Name: study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro
Uploaded: 2022-03-07T13:00:00.000+00:00
Duration: 6 min 12 s
Description: Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

We are grateful for technical support from Dr. Tz-Ling Chen. We thank the National RNAi Core Facility (Academia Sinica, Taiwan) for providing shRNA lentivirus (http://rnai.genmed.sinica.edu.tw). This work was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2320-B-002-037-MY3 and MOST 109-2320-B-002-054-MY3).

Handling of lentivirus is performed as per the regulation of the Department of Environmental Health and Safety of National Taiwan University College of Medicine.
1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)
<ol>
	<li>Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 &#181;M &#946;-estradiol.</li>
	<li>Passage the cells at a ratio of 1:10 every 3 days. 
	&#8203;NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x 10-5 M &#946;-mercaptoethanol, and 10 &#181;g/mL gentamicin. Recombinant murine FL is also commercially available.</li>
</ol>
2. Lentiviral transduction
<ol>
	<li>Plate iHSPCs at a density of 1 x 105 cells/well in 12-well plates in 1 mL of complete medium containing 100 ng/mL FL, 1 &#181;M &#946;-estradiol, and 8 &#181;g/mL polybrene. 
	NOTE: The concentration of polybrene depends on the cell types and is usually in the range of 4-8 &#181;g/mL.</li>
	<li>Add shRNA-carrying lentivirus in each well at a multiplicity of infection (MOI) of 100. 
	NOTE: The lentiviral vector is pLKO.1-Puro with a puromycin selection marker (Figure 1).The target sequences of shRNAs against LacZ, Tcf4, and Id2, respectively, are listed in the Table of Materials. The MOI is defined by the number of virions that are added per cell during infection. 
	<img alt="Equation 1" src="/files/ftp_upload/62730/62730eq01.jpg" /></li>
	<li>Spin the plates at 1,100 x g for 90 min at 37 &#176;C. 
	NOTE: Spin infection is carried out using a swing bucket rotor.</li>
	<li>Incubate the plate containing infected cells for overnight at 37 &#176;C in an incubator. 
	NOTE: If the cells are sensitive to polybrene, then refresh the cells with the complete medium without polybrene after the spin infection.</li>
	<li>Refresh cells with complete medium containing 100 ng/mL FL and 1 &#181;M &#946;-estradiol 24 h after the infection.</li>
	<li>Add 6 &#181;g/mL of puromycin to the medium to select the infected cells after an additional 24 h. 
	NOTE: Transduced lentiviral vector usually takes 48 h for expressing genes, including puromycin resistant gene. Ensure that the concentration of puromycin is optimized for each cell line.</li>
	<li>Refresh the selection medium containing 100 ng/mL FL, 1 &#181;M &#946;-estradiol, and 6 &#181;g/mL puromycin every 3 days and maintain the cells for at least one week to expand the stably transduced iHSPC cells. 
	&#8203;NOTE: Puromycin selection usually takes effect 48 h later, and the period of selection depends on cell types.</li>
</ol>
3. Measurement of knockdown efficiency by reverse transcription and real-time PCR (RT-PCR)
<ol>
	<li>Extract total RNA from 1 x 107 shLacZ, shTcf4, and shId2 stable knockdown iHSPC cells using commercial RNA extraction reagent and precipitate RNA from the aqueous layer with isopropanol, followed by washing the RNA precipitate with 75% ethanol.</li>
	<li>Dissolve the RNA (~ 5 &#181;g) with 5 &#181;L of DEPC-treated H2O and adjust the concentration to 1 &#181;g/&#181;L.</li>
	<li>Take 1-3 &#181;g of RNA, mix with DEPC-treated H2O to a final volume of 17.4 &#181;L, add 1 &#181;L of 1 unit/&#181;L RNase-free DNase I and incubate for 20 min at 37 &#176;C. 
	NOTE: This step is to digest the genomic DNA in the RNA samples.</li>
	<li>Add 1 &#181;L of 20 mM EDTA to the RNA samples, incubate at 65 &#176;C for 10 min to inactivate DNase I, and put the RNA samples immediately at 4 &#176;C.</li>
	<li>Add 11.6 &#181;L of the reaction mix containing 1 &#181;L of oligo (dT) primers (45 &#181;M), 6 &#181;L of 5x 1st strand buffer, 3 &#181;L of dNTP (2 mM), 0.6 &#181;L of RNase inhibitor (50 Unit/&#181;L) and 1 &#181;L of reverse transcriptase (200 Unit/&#181;L) to the RNA samples and incubate at 40 &#176;C for 1 h.</li>
	<li>Stop the reaction by heating at 70 &#176;C for 10 min and dilute the reaction mix with 30 &#181;L of H2O.</li>
	<li>Take 2 &#181;L of the diluted RT reaction mix as a DNA template and PCR amplify it using primers against Tcf4 or Id2 (see Table 1 for thermocycler conditions). 
	&#8203;NOTE: The primer sequences are included in the Table of Materials.</li>
</ol>
4. In vitro differentiation of the stable knockdown iHSPC cell lines
<ol>
	<li>Maintain the stable single knockdown of LacZ (shLacZ), Tcf4 (shTcf4), or Id2 (shId2) in iHSPCs in complete medium containing 100 ng/mL of FL and 1 &#181;M &#946;-estradiol.</li>
	<li>Collect shLacZ, shTcf4, and shId2 un-differentiated iHSPCs into a 15 mL tube and centrifuge for 5 min at 500 x g to pellet the cells.</li>
	<li>Discard the supernatant and add 10 mL of PBS to wash the cells. Repeat this step twice.</li>
	<li>Resuspend and seed the iHSPC cells at a density of 2 x 105 cells/mL into a 12-well plate in 1 mL of complete medium containing 100 ng/mL FL only.</li>
	<li>Add 1 mL of fresh complete medium containing 100 ng/mL FL three days later.</li>
	<li>Analyze the differentiated cells (shLacZ, shTcf4, and shId2 iHSPCs) by flow cytometry two days later.</li>
</ol>
5. Flow cytometric analysis of the differentiated DCs
<ol>
	<li>Collect the cells into 1.5 mL tubes by pipetting the cells up and down 2-3 times in the plate, and centrifuge for 5 min at 500 x g at room temperature (RT). 
	NOTE: In vitro differentiated DCs will slightly attach to the plates. Gentle pipetting will help recover DCs from the plates.</li>
	<li>Discard the supernatant and resuspend the cells in 50 &#181;L of FACS buffer. Next, add 50 &#181;L of anti-CD16/32 hybridoma supernatant and incubate for 5-10 min on ice. 
	NOTE: The Fc blocking antibody prevents nonspecific binding of antibodies to Fc receptors expressing on some myeloid cells and B cells and is commercially available through various vendors.</li>
	<li>Add fluorescent dye-conjugated antibodies (0.04 &#181;g for each antibody) directly to the cells and incubate for 15 min on ice in the dark. The antibodies used are APC/cy7 anti-mouse CD11c, FITC anti-mouse CD11b, and PE anti-mouse B220. 
	NOTE: pDCs are defined as CD11c+CD11b-B220+, and cDCs are defined as CD11c+CD11b+B220-.</li>
	<li>Wash cells with 1 mL of FACS buffer and centrifuge for 5 min at 500 x g at RT.</li>
	<li>Resuspend the cells in 100 &#181;L of FACS buffer and analyze by flow cytometry.</li>
</ol>

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

The authors have nothing to disclose.

Lentivirus-based shRNA vectors are often used for gene silencing by viral transduction into cells and permit stable integration into the host genome. However, various transduction efficiency in different cell types needs to be considered, and a number of approaches have been taken to overcome this problem. 
Polybrene is a polycationic polymer that can neutralize the charges on the cell membrane, thereby enhancing the binding of the virion to the cells during transduction20. Although it is an effective way to increase the transduction rate, it is also toxic to some cell types when adding excessive amounts. In this case, it is required to test the toxicity of polybrene and optimize the concentration in different cells. Protamine sulfate, a cationic compound, maybe an alternative approach to increase cell viability21. Moreover, refresh complete media on the same day of infection can improve the represent survival rate after transduction.
Most shRNA delivery systems have a selective marker for eliminating cells that have not been successfully infected. The lentiviral system we used contains a puromycin-resistant gene so that the infected cells could be selected after transduction. Moreover, lentivirus expressing GFP is also another option for the selection. However, there are both advantages and disadvantages to both methods. Using puromycin as a selection method is hard to directly measure the transduction efficiency unless the expression of target genes was confirmed by qPCR. But puromycin provides stress for selection to keep the foreign DNA inside the cells and maintain the knockdown phenotype. In contrast, GFP is also a selection method that does not provide stress to the cells even though the transduction efficiency can be immediately evaluated by flow cytometry. 
One of the limitations of this method is the relatively small number of cDC1 cells generated by iHSPCs in vitro19. Although iHSPCs have pDCs and cDCs potential driven by FL in vitro, most of cDC subtypes generated is cDC2s, but not cDC1s. This is likely due to the requirement of Notch signaling during in vitro cDC1 differentiation22. Therefore, co-culture with OP9-DL1 stromal cells which express the Notch ligand Delta-like 1 may restore cDC1 potential of iHSPCs, thereby improving the mechanistic studies on cDC1s. 
The application of this protocol not only for investigating the role of TFs but also for other genes, like metabolic genes likely to participate in the development of DCs or other cell types. An emerging concept highlights that DC developmental pathway is associated with different cellular metabolism23,24. Therefore, gene knockdown in DC progenitors is a powerful strategy to study metabolic regulation in response to environmental cues and determine how different metabolic pathways regulate DC differentiation by knocking down critical genes in metabolism25. On the other hand, iHSPCs have the capacity to differentiate into myeloid cells beyond DC lineages by utilizing specific differentiation factors. The use of macrophage colony-stimulating factor (M-CSF) and granulocyte-colony stimulating factor (G-CSF) results in the development of macrophages and granulocytes, respectively, from iHSPCs19. Based on the same strategy, this method could also apply to the research of myeloid cell development.
Collectively, the described protocol from gene knockdown to in vitro differentiation of iHSPCs provides a rapid and effective way to facilitate the study of DC development and answers fundamental questions of immune cell development in the future.

DCs are key regulators of innate and adaptive immunity1. DCs are mainly classified into two functionally distinct populations, namely pDCs and cDCs. Moreover, cDCs comprise two subsets, namely, type I and type II cDCs or cDC1s and cDC2s, respectively2. pDCs, expressing BST2, Siglec-H, and intermediate levels of CD11c in mice3,4, are the cells that can secrete large amounts of IFN-I during inflammation and viral infection5. Due to their robust IFN-I-producing ability, they are also suspected to play a key role in the progression of autoimmune diseases, including systemic lupus erythematosus (SLE)6. cDC1s, defined by the surface expression of XCR1, CD8a, CLEC9A, and CD103 in mice7, are specialized in the activation and polarization of cytotoxic CD8+ T cells (CTLs) through the antigen cross-presentation, thereby initiating type I immunity in response to intracellular pathogens and cancer8,9. On the other hand, cDC2s, expressing CD11b and CD172&#945; (also known as Sirp&#945;) in both humans and mice, can activate CD4+ T cells and promote type II immune response against allergen and parasites10, as well as modulate type III immunity following extracellular bacteria and microbiota recognition11,12.
Diversification of DCs is determined by a group of TFs from hematopoietic stem and progenitor cells (HSPCs) in the BM. E2-2 (encoded by Tcf4) is a master regulator for differentiation and function of pDCs13,14. In contrast, the inhibitor of DNA binding 2 (ID2) drives cDC specification and inhibits pDC development through blocking E protein activity15. Moreover, the development of cDC1s requires IRF8 and BATF3, while differentiation of cDC2s highly depends on IRF416. Recent works have explored the heterogeneity of pDCs17 and cDCs and their transcriptional regulation18. Because of the complexity of DC network, there is an unmet need to establish a platform to identify other TFs controlling the development and functionality of DCs.
Here, we used an iHSPC that was generated by expressing estrogen-regulated nuclear translocation of Hoxb8 in BM cells (also referred to as Hoxb8-FL cells)19. iHSPCs can proliferate and remain in an undifferentiated stage in the presence of &#946;-estradiol and Flt3 ligand (FL), whereas they start to differentiate into different DC types in the presence of FL upon withdrawal of &#946;-estradiol19. Based on this feature, we can knock down genes of interest at the progenitor stage, followed by examining the effect on in vitro differentiation of pDCs and cDCs. Therefore, this method is a powerful tool to discover the genes that regulate the development and function of DCs.

<table><tbody><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>APC/Cy7 anti-mouse CD11c Antibody</td><td>Biolegend</td><td>117324</td><td>(Clone: N418)</td></tr><tr><td>FITC anti-mouse/human CD11b Antibody</td><td>Biolegend</td><td>101206</td><td>(Clone: M1/70)</td></tr><tr><td>PE anti-mouse/human B220 Antibody</td><td>Biolegend</td><td>103208</td><td>(Clone: RA3-6B2)</td></tr><tr><td>&lt;strong&gt;Cell culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1.5 mL Micro tube</td><td>&amp;nbsp;ExtraGene</td><td>TUBE-170-C</td><td></td></tr><tr><td>12-well tissue culture-treated plate</td><td>Falcon</td><td>353043</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Corning</td><td>35-010-CV</td><td></td></tr><tr><td>RPMI 1640 medium</td><td>gibco</td><td>11875-085</td><td></td></tr><tr><td>&lt;strong&gt;Reagent&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&amp;beta;-estradiol</td><td>Sigma-Aldrich</td><td>E2758-250MG</td><td></td></tr><tr><td>&amp;beta;-mercaptoethanol (&amp;beta;-ME)</td><td>Sigma-Aldrich</td><td>M6250</td><td></td></tr><tr><td>FACS buffer</td><td>home-made</td><td></td><td>Formula: 1xPBS+0.5 %FBS+0.1%NaN&lt;sub&gt;3&lt;/sub&gt;</td></tr><tr><td>Flt3 ligand (FL)</td><td>home-made</td><td></td><td></td></tr><tr><td>Polybrene</td><td>Sigma-Aldrich</td><td>TR-1003-G</td><td></td></tr><tr><td>Puromycin</td><td>Invivogen</td><td>ant-pr-1</td><td></td></tr><tr><td>TRIsure</td><td>BIOLINE</td><td>BIO-38032</td><td></td></tr><tr><td>shRNA (Taregt sequence/clone ID)</td><td>Company</td><td></td><td></td></tr><tr><td>shId2&amp;nbsp; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td><td>The RNAi Consortium (TRC)</td><td></td><td></td></tr><tr><td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td><td>The RNAi Consortium (TRC)</td><td></td><td></td></tr><tr><td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td><td>The RNAi Consortium (TRC)</td><td></td><td></td></tr></tbody></table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided into conventional DCs (cDCs) and plasmacytoid DCs (pDCs). cDCs specializes in presenting antigens to and activate na&#239;ve T cells. On the other hand, pDCs can produce large quantities of type I interferons (IFN-I) during viral infection. The specification of DCs occurs at an early stage of DC progenitors in the bone marrow (BM) and is defined by a network of transcription factors (TFs). For example, cDCs highly express ID2, while pDCs highly express E2-2. Since more and more subsets of DCs are being identified, there is a growing interest in understanding specific TFs controlling DC development. Here, we establish a method to screen TFs critical for DCs differentiation in vitro by delivering lentivirus carrying short hairpin RNA (shRNA) into an immortalized hematopoietic stem and progenitor cell (iHSPCs) line. After the selection and in vitro differentiation, cDC and pDC potential of the stable knockdown cell lines are analyzed by flow cytometry. This approach provides a platform to identify genes potentially governing DC fates from progenitors in vitro.

The map of lentiviral vector pLKO.1-Puro is shown (Figure 1). After the delivery of lentivirus expressing shRNA against LacZ (a non-targeting control), Tcf4, and Id2 in iHSPCs, the knockdown efficiency confirmed by RT-qPCR revealed that the expression of Tcf4 was reduced in shTcf4 iHSPCs, compared to shLacZ iHSPCs (Figure 2A). On the other hand, the decreased expression of Id2 was also observed in shId2 iHSPCs, compared to shLacZ iHSPCs control (Figure 2B). The shLacZ,shTcf4, and shId2 iHSPCs cell lines were differentiated into pDCs and cDCs in vitro with FL. After five-day culture of shLacZ iHSPCs, the frequency of CD11c+ cells, which represent DC population7, was around 95% (Figure 3A,&#160;left panel). However, knockdown of Tcf4 or Id2 slightly decreased the generation of CD11c+ DCs (Figure 3A,&#160;middle and right panel). Moreover, further analysis of CD11c+ DCs revealed that shLacZ iHSPCs differentiated into 70% of cDCs (CD11c+CD11b+B220+) and 22% of pDCs (CD11c+CD11b-B220+) (Figure 3B,&#160;left panel). However, shTcf4 iHSPCs generated a significantly lower percentage of pDCs (4 %) than did shLacZ control (Figure 3B, middle panel). On the other hand, shId2 iHSPCs generated a significantly lower percentage of cDCs (54%) but a higher percentage of pDCs (39%) than did shLacZ control (Figure 3B,&#160;right panel). Therefore, these results suggest iHSPCs faithfully reflect the same requirement of transcription factors for controlling DC development.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62730/62730fig01.jpg" /> 
Figure 1: The construct of lentiviral vector pLKO.1-Puro. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62730/62730fig02.jpg" /> 
Figure 2: The knockdown efficiency of shTcf4 and shId2. After stable gene knockdown, RNAs were isolated from shLacZ, shTcf4, and shId2 iHSPCs and reversely transcribed into cDNA, and the expression of Tcf4 and Id2 was measured by RT-qPCR. Relative gene expression was normalized to Rpl7. A. The expression of Tcf4 in shLacZ and shTcf4 iHSPCs. B. The expression of Id2 in shLacZ and shId2 iHSPCs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62730/62730fig03.jpg" /> 
Figure 3: Knockdown of Tcf4 impairs pDC development, whereas knockdown of Id2 reduces cDC generation from iHSPCs in vitro. iHSPCs were stably transduced with shLacZ, shTcf4, and shId2-carrying lentiviruses, then in vitro differentiated into DCs with FL (100 ng/mL). After culture for 5 days, the cells were stained and analyzed by flow cytometry. A. The percentage of CD11c+ cells is shown. B. The analysis for pDCs (CD11c+B220+CD11b-), and cDCs (CD11c+B220-CD11b+) are shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR reaction</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>95&#176;C</td>
			<td>3 minutes</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95&#176;C</td>
			<td>15 seconds</td>
			<td rowspan="3">35-40</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>60&#176;C</td>
			<td>20 seconds</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72&#176;C</td>
			<td>20 seconds</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>80&#176;C</td>
			<td>20 seconds</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4&#176;C</td>
			<td>&#8734;</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 1: Thermocycler conditions for PCR.

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

study-dendritic-cell-development-short-hairpin-rna-mediated-gene

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

3.4K Views.  National Taiwan University College of Medicine. Dendritische cellen, of DC's, zijn belangrijke immuuncellen die het aangeboren en adaptieve immuunsysteem met elkaar verbinden. Hoewel DC's heterogeen zijn, helpt deze methode ons te begrijpen welke genen, inclusief transcriptiefactoren, de DC-ontwikkeling kunnen reguleren. Deze techniek biedt een eenvoudige en snelle manier om een gen te identificeren dat dc-ontwikkeling regelt vanuit hun voorloper in vitro.Onderhoud om te beginnen de vereeuwigde hematopoietische stam- en voorlopercel...

Video: Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, in the case that the KD of the protein of interest has a lethal effect on cells or the anticipated effect of the KD is time-dependent, unconditional KD methods are not appropriate. Conditional systems are more suitable in these cases and have been the subject of much interest. These include Ecdysone-inducible overexpression systems, Cytochrome P-450 induction system1, and the tetracycline regulated gene expression systems. 
The tetracycline regulated gene expression system enables reversible control over protein expression by induction of shRNA expression in the presence of tetracycline. In this protocol, we present an experimental design using functional Tet-ON system in human cancer cell lines for conditional regulation of gene expression. We then demonstrate the use of this system in the study of tumor cell-monocyte interaction.

This protocol serves as a scheme for setting up a functional Tet-ON system in cancer cell lines and its subsequent use, in particular for studying the role of tumor cell-derived proteins in recruitment of monocytes/macrophages to the tumor microenvironment.

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

Cancer Research

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genetics

Stable Knockdown of Genes Encoding Extracellular Matrix Proteins in the C2C12 Myoblast Cell Line Using Small-Hairpin (sh)RNA

Extracellular matrix (ECM) proteins are crucial for skeletal muscle development and homeostasis. The stable knockdown of genes coding for ECM proteins in C2C12 myoblasts can be applied to study the role of these proteins in skeletal muscle development. Here, we describe a protocol to deplete the ECM protein ADAMTSL2 as an example, using small-hairpin (sh) RNA in C2C12 cells. Following transfection of shRNA plasmids, stable cells were batch-selected using puromycin. We further describe the maintenance of these cell lines and the phenotypic analysis via mRNA expression, protein expression, and C2C12 differentiation. The advantages of the method are the relatively fast generation of stable C2C12 knockdown cells and the reliable differentiation of C2C12 cells into multinucleated myotubes upon depletion of serum in the cell culture medium. Differentiation of C2C12 cells can be monitored by bright field microscopy and by measuring the expression levels of canonical marker genes, such as MyoD, myogenin, or myosin heavy chain (MyHC) indicating the progression of C2C12 myoblast differentiation into myotubes. In contrast to the transient knockdown of genes with small-interfering (si) RNA, genes that are expressed later during C2C12 differentiation or during myotube maturation can be targeted more efficiently by generating C2C12 cells that stably express shRNA. Limitations of the method are a variability in the knockdown efficiencies, depending on the specific shRNA that may be overcome by using gene knockout strategies based on CRISPR/Cas9, as well as potential off-target effects of the shRNA that should be considered.

Stable Knockdown of Genes Encoding Extracellular Matrix Proteins in the C2C12 Myoblast Cell Line Using Small-Hairpin shRNA

We provide a protocol to stably knock down genes encoding extracellular matrix (ECM) proteins in C2C12 myoblasts using small-hairpin (sh) RNA. Targeting ADAMTSL2 as an example, we describe the methods for the validation of the knockdown efficiency on the mRNA, protein, and cellular level during C2C12 myoblast to myotube differentiation.

Extracellular matrix (ECM) proteins are crucial for skeletal muscle development and homeostasis. The stable knockdown of genes coding for ECM proteins in ...

Proliferation and Differentiation of Murine Myeloid Precursor 32D/G-CSF-R Cells

Understanding of the hematopoietic stem and progenitor cell biology has important implications for regenerative medicine and the treatment of hematological pathologies. Despite the most relevant data that can be acquired using in vivo models or primary cultures, the low abundance of hematopoietic stem and progenitor cells considerably restricts the pool of suitable techniques for their investigation. Therefore, the use of cell lines allows sufficient production of biological material for the performance of screenings or assays that require large cell numbers. Here we present a detailed description, readout, and interpretation of proliferation and differentiation assays which are used for the investigation of processes involved in myelopoiesis and neutrophilic differentiation. These experiments employ the 32D/G-CSF-R cytokine dependent murine myeloid cell line, which possesses the ability to proliferate in the presence of IL-3 and differentiate in G-CSF. We provide optimized protocols for handling 32D/G-CSF-R cells and discuss major pitfalls and drawbacks that might compromise the described assays and expected results. Additionally, this article contains protocols for lentiviral and retroviral production, titration, and transduction of 32D/G-CSF-R cells. We demonstrate that genetic manipulation of these cells can be employed to successfully perform functional and molecular studies, which can complement results obtained with primary hematopoietic stem and progenitor cells or in vivo models.

Here detailed protocols for culturing the murine myeloid precursor 32D/G-CSF-R cell line, performing viral infections, and carrying out proliferation and differentiation assays are presented. This cell line is suitable for studying myeloid cell development, and the role of genes of interest in myeloid cell growth and neutrophilic differentiation.

Understanding of the hematopoietic stem and progenitor cell biology has important implications for regenerative medicine and the treatment of ...

Developmental Biology

In Vitro Generation of Murine Plasmacytoid Dendritic Cells from Common Lymphoid Progenitors using the AC-6 Feeder System

Plasmacytoid dendritic cells (pDCs) are powerful type I interferon (IFN-I) producing cells that are activated in response to infection or during inflammatory responses. Unfortunately, study of pDC function is hindered by their low frequency in lymphoid organs, and existing methods for in vitro DC generation predominantly favor the production of cDCs over pDCs. Here we present a unique approach to efficiently generate pDCs from common lymphoid progenitors (CLPs) in vitro. Specifically, the protocol described details how to purify CLPs from bone marrow and generate pDCs by coculturing with &#947;-irradiated AC-6 feeder cells in the presence of Flt3 ligand. A unique characteristic of this culture system is that the CLPs migrate underneath the AC-6 cells and become cobblestone area-forming cells, a critical step for expanding pDCs. Morphologically distinct DCs, namely pDCs and cDCs, were generated after approximately 2 weeks with a composition of 70-90% pDCs under optimal conditions. Typically, the number of pDCs generated by this method is roughly 100-fold of the number of CLPs seeded. Therefore, this is a novel system with which to robustly generate the large numbers of pDCs required to facilitate further studies into the development and function of these cells.

In Vitro Generation of Murine Plasmacytoid Dendritic Cells from Common Lymphoid Progenitors using the AC-6 Feeder System

In this study we present an in vitro culture system that can efficiently generate pDCs by co-culturing common lymphoid progenitors with AC-6 feeder cells in the presence of Flt3 ligand.

Plasmacytoid dendritic cells (pDCs) are powerful type I interferon (IFN-I) producing cells that are activated in response to infection or during ...

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

Erythropoiesis is a commonly used model system to study cell differentiation. During erythropoiesis, pluripotent adult human hematopoietic stem cells (HSCs) differentiate into oligopotent progenitors, committed precursors and mature red blood cells 1. This process is regulated for a large part at the level of gene expression, whereby specific transcription factors activate lineage-specific genes while concomitantly repressing genes that are specific to other cell types 2. Studies on transcription factors regulating erythropoiesis are often performed using human and murine cell lines that represent, to some extent, erythroid cells at given stages of differentiation 3-5. However transformed cell lines can only partially mimic erythroid cells and most importantly they do not allow one to comprehensibly study the dynamic changes that occur as cells progress through many stages towards their final erythroid fate. Therefore, a current challenge remains the development of a protocol to obtain relatively homogenous populations of primary HSCs and erythroid cells at various stages of differentiation in quantities that are sufficient to perform genomics and proteomics experiments.
Here we describe an ex vivo cell culture protocol to induce erythroid differentiation from human hematopoietic stem/progenitor cells that have been isolated from either cord blood, bone marrow, or adult peripheral blood mobilized with G-CSF (leukapheresis). This culture system, initially developed by the Douay laboratory 6, uses cytokines and co-culture on mesenchymal cells to mimic the bone marrow microenvironment. Using this ex vivo differentiation protocol, we observe a strong amplification of erythroid progenitors, an induction of differentiation exclusively towards the erythroid lineage and a complete maturation to the stage of enucleated red blood cells. Thus, this system provides an opportunity to study the molecular mechanism of transcriptional regulation as hematopoietic stem cells progress along the erythroid lineage. 
Studying erythropoiesis at the transcriptional level also requires the ability to over-express or knockdown specific factors in primary erythroid cells. For this purpose, we use a lentivirus-mediated gene delivery system that allows for the efficient infection of both dividing and non-dividing cells 7. Here we show that we are able to efficiently knockdown the transcription factor TAL1 in primary human erythroid cells. In addition, GFP expression demonstrates an efficiency of lentiviral infection close to 90%. Thus, our protocol provides a highly useful system for characterization of the regulatory network of transcription factors that control erythropoiesis.

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

An ex vivo protocol to generate mature human red blood cells from hematopoietic stem/progenitors is described. Additionally we describe an efficient lentiviral-delivery method to knockdown the transcription factor TAL1 in primary erythroid cells. The efficiency of lentivirus mediated gene delivery is demonstrated using GFP expressing viruses.

Erythropoiesis is a commonly used model system to study cell differentiation. During erythropoiesis, pluripotent adult human hematopoietic stem cells ...

Biology

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Retroviral Infection of Murine Embryonic Stem Cell Derived Embryoid Body Cells for Analysis of Hematopoietic Differentiation

Embryonic stem cells (ESCs) are an outstanding model for elucidating the molecular mechanisms of cellular differentiation. They are especially useful for investigating the development of early hematopoietic progenitor cells (HPCs). Gene expression in ESCs can be manipulated by several techniques that allow the role for individual molecules in development to be determined. One difficulty is that expression of specific genes often has different phenotypic effects dependent on their temporal expression. This problem can be circumvented by the generation of ESCs that inducibly express a gene of interest using technology such as the doxycycline-inducible transgene system. However, generation of these inducible cell lines is costly and time consuming. Described here is a method for disaggregating ESC-derived embryoid bodies (EBs) into single cell suspensions, retrovirally infecting the cell suspensions, and then reforming the EBs by hanging drop. Downstream differentiation is then evaluated by flow cytometry. Using this protocol, it was demonstrated that exogenous expression of a microRNA gene at the beginning of ESC differentiation blocks HPC generation. However, when expressed in EB derived cells after nascent mesoderm is produced, the microRNA gene enhances hematopoietic differentiation. This method is useful for investigating the role of genes after specific germ layer tissue is derived.

Manipulating temporal gene expression in differentiating embryonic stem cells (ESCs) can be achieved using inducible gene systems. However, generation of these cell lines is costly and time consuming. This protocol achieves rapid expression of a transgene in differentiating ES-derived cells and subsequent analysis of downstream hematopoietic differentiation.

Embryonic stem cells (ESCs) are an outstanding model for elucidating the molecular mechanisms of cellular differentiation. They are especially useful for ...

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video