent protein (tdTomato) into the IL-22 gene in such a way that the fluorescent protein cannot be secreted and therefore remains trapped inside the producing cells in vivo. Fluorescent producers can then be visualized in tissue sections or by ex vivo analysis through flow cytometry. The actual construction process for the reporter included recombineering a bacterial artificial chromosome that contained the IL-22 gene. This engineered chromosome was then introduced into the mouse genome. Homeostatic IL-22 reporter expression was observed in different mouse tissues, including the spleen, thymus, lymph nodes, Peyer&#39;s patch, and intestine, by flow cytometry analysis. Colitis was induced by T-cell (CD4+CD45RBhigh) transfer, and reporter expression was visualized. Positive T cells were first present in the mesenteric lymph nodes, and then they accumulated inside the lamina propria of the distal small intestine and colon tissues. The strategy using BACs gave good-fidelity reporter expression compared to IL-22 expression, and it is simpler than knock-in procedures.

A murine IL-22 reporter transgene was created using recombineering to modify a bacterial artificial chromosome carrying the IL-22 locus. Figure 1 shows a diagram of pBACe3.6 vector containing the sacBII gene, a positive-selection marker, and chloramphenicol antibiotic resistance gene11. After introducing tdTomato into exon 1, the signal peptide sequence was disrupted, as shown in Figure 2. Thus, the tdTomato reporter was trapped inside the IL-22-expressing cells, enabling their detection and isolation by flow cytometry. The homozygous mice were bred from founder lines and screened by PCR, and they did not require backcrossing in order to achieve offspring with a genetic identity, as is required in the usual knock-in strategy. To test the fidelity of the IL-22 reporters, in vitro-generated splenocytes were cultured under Th22 or neutral conditions. Figure 3 demonstrates that IL-22-tdtomato was well expressed in Th22 cells in vitro, detected either by flow cytometry or by fluorescent microscopy. In vivo, as shown in Figure 4, the IL-22 reporter was detected in different mouse tissues under homeostatic condition. Most of the tdTomato signal was found in the lamina propria (LP) cells from the gut, but not in the axillary lymph node (ALN), the spleen, or the thymus. To visualize the tdTomato reporter in inflamed tissue, we used a mouse colitis model induced by the transfer of reporter CD4+CD45Rbhi T cells into Rag1-/- mice. Figure 5 demonstrates that the reporters were first present in the mesenteric lymph nodes and then accumulated inside the lamina propria of distal small intestine and colon tissues. Taken together, this novel method for the generation of IL-22 reporter mice is effective and time-saving.
<img alt="Figure 1" src="/files/ftp_upload/54710/54710fig1.jpg" /> 
Figure 1: Site map of the pBACe3.6 vector. pBACe3.6 is characterized by containing chloramphenicol antibiotic resistance and a sacBII gene as a positive-selection marker. During recombination, the desired clones are sucrose-resistant through their expressing the sacBII gene and are allowed to grow on sucrose-containing media, while the negative BAC colonies are sucrose-sensitive.
<img alt="Figure 2" src="/files/ftp_upload/54710/54710fig2.jpg" /> 
Figure 2: Schematic view of the modified RP23-401E11 BAC clone. A tdTomato&#160;reporter gene was introduced into the Il-22 locus, which includes IL-22 and regulatory elements in a murine bacterial artificial chromosome (BAC RP23-401E11), using recombineering technology. By homologous recombination, the sequence of the signal peptide of Il-22 in the BAC was disrupted and exon 1 of Il-22 was replaced by the tdTomato reporter gene. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54710/54710fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/54710/54710fig3.jpg" /> 
Figure 3: Identification of IL-22 reporters in splenocytes cultured in vitro. CD4 T cells were purified from the spleen and then stimulated with anti-CD28; anti-CD3 (neutral condition); or anti-CD3, anti-CD28, anti-IFN&#435;, anti-IL4, IL-6, TGF-&#946;, and 6-Formylindolo (3,2-b)carbazole (FICZ) for 5 days. IL-22-tdTomato was analyzed by flow cytometry (top two) and fluorescent microscopy (bottom two, scale bar: 100 &#181;m). The numbers in the quadrants indicate the percent of CD45+ cells. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54710/54710fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/54710/54710fig4.jpg" /> 
Figure 4: Visualization of IL-22-producing cells in different mouse tissues. Single-cell suspensions were prepared from the spleen, thymus, lymph nodes, intestines (IEL and LP), and Peyer&#39;s patch. They were then surface-stained with FITC-anti-CD3 and examined for tdTomato expression. MLN: mesenteric lymph node, ALN: axillary lymph node, PP: Peyer&#39;s patch, IEL: intraepithelial cells isolated from the small intestine, LP: lamina propria cells purified from the small intestine. The numbers in the quadrants indicate the percent of CD45+ cells. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54710/54710fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/54710/54710fig5.jpg" /> 
Figure 5: Localization of IL-22 reporters during the development of T-cell transfer colitis. CD4CD45RBHigh T cells from IL-22 reporter mice were transferred into Rag1-/- mice, and the tdTomato signals were evaluated by immunohistochemistry in the different tissues at different time points during the development of colitis. The arrows point to the IL-22-tdTomato signals. Scale bars = 25 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54710/54710fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

visualization-of-il-22-expressing-lymphocytes-using-reporter-mice

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

8.7K Views.  National Cancer Institute, National Institutes of Health. We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse. 

Video: Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Visualization of Bacterial Toxin Induced Responses Using Live Cell Fluorescence Microscopy

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external environment. The cell can either recover from this insult, which requires active membrane repair processes, or else die depending on the amount of toxin exposure and cell type1. In addition, these toxins induce strong inflammatory responses in infected hosts through activation of immune cells, including macrophages, which produce an array of pro-inflammatory cytokines2. Many Gram positive bacteria produce cholesterol binding toxins which have been shown to contribute to their virulence through largely uncharacterized mechanisms.
Morphologic changes in the plasma membrane of cells exposed to these toxins include their sequestration into cholesterol-enriched surface protrusions, which can be shed into the extracellular space, suggesting an intrinsic cellular defense mechanism3,4. This process occurs on all cells in the absence of metabolic activity, and can be visualized using EM after chemical fixation4. In immune cells such as macrophages that mediate inflammation in response to toxin exposure, induced membrane vesicles are suggested to contain cytokines of the IL-1 family and may be responsible both for shedding toxin and disseminating these pro-inflammatory cytokines5,6,7. A link between IL-1&beta; release and a specific type of cell death, termed pyroptosis has been suggested, as both are caspase-1 dependent processes8. To sort out the complexities of this macrophage response, which includes toxin binding, shedding of membrane vesicles, cytokine release, and potentially cell death, we have developed labeling techniques and fluorescence microscopy methods that allow for real time visualization of toxin-cell interactions, including measurements of dysfunction and death (Figure 1). Use of live cell imaging is necessary due to limitations in other techniques. Biochemical approaches cannot resolve effects occurring in individual cells, while flow cytometry does not offer high resolution, real-time visualization of individual cells. The methods described here can be applied to kinetic analysis of responses induced by other stimuli involving complex phenotypic changes in cells.

Methods for purifying the cholesterol binding toxin streptolysin O from recombinant E. coli and visualization of toxin binding to live eukaryotic cells are described. Localized delivery of toxin induces rapid and complex changes in targeted cells revealing novel aspects of toxin biology.

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external ...

Isolation of Lymphocytes from Mouse Genital Tract Mucosa

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and bacteria 1. Mucosae are also inductive sites in the host to generate immunity against pathogens, such as the Peyers patches in the intestinal tract and the nasal-associated lymphoreticular tissue in the respiratory tract. This unique feature brings mucosal immunity as a crucial player of the host defense system. Many studies have been focused on gastrointestinal and respiratory mucosal sites. However, there has been little investigation of reproductive mucosal sites. The genital tract mucosa is the primary infection site for sexually transmitted diseases (STD), including bacterial and viral infections. STDs are one of the most critical health challenges facing the world today. Centers for Disease Control and Prevention estimates that there are 19 million new infectious every year in the United States. STDs cost the U.S. health care system $17 billion every year 2, and cost individuals even more in immediate and life-long health consequences. In order to confront this challenge, a greater understanding of reproductive mucosal immunity is needed and isolating lymphocytes is an essential component of these studies. Here, we present a method to reproducibly isolate lymphocytes from murine female genital tracts for immunological studies that can be modified for adaption to other species. The method described below is based on one mouse.&#x2003;

An efficient way to isolate lymphocytes from mouse genital tract is described. This method takes advantage of enzyme digestion and Percoll gradient separation to allow efficient isolation. This technique is also adaptable to for use in other species

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and ...

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Long Term Intravital Multiphoton Microscopy Imaging of Immune Cells in Healthy and Diseased Liver Using CXCR6.Gfp Reporter Mice

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, neutrophils, T cell subsets, B cells, natural killer (NK) and NKT cells. Intravital microscopy of the liver for monitoring immune cell migration is particularly challenging due to the high requirements regarding sample preparation and fixation, optical resolution and long-term animal survival. Yet, the dynamics of inflammatory processes as well as cellular interaction studies could provide critical information to better understand the initiation, progression and regression of inflammatory liver disease. Therefore, a highly sensitive and reliable method was established to study migration and cell-cell-interactions of different immune cells in mouse liver over long periods (about 6 hr) by intravital two-photon laser scanning microscopy (TPLSM) in combination with intensive care monitoring.
The method provided includes a gentle preparation and stable fixation of the liver with minimal perturbation of the organ; long term intravital imaging using multicolor multiphoton microscopy with virtually no photobleaching or phototoxic effects over a time period of up to 6 hr, allowing tracking of specific leukocyte subsets; and stable imaging conditions due to extensive monitoring of mouse vital parameters and stabilization of circulation, temperature and gas exchange.
To investigate lymphocyte migration upon liver inflammation CXCR6.gfp knock-in mice were subjected to intravital liver imaging under baseline conditions and after acute and chronic liver damage induced by intraperitoneal injection(s) of carbon tetrachloride (CCl4).
CXCR6 is a chemokine receptor expressed on lymphocytes, mainly on Natural Killer T (NKT)-, Natural Killer (NK)- and subsets of T lymphocytes such as CD4 T cells but also mucosal associated invariant (MAIT) T cells1. Following the migratory pattern and positioning of CXCR6.gfp+ immune cells allowed a detailed insight into their altered behavior upon liver injury and therefore their potential involvement in disease progression.

Stable intravital high-resolution imaging of immune cells in the liver is challenging. Here we provide a highly sensitive and reliable method to study migration and cell-cell-interactions of immune cells in mouse liver over long periods (about 6 hours) by intravital multiphoton laser scanning microscopy in combination with intensive care monitoring.

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, ...

Intravital Imaging of Neutrophil Priming Using IL-1&#946; Promoter-driven DsRed Reporter Mice

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that enhances the phagocytic functionality of neutrophils. Although extensive studies have unveiled the existence and importance of neutrophil priming during infection and injury, means of visualizing this process in vivo have been unavailable. The protocol provided enables monitoring of the dynamic process of neutrophil priming in living animals by combining three methodologies: 1) DsRed reporter signal &#8212; used as a measure of priming 2) in vivo neutrophil labeling &#8212; achieved by injection of fluorescence-conjugated anti-lymphocyte antigen 6G (Ly6G) monoclonal antibody (mAb) and 3) intravital confocal imaging. Several critical steps are involved in this protocol: oxazolone-induced mouse ear skin inflammation, appropriate sedation of animals, repeated injections of anti-Ly6G mAb, and prevention of focus drift during imaging. Although a few limitations have been observed, such as the limit of continuous imaging time (~ 8 hr) in one mouse and the leakage of fluorescein isothiocyanate-dextran from blood vessels in the inflammatory state, this protocol provides a fundamental framework for intravital imaging of primed neutrophil behavior and function, which can easily be expanded to examination of other immune cells in mouse inflammation models.

This current protocol employs fluorescent reporters, in vivo labeling, and intravital imaging techniques to enable monitoring of the dynamic process of neutrophil priming in living animals.

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that ...

Isolation and Activation of Murine Lymphocytes

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading pathogen1,2. Understandably, such intricate abilities are controlled by a large number of molecules involved in various cellular processes to ensure timely and spatially regulated immune responses3. Here, we describe experimental procedures that allow rapid isolation of highly purified murine lymphocytes using magnetic cell sorting technology. The resulting purified lymphocytes can then be subjected to various in vitro or in vivo functional assays, such as the determination of lymphocyte signaling capacity upon stimulation by immunoblotting4 and the investigation of proliferative abilities by 3H-thymidine incorporation or carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling5-7. In addition to comparing the functional capacities of control and genetically modified lymphocytes, we can also determine the T cell stimulatory capacity of antigen-presenting cells (APCs) in vivo, as shown in our representative results using transplanted CFSE-labeled OT-I T cells.

Lymphocytes are the major players in adaptive immune responses. Here, we present a lymphocyte purification protocol to determine the physiological functions of the desired molecules in lymphocyte activation in vitro and in vivo. The described experimental procedures are suitable for comparing functional capacities between control and genetically modified lymphocytes.

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading ...

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. albicans is its ability to form biofilms, structured communities of cells attached to biotic and abiotic surfaces. C. albicans biofilms can form on host tissues, such as mucosal layers, and on medical devices, such as catheters, pacemakers, dentures, and joint prostheses. Biofilms pose significant clinical challenges because they are highly resistant to physical and chemical perturbations, and can act as reservoirs to seed disseminated infections. Various in vitro assays have been utilized to study C. albicans biofilm formation, such as microtiter plate assays, dry weight measurements, cell viability assays, and confocal scanning laser microscopy. All of these assays are single end-point assays, where biofilm formation is assessed at a specific time point. Here, we describe a protocol to study biofilm formation in real-time using an automated microfluidic device under laminar flow conditions. This method allows for the observation of biofilm formation as the biofilm develops over time, using customizable conditions that mimic those of the host, such as those encountered in vascular catheters. This protocol can be used to assess the biofilm defects of genetic mutants as well as the inhibitory effects of antimicrobial agents on biofilm development in real-time.

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

This protocol describes the use of a customizable automated microfluidic device to visualize biofilm formation in Candida albicans under host physiological conditions.

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. ...

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by fluorescence or bioluminescence. We utilize BlaC, an enzyme expressed constitutively by all M. tuberculosis strains. REF allows rapid quantification of bacteria in lungs of infected mice. The same group of mice can be imaged at many time points, greatly reducing costs, enumerating bacteria more quickly, allowing novel observations in host-pathogen interactions, and increasing statistical power, since more animals per group are readily maintained. REF is extremely sensitive due to the catalytic nature of the BlaC enzymatic reporter and specific due to the custom flourescence resonance energy transfer (FRET) or fluorogenic substrates used. REF does not require recombinant strains, ensuring normal host-pathogen interactions. We describe the imaging of M. tuberculosis infection using a FRET substrate with maximal emission at 800 nm. The wavelength of the substrate allows sensitive deep tissue imaging in mammals. We will outline aerosol infection of mice with M. tuberculosis, anesthesia of mice, administration of the REF substrate, and optical imaging. This method has been successfully applied to evaluating host-pathogen interactions and efficacy of antibiotics targeting M. tuberculosis.

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

We describe the optical imaging of mice infected with Mycobacterium tuberculosis (M. tuberculosis) using reporter enzyme fluorescence (REF). This protocol facilitates the sensitive and specific detection of M. tuberculosis in pre-clinical animal models for pathogenesis, therapeutics and vaccine research.

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by ...

Probiotic Studies in Neonatal Mice Using Gavage

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult mouse models to neonatal diseases is limited. To better understand disease progression, host responses and long-term impact of interventions in neonates, a neonatal mouse model likely is a better fit. The sparse use of neonatal mouse models can in part be attributed to the technical difficulties of working with these small animals. A neonatal mouse model was developed to determine the effects of probiotic administration in early life and to specifically assess the ability to establish colonization in the newborn mouse intestinal tract. Specifically, to assess probiotic colonization in the neonatal mouse, Lactobacillus plantarum (LP) was delivered directly into the neonatal mouse gastrointestinal tract. To this end, LP was administered to mice by feeding through intra-esophageal (IE) gavage. A highly reproducible method was developed to standardize the process of IE gavage that allows an accurate administration of probiotic dosages while minimizing trauma, an aspect particularly important given the fragility of newborn mice. Limitations of this process include possibilities of esophageal irritation or damage and aspiration if gavaged incorrectly. This approach represents an improvement on current practices because IE gavage into the distal esophagus reduces the chances of aspiration. Following gavage, the colonization profile of the probiotic was traced using quantitative polymerase chain reaction (qPCR) of the extracted intestinal DNA with LP specific primers. Different litter settings and cage management techniques were used to assess the potential for colonization-spread. The protocol details the intricacies of IE neonatal mouse gavage and subsequent colonization quantification with LP.

This study details the process of gavaging precise amounts of probiotics to neonatal mice. The experimental set-up was optimized to include but is not limited to probiotic dosing, methods of administration, and quantification of bacteria in the intestines.

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult ...

Intravital Imaging of Intraepithelial Lymphocytes in Murine Small Intestine

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal epithelium. Due in part to the lack of a definitive ligand for the &#947;&#948; T cell receptor, our understanding of the regulation of &#947;&#948; IEL activation and their function in vivo remains limited. This necessitates the development of alternative strategies to interrogate signaling pathways involved in regulating &#947;&#948; IEL function and the responsiveness of these cells to the local microenvironment. Although &#947;&#948; IELs are widely understood to limit pathogen translocation, the use of intravital imaging has been critical to understanding the spatiotemporal dynamics of IEL/epithelial interactions at steady-state and in response to invasive pathogens. Herein, we present a protocol for visualizing IEL migratory behavior in the small intestinal mucosa of a GFP &#947;&#948; T cell reporter mouse using inverted spinning disk confocal laser microscopy. Although the maximum imaging depth of this approach is limited relative to the use of two-photon laser-scanning microscopy, spinning disk confocal laser microscopy provides the advantage of high speed image acquisition with reduced photobleaching and photodamage. Using 4D image analysis software, T cell surveillance behavior and their interactions with neighboring cells can be analyzed following experimental manipulation to provide additional insight into IEL activation and function within the intestinal mucosa.

We describe a method to visualize GFP-labeled &#947;&#948; IELs using intravital imaging of murine small intestine by inverted spinning disk confocal microscopy. This technique enables the tracking of live cells within the mucosa for up to 4 h and can be used to investigate a variety of intestinal immune-epithelial interactions. &#160;