Name: engineering oncogenic heterozygous gain-of-function mutations in human hematopoietic stem and progenitor cells
Uploaded: 2023-03-10T14:50:00.000+00:00
Duration: 12 min 4 s
Description: Watch this Scientific Journal Video about Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells at JoVE.com

This work is supported by grants from the Austrian Science Fund (FWF; number P32783 and I5021) to A.R. Additional funding to A.R. is also provided by the Austrian Society of Internal Medicine (Joseph Skoda Fellowship), the Austrian Society of Hematology and Oncology (OeGHO; Clinical Research Grant), and MEFOgraz.&#160;T.K. is a Special Fellow of the Leukemia &#38; Lymphoma Society.

The authors have nothing to disclose.

The efficient and precise genetic manipulation of human primary HSPCs represents a great opportunity to explore and understand the processes influencing normal hematopoiesis, and most importantly, the leukemic transformation of hematopoietic cells.
In this protocol, an efficient strategy to engineer human HSPCs to express recurrent heterozygous GOF mutations was described. This procedure took advantage of CRISPR/Cas9 technology and rAAV6 vectors as donors for DNA templates to precisely insert WT and mutant DNA sequences into their endogenous gene loci. Coupling the engineered cDNAs (WT and mutant) with separated fluorescent reporter proteins allows for the enrichment and tracking of cells with a definitive heterozygous state.
This strategy presents several advantages in comparison to the frequently used lentiviral (LV)-based methods. One main advantage is that the CRISPR/Cas9-based system allows for precise editing in the endogenous loci, resulting in the preservation of the endogenous promoters and regulatory elements. This leads to homogeneity in the expression of the edited gene in the cells, a goal hardly achievable when an LV-based method is used. Gene transfer with LV vectors leads to semi-random integration of the gene with preference for transcriptionally active sites34. This can translate into overexpression of the transferred gene and heterogeneity between the edited cells, eventually resulting in difficulties to investigate and analyze the role of mutations and gene interactions. A second advantage is that the described system, being a site-specific editing system, eliminates the risks of insertional mutagenesis35.
The dual fluorescent reporter strategy allows for the precise enrichment and tracking of cells that were successfully edited on both alleles, with one allele integrating the WT cDNA and the other allele integrating the mutated cDNA sequences. Cells only expressing a single reporter represent either only monoallelic integration or biallelic integration of HDR templates with the same fluorescent reporter. Both scenarios can only be precisely distinguished if single cell-derived clones are produced and individually analyzed. However, HSPCs have only limited proliferative capacity in vitro, and when kept in culture for extended periods of time, HSPCs start differentiating into more mature progeny and lose their self-renewal and engraftment capacity. This makes selecting and expanding single-cell clones harboring the desired heterozygous mutation unfeasible. The application of the dual fluorescent protein strategy and enrichment by flow cytometry for cells bearing the heterozygous mutation allows for bypassing the problems induced by extended in vitro culture.
In this specific example, it was successfully demonstrated that HSPCs could be efficiently engineered and sorted in order to obtain pure populations of HSPCs carrying the heterozygous CALRDEL/WT&#160;mutation.
However, this system is not limited to engineering heterozygous frameshift mutations but can also easily be adopted to create other mutation types, including missense and nonsense mutations. By applying different combinations of AAVs containing WT or mutated sequences with different fluorescent reporter proteins, this system can also be utilized for the introduction of homozygous mutations (simultaneous transduction with two rAAVs both carrying mutant cDNA but different fluorescent reporters) or even the correction of mutations (simultaneous transduction with two AAVs both carrying WT cDNA but different fluorescent reporters). Additionally, it is important to mention that this strategy is not limited to the introduction of oncogenic GOF mutations. In fact, the described protocol can be utilized for multiple alternative strategies including gene knock-out, gene replacement36,37, targeted knock-in of transgenes (i.e., chimeric antigen receptors)38, and even for the correction of disease-causing mutations11,39.
The strategy of combining CRISPR/Cas9 and AAV6 with multiple fluorescent reporters has also been shown to be applicable in many other cell types including T-cells, plasmacytoid dendritic cells, induced pluripotent stem cells, neuronal stem cells, and airway stem cells24,38,40,41,42,43,44. This strategy can be implemented for the production of superior chimeric antigen receptor (CAR) T cells. For example, it was recently published that CRISPR/Cas9-mediated knock-out of the TGFBR2 gene in CAR T cells greatly increases their function in the suppressive TGF-&#946; rich tumor microenvironment45. Such an approach could provide a one-step protocol to both engineer the T cells to express the CAR and to knock out the TGFBR2 gene by site specifically inserting the CAR into both alleles of the TGFBR2 gene. Moreover, this approach could also be useful to generate universal CAR T cells by integrating the CAR in the T cell receptor alpha constant (TRAC) gene46,47.
To increase the reproducibility and to guarantee efficient editing of the cells, some important considerations need to be taken care of. The main critical points for ensuring successful editing of the cells reside in (i) the selection of the sgRNA, (ii) the design of the HDR template, and (iii) the rAAV6 production.
The selection of a good-performing sgRNA is crucial as it will determine the maximum number of alleles in which the HDR template can be integrated. Due to numerous software that are now available, the search for candidate sgRNAs has been simplified. By selecting the region of interest, the software can propose a series of sgRNAs with an on-target score and an off-target score that indicate the chances for editing at the desired locus and unwanted loci, respectively. These scores are calculated based on previously published scoring models48,49. Although this is a good starting point for selecting a good-performing sgRNA, the performance of the sgRNA needs to be confirmed as its predicted performance in silico does not always correspond to an efficient sgRNA in vitro. Therefore, it is highly recommended to design and test out at least three sgRNAs to increase the chances of finding the best sgRNA. Once a true good-performing sgRNA has been identified, then it is suggested to proceed with the design of the HDR template.
Precautions should be taken into consideration when designing the HDR template. The left and right homology arms (LHA and RHA, respectively) should each span 400 bp upstream and downstream of the sgRNA cut site, respectively, as shorter HAs could result in reduced HDR frequencies. The size of the cDNA that can be introduced via HDR is dependent on the packaging capabilities of AAVs, which is roughly 4.7 kb. Due to the numerous elements mandatory within the HDR template (LHA, RHA, SA, PolyA, promoter, and fluorescent reporter sequence), the remaining space for the mutated or WT cDNA is limited. This is unproblematic if the desired mutation is located near the 3&#39; end of a gene or in genes with an overall short CDS. However, in cases where the mutation is located near the transcriptional start side (TSS) of the genes with a long CDS (exceeding the remaining packing space of the AAV), this described approach may not be feasible. To circumvent this problem, a strategy that relies on splitting the HDR template into two AAVs has been recently developed by Bak and colleagues. This strategy relies on two separate HDR-mediated integrations to obtain the final seamless integration of a large gene50.
The quality of the virus and its titer are additional factors that can make or break the successful genome engineering of the cells. For an optimal yield, it is important to not let the HEK293T reach full confluency while being maintained in culture. Ideally, the HEK293T cells should be split when 70%-80% confluency is reached. Additionally, the HEK293T should not be cultured for long periods of time as this can decrease their ability to produce virus. New HEK293T cells need to be thawed after 20 passages. Obtaining high virus titers is important for increasing the efficiency and reproducibility of the experiments. Low viral titers will translate to large volumes of rAAV solution required for the transduction of the HSPCs. As a general rule, the rAAV solution added to the nucleofected cells should not exceed 20% of the total volume of the HSPC retention medium. Higher volumes of AAV solution may lead to increased cell death, lower proliferation, and impaired transduction efficiencies. In the case of low virus titers, it is, therefore, recommended to further concentrate the virus.
In summary, this protocol offers a reproducible approach to manipulate human HSPCs precisely and efficiently through the simultaneous use of CRIPSR/Cas9 and rAAV6 donor templates with additional dual fluorescent reporters. This approach has proven to be a great tool in studying normal hematopoietic stem cell biology and the contributions that mutations make to leukemogenesis.

With the development of the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology, a new and extremely powerful instrument has been added to the toolkit of scientists. This technology allows for the precise engineering of the genome and has proven itself to be extremely useful not only for research purposes (reviewed in Hsu et al.1) but more recently has also been successfully translated into the clinical setting2,3,4. CRISPR/Cas9 editing strategies rely on the activity of a Cas9 protein and a single-guide RNA (sgRNA)5,6,7. In the host cell, the Cas9 protein is guided to a specific site in the DNA that is complementary to the sgRNA sequence and will introduce a DNA double-strand break (DSB). Once a DSB is generated, there are two main and competing repair mechanisms that can occur: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ is an error-prone, predominantly used repair mechanism leading to insertions and deletions (indels), whereas HDR, by using the sister chromatid as a repair template, is very precise but limited to the S or G2 phase of the cell cycle8. In genome engineering, HDR can be utilized for the targeted modification of DNA by providing a donor template that is flanked by homology arms identical to both DNA ends of the Cas9-induced DSB (Figure 1). The type of donor template that is used for HDR can greatly impact editing efficiency. For genetic engineering in human HSPCs, adeno-associated virus serotype 6 (AAV6) has recently been described to be an excellent vehicle for the delivery of single-stranded DNA templates9,10.
CRISPR/Cas9 genome engineering can be employed therapeutically to correct deleterious mutations11 but can also be utilized to introduce pathogenic mutations into the DNA to model cancer development12. Blood cancer, such as leukemia, develops via the sequential acquisition of somatic mutations in healthy HSPCs13,14. Early genetic events lead to a clonal proliferative advantage, resulting in clonal hematopoiesis of indeterminate potential (CHIP)15,16. Further acquisition of mutations will eventually lead to leukemic transformation and the development of the disease. Somatic mutations can be found in genes controlling self-renewal, survival, proliferation, and differentiation17.
Introducing individual mutations via genome engineering into healthy HSPCs allows for precisely modeling this stepwise leukemogenic process. The limited number of recurrent mutations found in myeloid neoplasms such as acute myeloid leukemia (AML)18,19 makes this disease particularly amenable to being recapitulated using genome engineering tools.
Somatic mutations can emerge on only one allele (monoallelic/heterozygous mutations) or on both alleles (biallelic/homozygous mutations) and can have profound effects on the gene&#39;s function, which could cause a loss-of-function (LOF) or a gain-of-function (GOF). LOF mutations lead to a reduced (if one allele is affected) or complete (if both alleles are affected) LOF of the gene, whereas GOF mutations lead to an increased activation or novel function of the gene. GOF mutations are typically heterozygous20.
Importantly, the zygosity (hetero- vs. homozygous) has major implications for the attempt to faithfully model a mutation; therefore, the targeted manipulation of only one allele of a gene is necessary to engineer heterozygous hotspot GOF mutations. Error-prone NHEJ leads to indels of different lengths21 that can lead to varying, unpredictable biological consequences. However, since NHEJ is the predominant repair program employed by cells after the introduction of a DSB, most CRISPR/Cas9 platforms currently used to manipulate HSPCs do not allow for precisely predicting the genetic outcome22,23. In contrast, the introduction of a CRISPR/Cas9-mediated double-strand break (DSBs), combined with the use of recombinant adeno-associated virus (rAAV) vector-based DNA donor templates for genome engineering via HDR, allows for the allele-specific insertion of mutations in human HSPCs11,24. The simultaneous integration of a mutant and a wild-type (WT) sequence coupled with distinct fluorescent reporters on the individual alleles can be performed to select for a heterozygous genotype (Figure 2). This strategy can be leveraged as a powerful tool to precisely characterize the effects of recurrent, leukemic, heterozygous GOF hotspot mutations on HSPC function, disease initiation, and progression.
In this article, a detailed protocol for the efficient engineering of recurrently mutated heterozygous GOF mutations in primary human HSPCs is provided. This strategy combines the use of CRISPR/Cas9 and a dual AAV6 transduction to provide WT and mutant DNA donor templates for the prospective generation of the heterozygous GOF mutation. As an example, engineering of the recurrent type 1 mutations (52 bp deletion) in the calreticulin (CALR) gene will be shown25. The heterozygous GOF mutation in exon 9 of CALR is recurrently found in myeloproliferative disorders such as essential thrombocythemia (ET) and primary myelofibrosis (PMF)26. CALR is an endoplasmic reticulum resident protein that has primarily a quality control function in the folding process of newly synthesized proteins. Its structure can be divided into three main domains: an amino (N)-terminal domain and a proline-rich P domain, which are involved in the chaperone function of the protein, and a C-domain, which is involved in calcium storage and regulation27,28. CALR mutations cause a +1 frameshift, leading to the transcription of a novel extended C-terminal end and the loss of the endoplasmic reticulum (ER)-retention signal (KDEL). Mutant CALR has been shown to bind the thrombopoietin (TPO) receptor, thereby leading to TPO-independent signaling with increased proliferation29.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64558/64558fig01v2.jpg" /> 
Figure 1: NHEJ and HDR repair. Simplified schematic representation of NHEJ and HDR repair mechanisms following the introduction of a double-stranded break in the DNA. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64558/64558fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64558/64558fig02.jpg" /> 
Figure 2: Schematic overview of biallelic HDR editing strategy. Schematic representation showing the integration of the donor templates into the targeted alleles followed by their translation into functioning mRNAs. The orange dotted boxes indicate the regions corresponding to the left homology arm (LHA) and right homology arm (RHA). The ideal size of the HAs is 400 bp each. The green dotted box represents the region corresponding to the SA sequence. The size of the SA is 150 bp. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64558/64558fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<table><tbody><tr><td>175 cm2 Cell Culture Flask, Vent Cap, TC-treated</td><td>Corning</td><td>431080</td><td></td></tr><tr><td>150 mm x 25 mm dishes</td><td>Corning</td><td>430599</td><td></td></tr><tr><td>293T</td><td>DSMZ</td><td>ACC 635</td><td>https://www.dsmz.de/collection/catalogue/details/culture/ACC-635</td></tr><tr><td>4D Nucleofector Core Unit</td><td>Lonza</td><td>-</td><td>For nucleofection of human HSPCs use the DZ-100 program.</td></tr><tr><td>4D Nucleofector X Unit</td><td>Lonza</td><td>-</td><td></td></tr><tr><td>500 ml Centrifuge Tube</td><td>Corning</td><td>431123</td><td></td></tr><tr><td>7-AAD</td><td>BD Biosciences</td><td>559925</td><td></td></tr><tr><td>AAVpro Purification Kit</td><td>Takara</td><td>6666</td><td></td></tr><tr><td>Alt-R S.p. Cas9 Nuclease V3</td><td>Integrated DNA Technologies (IDT)</td><td>1081058</td><td></td></tr><tr><td>Avanti JXN-30 Ultracentrifuge</td><td>Beckman Coulter</td><td>-</td><td></td></tr><tr><td>Benchling sgRNA design tool</td><td></td><td></td><td>Online tool for sgRNA design: http://www.benchling.com/crispr</td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Sigma-Aldrich</td><td>A7906-100G</td><td></td></tr><tr><td>C1000 Touch Thermal Cycler</td><td>Bio-Rad</td><td>-</td><td></td></tr><tr><td>Chemically modified synthetic sgRNA</td><td>Synthego</td><td></td><td>Website: https://www.synthego.com/products/crispr-kits/synthetic-sgrna Sequence for the sgRNA targeting intron 7 of CALR: 5&amp;rsquo;-CGCCTGTAATCCTCGCCCAG-3&amp;rsquo;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; An 80 nucleotide SpCas9 scaffold is added to the 20 nucleotide RNA sequence to complete the sgRNA. Chemical modifications of 2&#039;-O-Methyl are added to the first and last 3 bases and 3&#039; phosphorothioate bonds are added in the first 3 and last 2 bases.&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; *Alternatively chemically modified synthetic sgRNAs can be acquired from IDT (https://eu.idtdna.com/site/order/oligoentry/index/crispr) and Trilink (https://www.trilinkbiotech.com/custom-oligos)</td></tr><tr><td>CHOPCHOP sgRNA design tool</td><td></td><td></td><td>Online tool for sgRNA design: http://chopchop.cbu.uib.no</td></tr><tr><td>Costar 24-well Clear TC-treated Multiple Well Plates</td><td>Corning</td><td>3526</td><td></td></tr><tr><td>CRISPick sgRNA design tool</td><td></td><td></td><td>Online tool for sgRNA design: https://portals.broadinstitute.org/gppx/crispick/public</td></tr><tr><td>CRISPOR sgRNA design tool</td><td></td><td></td><td>Online tool for sgRNA design: http://crispor.tefor.net</td></tr><tr><td>ddPCR 96-Well Plates</td><td>Bio-Rad</td><td>12001925</td><td></td></tr><tr><td>ddPCR Supermix for Probes (no dUTP)</td><td>Bio-Rad</td><td>1863024</td><td></td></tr><tr><td>DG8 Cartridges for QX200/QX100 Droplet Generator&amp;nbsp;</td><td>Bio-Rad</td><td>1864008</td><td></td></tr><tr><td>DG8 Gaskets for QX200/QX100 Droplet Generator&amp;nbsp;</td><td>Bio-Rad</td><td>1863009</td><td></td></tr><tr><td>DreamTaq Green PCR Master Mix (2X)</td><td>Thermo Scientific</td><td>K1081</td><td></td></tr><tr><td>Droplet Generation Oil for Probes</td><td>Bio-Rad</td><td>1863005</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Modified Eagle Medium (DMEM) with high glucose</td><td>Sigma-Aldrich</td><td>D6429-6X500ML</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline (DPBS)</td><td>Sigma-Aldrich</td><td>D8537-500ML</td><td></td></tr><tr><td>FACSAria Fusion</td><td>BD Biosciences</td><td>-</td><td></td></tr><tr><td>Falcon 5 mL Round Bottom</td><td>Corning</td><td>352054</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS) Good Forte (heat inactivated), 500 ml</td><td>Pan Biotech</td><td>P40-47500</td><td></td></tr><tr><td>FlowJo 10.8.0</td><td>BD Biosciences&amp;nbsp;</td><td>-</td><td></td></tr><tr><td>GenAgarose L.E.</td><td>Inno-train</td><td>GX04090</td><td></td></tr><tr><td>GeneRuler 100 bp Plus DNA Ladder</td><td>Thermo Scientific</td><td>SM0321</td><td></td></tr><tr><td>Gibson Assembly Master Mix</td><td>New England Biolabs Inc. (NEB)</td><td>E2611L</td><td></td></tr><tr><td>HEK293T</td><td></td><td></td><td></td></tr><tr><td>HEPES solution</td><td>Sigma-Aldrich</td><td>H0887-100ML</td><td></td></tr><tr><td>ICE</td><td>Synthego</td><td></td><td>https://ice.synthego.com</td></tr><tr><td>IDT codon optimization tool</td><td>IDT</td><td></td><td>https://www.idtdna.com/pages/tools/codon-optimization-tool</td></tr><tr><td>IDT sgRNA design tool</td><td></td><td></td><td>Online tool for sgRNA design: https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM</td></tr><tr><td>LB Broth (Lennox) EZMix powder microbial growth medium</td><td>Sigma-Aldrich</td><td>L7658-1KG</td><td></td></tr><tr><td>LB Broth with agar (Lennox) EZMix powder microbial growth medium</td><td>Sigma-Aldrich</td><td>L7533-1KG</td><td></td></tr><tr><td>Midori Green Advance</td><td>Nippon Genetics</td><td>MG04</td><td></td></tr><tr><td>Monarch Plasmid Miniprep Kit</td><td>NEB</td><td>T1010L</td><td></td></tr><tr><td>Monarch DNA Gel Extraction Kit</td><td>NEB</td><td>T1020L</td><td></td></tr><tr><td>NEB 5-alpha Competent E. coli (High Efficiency)</td><td>NEB</td><td>C2987U</td><td></td></tr><tr><td>Nuclease-Free Water, 5X100 ml</td><td>Ambion</td><td>AM9939</td><td></td></tr><tr><td>NucleoBond Xtra Midi</td><td>Macherey-Nagel</td><td>740410</td><td></td></tr><tr><td>Opti-MEM, Reduced Serum Medium, 500 ml</td><td>Gibco</td><td>31985070</td><td></td></tr><tr><td>P3 Primary Cell 4D-Nucleofetor&amp;nbsp; X Kit L</td><td>Lonza</td><td>V4XP-3024</td><td>The Lonza Primary P3 solution is supplied as a 2.25 mL P3 Primary Cell Nucleofector Solution and 0.5 mL Supplement 1. To reconstitute, add the Supplement 1 to the P3 Primary Cell Nucleofector Solution and mix.</td></tr><tr><td>pAAV-MCS2</td><td>Addgene</td><td>46954</td><td></td></tr><tr><td>PCR Plate Heat Seal Foil, pierceable</td><td>Bio-Rad</td><td>1814040</td><td></td></tr><tr><td>pDGM6</td><td>Addgene</td><td>110660</td><td></td></tr><tr><td>Penicillin-Streptomycin (P/S)</td><td>Gibco</td><td>15140122</td><td></td></tr><tr><td>Polyethylenimine (PEI)</td><td>Polysciences</td><td>23966</td><td>Add 50 mL of PBS 4.5 pH (made with HCl) to 50 mg of PEI in a tube. Dissolve by placing the tube in a 70&amp;deg;C water bath and vortexing every 10 minutes until the solution is dissolved. After the solution has reached RT, filter sterilze through a 0.22 &amp;mu;m filter, make 1120 &amp;mu;L aliquots, and store at -80&amp;deg;C.</td></tr><tr><td>Polystyrene Test Tube, with Snap Cap</td><td></td><td></td><td></td></tr><tr><td>Primers&amp;nbsp;</td><td>Eurofins</td><td>-</td><td>Primers were ordered from Eurofins (eurofinsgenomics.eu) as unmodified salt free custom oligos. The primers were designed by using PRIMER-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/)&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; Primer 1 Fwd:&amp;nbsp;&amp;nbsp;&amp;nbsp; AAGTGATCCGTTCGCCATGAC;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; Primer 2 Rev CALR WT specific: ACGTCCTCTTCCTCGTCCTC;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp; Primer 2 Rev CALR DEL specific: CCAACCCTGGAGACACGCTTC</td></tr><tr><td>PrimeTime qPCR Primer Assay</td><td>IDT</td><td>-</td><td>PrimeTime qPCR Probe Assays (1 probe/2 primers)&amp;nbsp; that can be ordered from IDT (https://eu.idtdna.com/site/order/qpcr/assayentry). Scale: Std - qPCR Assay 500 reactions; Primer 1 Forward (5&#039;-3&#039;) : GGAACCCCTAGTGATGGAGTT; Primer 2 Reverse (5&#039;-3&#039;): CGGCCTCAGTGAGCGA; Probe (5&#039;-3&#039;): CACTCCCTCTCTGCGCGCTCG; 5&#039; Dye/3&#039; Quencher: FAM/ZEN/IBFQ; Primer to probe ratio: 3.6</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>Bio-Rad</td><td>1814000</td><td></td></tr><tr><td>QuantaSoft Software</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Quick Extract DNA Extraction Solution</td><td>Lucigen</td><td>QE0905T</td><td></td></tr><tr><td>QX200 Droplet Generator&amp;nbsp;</td><td>Bio-Rad</td><td>1864002</td><td></td></tr><tr><td>QX200 Droplet Reader</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Recombinant human Flt3-ligand</td><td>Peprotech</td><td>300-19</td><td></td></tr><tr><td>Recombinant human IL-6</td><td>Peprotech</td><td>200-06</td><td></td></tr><tr><td>Recombinant Human SCF</td><td>Peprotech</td><td>300-07</td><td></td></tr><tr><td>Recombinant Human TPO</td><td>Peprotech</td><td>300-18</td><td></td></tr><tr><td>RPMI 1640</td><td>Sigma-Aldrich</td><td>R8758-6X500ML</td><td></td></tr><tr><td>SnapGene</td><td>Dotmatics</td><td></td><td>Molecular cloning software https://www.snapgene.com *Alternatively also Benchling (https://www.benchling.com) and Geneious (https://www.geneious.com) can be used.</td></tr><tr><td>Soc outgrowth medium</td><td>NEB</td><td>B9020S</td><td></td></tr><tr><td>Sodium-butyrate</td><td>Sigma-Aldrich</td><td>B5887-1G</td><td></td></tr><tr><td>Stem Regenin 1 (SR1)</td><td>Biogems</td><td>1224999</td><td></td></tr><tr><td>StemSpan SFEM II</td><td>STEMCELL Technologies</td><td>9655</td><td></td></tr><tr><td>TAE Buffer (Tris-acetate-EDTA) 50X</td><td>Thermo Scientific&amp;nbsp;</td><td>B49</td><td></td></tr><tr><td>TIDE</td><td></td><td></td><td>http://shinyapps.datacurators.nl/tide/</td></tr><tr><td>Trypan blue 0.4%</td><td>Sigma-Aldrich</td><td>T8154-100ML</td><td></td></tr><tr><td>TrypLE (with phenol red), 500 ml</td><td>Thermo Scientific</td><td>16605-028</td><td></td></tr><tr><td>UltraPure 0.5: EDTA, pH 8.0, 100 ml</td><td>Thermo Scientific</td><td>15575-038</td><td></td></tr><tr><td>UM171</td><td>STEMCELL Technologies</td><td>72914</td><td></td></tr><tr><td>Vector Builder codon optimization tool</td><td>Vector Builder</td><td></td><td>https://en.vectorbuilder.com/tool/codon-optimization.html</td></tr></tbody></table>

engineering oncogenic heterozygous gain-of-function mutations in human hematopoietic stem and progenitor cells

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional properties such as proliferation and differentiation, thereby promoting the development of hematologic malignancies. Efficient and precise genetic manipulation of HSPCs is required to model, characterize, and better understand the functional consequences of recurrent somatic mutations. Mutations can have a deleterious effect on a gene and result in loss-of-function (LOF) or, in stark contrast, may enhance function or even lead to novel characteristics of a particular gene, termed gain-of-function (GOF). In contrast to LOF mutations, GOF mutations almost exclusively occur in a heterozygous fashion. Current genome-editing protocols do not allow for the selective targeting of individual alleles, hampering the ability to model heterozygous GOF mutations. Here, we provide a detailed protocol on how to engineer heterozygous GOF hotspot mutations in human HSPCs by combining CRISPR/Cas9-mediated homology-directed repair and recombinant AAV6 technology for efficient DNA donor template transfer. Importantly, this strategy makes use of a dual fluorescent reporter system to allow for the tracking and purification of successfully heterozygously edited HSPCs. This strategy can be employed to precisely investigate how GOF mutations affect HSPC function and their progression toward hematological malignancies.

By applying the above-described protocol, heterozygous type 1 CALR mutations were reproducibly introduced in cord-blood derived HSPCs. This mutation consists of a 52 bp deletion in exon 9 (the last exon of CALR), which results in a +1 frameshift, leading to the translation of a novel positively charged C-terminal domain26,33. To introduce the CALR mutation at the endogenous gene locus, an intronic targeting strategy upstream of exon 9 was adopted, since this would circumvent any unwanted changes in the coding sequence in cases where the Cas9-induced DSB was not repaired via the HDR mechanism. In this specific case, an sgRNA for intron 7 was designed due to the availability of high on-target and low off-target sequences in combination with favorable homology arms (lack of sequence repeats; Figure 5A).
Two donor templates were then designed and packaged in AAV6 vectors. In order to enable correct splicing from the endogenous exons to the integrated cDNA, the donor templates contain (i) a SA sequence including the 3&#39; splice-site, branch point, and the polypyrimidine tract, (ii) the codon-optimized cDNA sequence of exons 8-9, either containing the WT (CALRWT) or the mutated sequence (CALRDEL) including a stop codon, (iii) a simian virus 40 (SV40) polyA signal, (iv) a sequence encoding for a fluorescent protein under the control of the separate internal promoter, the spleen focus-forming virus (SFFV) promoter, followed by (v) a bovine growth hormone (bGH) polyA signal. The donor template containing the CALRWT cDNA was designed to contain a GFP cassette, whereas the donor template containing the CALRDEL cDNA sequence was designed to contain a BFP cassette. The whole construct was flanked by a left and right HA (Figure 5A).
Two days following transfection with the RNP complex and transduction with the rAAV6 viruses, the cells were analyzed by flow cytometry. Four main populations could be detected: (i) cells expressing neither the GFP nor the BFP, representing cells with no HDR-based genome editing, (ii) cells positive only for GFP, representing those that had integrated only the WT construct, (iii) cells positive only for BFP, representing those that had integrated only the mutated construct, and (iv) GFP and BFP double-positive cells, representing the cells that had integrated both the WT and mutated sequences (Figure 5B). In order to obtain pure populations of HSPCs bearing the heterozygous type 1 CALR mutation, the double-positive cells were sorted by flow cytometry. HSPCs in which two WT sequences were knocked-in were used as control cells (GFP+ mCherry+; Figure 5B). A valid alternative to use as control cells would be HSPCs with a biallelic integration of the fluorescent proteins in a safe harbor locus (i.e., AAVS1; not shown). Cell counting by trypan blue exclusion performed on the sorted HSPCs indicated that more than 90% of the cells were viable.
Seamless on-target integration of the constructs was confirmed by applying the in-out PCR strategy (Figure 6A). In this specific case, we performed two separate in-out PCRs, one for the knocked-in CALRWT sequence (lane 1 of the gel electrophoresis in Figure 6A) and one for the knocked-in CALRDEL sequence (lane 2 of the gel electrophoresis of Figure 6A). Sanger sequencing performed on the DNA extracted from the gel bands confirmed the correct insertion of the WT and mutated sequences in the CALRDEL/WT&#160;HSPCs (Figure 6B).
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/64558/64558fig05.jpg" /> 
Figure 5: Generation of HSPCs bearing the heterozygous CALR mutation. (A) Representative scheme depicting the editing strategy for the insertion of the heterozygous CALR mutation. The RNP complex targets the intron between exon 7 and exon 8 of the CALR gene. Two AAVs, one containing the mutated exons 8-9 and a BFP and the other containing the WT exons 8-9 and a GFP, will serve as donor repair templates and will promote the integration of the mutated sequence in one allele and the integration of the WT sequence in the remaining allele. (B) Representative flow cytometry plots depicting the expression of GFP and BFP or GFP and mCherry 48 h following the transfection and transduction of HSPCs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64558/64558fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/64558/64558fig06.jpg" /> 
Figure 6: Validation of successful heterozygous CALR mutation in HSPCs. (A) Gel electrophoresis from the products of the in-out PCR performed on genomic DNA extracted from AAV controls, CALRWT/WT, and CALRDEL/WT. A 100 bp DNA ladder was used. Abbreviation: NTC = non-template control. (B) Sanger sequencing results obtained from the in-out PCRs performed on CALRDEL/WT confirming successful integration of the WT and mutated sequences. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64558/64558fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells at JoVE.com

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Novel strategies to faithfully model somatic mutations in hematopoietic stem and progenitor cells (HSPCs) are necessary to better study hematopoietic stem cell biology and hematological malignancies. Here, a protocol to model heterozygous gain-of-function mutations in HSPCs by combining the use of CRISPR/Cas9 and dual rAAV donor transduction is described.

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional ...

engineering-oncogenic-heterozygous-gain-function-mutations-human

Nanyang Technological University

Research

JoVE Journal

Cancer Research

3.4K Views.  Medical University of Graz. Deze methode maakt het mogelijk om terugkerende leukemogene gain-of-function mutaties in primaire menselijke hematopoëtische stam- en voorlopercellen nauwkeurig te modelleren en daarbij de rol in leukemische transformatie te onderzoeken. Het grote voordeel van deze techniek is dat de crispr-cas9-gebaseerde mutatie engineering wordt gecombineerd met de introductie van een fluorescerende reporter. Dit maakt op unieke wijze de identificatie, verrijking en tracking van zuivere heterozygot-gemute...

Video: Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Next Generation Sequencing for the Detection of Actionable Mutations in Solid and Liquid Tumors

As our understanding of the driver mutations necessary for initiation and progression of cancers improves, we gain critical information on how specific molecular profiles of a tumor may predict responsiveness to therapeutic agents or provide knowledge about prognosis. At our institution a tumor genotyping program was established as part of routine clinical care, screening both hematologic and solid tumors for a wide spectrum of mutations using two next-generation sequencing (NGS) panels: a custom, 33 gene hematological malignancies panel for use with peripheral blood and bone marrow, and a commercially produced solid tumor panel for use with formalin-fixed paraffin-embedded tissue that targets 47 genes commonly mutated in cancer. Our workflow includes a pathologist review of the biopsy to ensure there is adequate amount of tumor for the assay followed by customized DNA extraction is performed on the specimen. Quality control of the specimen includes steps for quantity, quality and integrity and only after the extracted DNA passes these metrics an amplicon library is generated and sequenced. The resulting data is analyzed through an in-house bioinformatics pipeline and the variants are reviewed and interpreted for pathogenicity. Here we provide a snapshot of the utility of each panel using two clinical cases to provide insight into how a well-designed NGS workflow can contribute to optimizing clinical outcomes.

This manuscript describes clinical protocols for two next-generation sequencing panels. One panel interrogates hematologic malignancies while the other panel targets genes commonly mutated in solid tumors. Molecular classification of driver mutations in human malignancies offers valuable prognostic and predictive information.

As our understanding of the driver mutations necessary for initiation and progression of cancers improves, we gain critical information on how specific ...

Colony Forming Cell (CFC) Assay for Human Hematopoietic Cells

Human hematopoietic stem/progenitor cells are usually obtained from bone marrow, cord blood, or peripheral blood and are used to study hematopoiesis and leukemogenesis. They have the capacity to differentiate into lymphoid and myeloid lineages. The colony forming cell (CFC) assay is used to study the proliferation and differentiation pattern of hematopoietic progenitors by their ability to form colonies in a semisolid medium. The number and the morphology of the colonies formed by a fixed number of input cells provide preliminary information about the ability of progenitors to differentiate and proliferate. Cells can be harvested from individual colonies or from the whole plate to further assess their numbers and differentiation states using flow cytometry and morphologic evaluation of Giemsa-stained slides. This assay is useful for assessing myeloid but not lymphoid differentiation. The term myeloid in this context is used in its wider sense to encompass granulocytic, monocytic, erythroid, and megakaryocytic lineages.

We have used this assay to assess the effects of oncogenes on the differentiation of primary human CD34+ cells derived from peripheral blood. For this purpose cells are transduced with either control retroviral construct or a construct expressing the oncogene of interest, in this case NUP98-HOXA9. We employ a commonly used retroviral vector, MSCV-IRES-GFP, that expresses a bicistronic mRNA that produces the gene of interest and a GFP marker. Cells are pre-activated by growing in the presence of cytokines for two days prior to retroviral transduction. After another two days, GFP+ cells are isolated by fluorescence-activated cell sorting (FACS) and mixed with a methylcellulose-containing semisolid medium supplemented with cytokines and incubated till colonies appear on the surface, typically 14 days. The number and morphology of the colonies are documented. Cells are then removed from the plates, washed, counted, and subjected to flow cytometry and morphologic examination. Flow cytometry with antibodies specific to the cell surface markers expressed during hematopoiesis provides information about lineage and maturation stage. Morphological studies of individual cells under a microscope after Wright- Giemsa staining provide further information with regard to lineage and maturation. Comparison of cells transduced with control empty vector to those transduced with an oncogene reveals the effects of the oncogene on hematopoietic differentiation.

Colony Forming Cell CFC Assay for Human Hematopoietic Cells

The colony forming cell (CFC) assay is an in vitro assay in which hematopoietic progenitors form colonies in a semi-solid medium. A combination of colony morphology, cell morphology, and flow cytometry are used to assess the ability of the progenitors to proliferate and differentiate along the different hematopoietic lineages.

Human hematopoietic stem/progenitor cells are usually obtained from bone marrow, cord blood, or peripheral blood and are used to study hematopoiesis and ...

Immunology and Infection

Competitive Transplants to Evaluate Hematopoietic Stem Cell Fitness

The gold standard definition of a hematopoietic stem cell (HSC) is a cell that when transferred into an irradiated recipient will have the ability to reestablish blood cell production for the lifespan of the recipient. This protocol explains how to set up a functional assay to compare the HSC capacities of two different populations of cells, such as bone marrow from mice of two different genotypes, and how to analyze the recipient mice by flow cytometry. The protocol uses HSC equivalents rather than cell sorting for standardization and discusses the advantages and disadvantages of both approaches. We further discuss different variations to the basic protocol, including serial transplants, limiting dilution assays, homing assays and non-competitive transplants, including the advantages and preferred uses of these varied approaches. These assays are central for the study of HSC function and could be used not only for the investigation of fundamental HSC intrinsic aspects of biology but also for the development of preclinical assays for bone marrow transplant and HSC expansion in culture.

This protocol provides step-by-step guidelines for setting up competitive mouse bone marrow transplant experiments to study hematopoietic stem/progenitor cell function without prior purification of stem cells by cell sorting.

The gold standard definition of a hematopoietic stem cell (HSC) is a cell that when transferred into an irradiated recipient will have the ability to ...

Developmental Biology

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem cells are responsible for ensuring tissue homeostasis and repair throughout life, it is reasonable to hypothesize that the stem cell population is critical for preserving genomic integrity of tissues. Therefore, significant interest has arisen in assessing the impact of endogenous and environmental factors on genomic integrity in stem cells and their progeny, aiming to understand the etiology of stem-cell based diseases.
LacI transgenic mice carry a recoverable &#955;&#160;phage vector encoding the LacI reporter system, in which the LacI gene serves as the mutation reporter. The result of a mutated LacI gene is the production of &#946;-galactosidase that cleaves a chromogenic substrate, turning it blue. The LacI reporter system is carried in all cells, including stem/progenitor cells and can easily be recovered and used to subsequently infect E. coli. After incubating infected E. coli on agarose that contains the correct substrate, plaques can be scored; blue plaques indicate a mutant LacI gene, while clear plaques harbor wild-type. The frequency of blue (among clear) plaques indicates the mutant frequency in the original cell population the DNA was extracted from. Sequencing the mutant LacI gene will show the location of the mutations in the gene and the type of mutation.
The LacI transgenic mouse model is well-established as an in vivo mutagenesis assay. Moreover, the mice and the reagents for the assay are commercially available. Here we describe in detail how this model can be adapted to measure the frequency of spontaneously occurring DNA mutants in stem cell-enriched Lin-IL7R-Sca-1+cKit++(LSK) cells and other subpopulations of the hematopoietic system.

Here we describe an in vivo mutagenesis assay for small numbers of purified hematopoietic cells using the LacI transgenic mouse model.&#160;The LacI gene can be isolated to determine the frequency, location, and type of DNA mutants&#160;spontaneously arisen or after exposure to genotoxins.

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Proliferation and Differentiation of Murine Myeloid Precursor 32D/G-CSF-R Cells

Understanding of the hematopoietic stem and progenitor cell biology has important implications for regenerative medicine and the treatment of hematological pathologies. Despite the most relevant data that can be acquired using in vivo models or primary cultures, the low abundance of hematopoietic stem and progenitor cells considerably restricts the pool of suitable techniques for their investigation. Therefore, the use of cell lines allows sufficient production of biological material for the performance of screenings or assays that require large cell numbers. Here we present a detailed description, readout, and interpretation of proliferation and differentiation assays which are used for the investigation of processes involved in myelopoiesis and neutrophilic differentiation. These experiments employ the 32D/G-CSF-R cytokine dependent murine myeloid cell line, which possesses the ability to proliferate in the presence of IL-3 and differentiate in G-CSF. We provide optimized protocols for handling 32D/G-CSF-R cells and discuss major pitfalls and drawbacks that might compromise the described assays and expected results. Additionally, this article contains protocols for lentiviral and retroviral production, titration, and transduction of 32D/G-CSF-R cells. We demonstrate that genetic manipulation of these cells can be employed to successfully perform functional and molecular studies, which can complement results obtained with primary hematopoietic stem and progenitor cells or in vivo models.

Here detailed protocols for culturing the murine myeloid precursor 32D/G-CSF-R cell line, performing viral infections, and carrying out proliferation and differentiation assays are presented. This cell line is suitable for studying myeloid cell development, and the role of genes of interest in myeloid cell growth and neutrophilic differentiation.

Understanding of the hematopoietic stem and progenitor cell biology has important implications for regenerative medicine and the treatment of ...

Pan-myeloid Differentiation of Human Cord Blood Derived CD34+ Hematopoietic Stem and Progenitor Cells

Ex vivo differentiation of human hematopoietic stem cells is a widely used model for studying hematopoiesis. The protocol described here is for cytokine induced differentiation of CD34+ hematopoietic stem and progenitor cells to the four myeloid lineage cells. CD34+ cells are isolated from human umbilical cord blood and co-cultured with MS-5 stromal cells in the presence of cytokines. Immunophenotypic characterization of the stem and progenitor cells, and the differentiated myeloid lineage cells are described. Using this protocol, CD34+ cells may be incubated with small molecules or transduced with lentiviruses to express myeloid disease mutations to investigate their impact on myeloid differentiation.

Pan-myeloid Differentiation of Human Cord Blood Derived CD34+ Hematopoietic Stem and Progenitor Cells

Here, we present a protocol for immunophenotypic characterization and cytokine induced differentiation of cord blood derived CD34+ hematopoietic stem and progenitor cells to the four myeloid lineages. The applications of this protocol include investigations on the effect of myeloid disease mutations or small molecules on myeloid differentiation of the CD34+ cells.

Ex vivo differentiation of human hematopoietic stem cells is a widely used model for studying hematopoiesis. The protocol described here is for cytokine ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Intrafemoral Injection for Bone Marrow Study in Live Mice

Simplified Intrafemoral Injections Using Live Mice Allow for Continuous Bone Marrow Analysis

Despite the complexity of hematopoietic cell transplantation in humans, researchers commonly perform intravenous or intrafemoral (IF) injections in mice. In murine models, this technique has been adapted to enhance the seeding efficiency of transplanted hematopoietic stem and progenitor cells (HSPCs). This paper describes a detailed step-by-step technical procedure of IF injection and the following bone marrow (BM) aspiration in mice that allows for serial characterization of cells present in the BM. This method enables the transplantation of valuable samples with low cell numbers that are particularly difficult to engraft by intravenous injection. This procedure facilitates the creation of xenografts that are critical for pathological analysis. While it is easier to access peripheral blood (PB), the cellular composition of PB does not reflect the BM, which is the niche for HSPCs. Therefore, procedures providing access to the BM compartment are essential for studying hematopoiesis. IF injection and serial BM aspiration, as described here, allow for the prospective retrieval and characterization of cells enriched in the BM, such as HSPCs, without sacrificing the mice.

This protocol describes the intrafemoral injection of a few hematopoietic or leukemic stem cells, including gene-edited cells, in murine xenograft models, which will not only enable the quick and safe transplantation of cells but also serial analyses of the bone marrow.

Despite the complexity of hematopoietic cell transplantation in humans, researchers commonly perform intravenous or intrafemoral (IF) injections in mice. ...

Medicine

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video