Name: directed differentiation of hemogenic endothelial cells from human pluripotent stem cells
Uploaded: 2021-03-31T14:00:00.000+00:00
Duration: 4 min 23 s
Description: Watch this Scientific Journal Video about Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells at JoVE.com

This work was partially supported by NIH grants HL128064 and U2EB017103. Further support was provided by CT Innovations 15-RMB-YALE-04 grant.

<ol>
	<li>Giacomelli, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+cardiac+microtissues+composed+of+cardiomyocytes+and+endothelial+cells+co-differentiated+from+human+pluripotent+stem+cells.">Three-dimensional cardiac microtissues composed of cardiomyocytes and endothelial cells co-differentiated from human pluripotent stem cells.</a> Development. 144 (6), 1008-1017 (2017).</li><li>Wu, J., Wu, Z., Xue, Z., Li, H., Liu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PHBV/bioglass+composite+scaffolds+with+co-cultures+of+endothelial+cells+and+bone+marrow+stromal+cells+improve+vascularization+and+osteogenesis+for+bone+tissue+engineering.">PHBV/bioglass composite scaffolds with co-cultures of endothelial cells and bone marrow stromal cells improve vascularization and osteogenesis for bone tissue engineering.</a> RSC Advances. 7 (36), 22197-22207 (2017).</li><li>Lee, H., Chung, M., Jeon, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microvasculature:+An+essential+component+for+organ-on-chip+systems.">Microvasculature: An essential component for organ-on-chip systems.</a> MRS Bulletin. 39 (1), 51-59 (2014).</li><li>Gritz, E., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+and+function+of+hemogenic+endothelium+during+embryogenesis.">Specification and function of hemogenic endothelium during embryogenesis.</a> Cellular and Molecular Life Sciences. 73 (8), 1547-1567 (2016).</li><li>Williams, I. M., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+endothelial+cells+from+human+pluripotent+stem+cells:+Methods,+considerations,+and+applications.">Generation of endothelial cells from human pluripotent stem cells: Methods, considerations, and applications.</a> Arteriosclerosis, Thrombosis, and Vascular Biology. 39 (7), 1317-1329 (2019).</li><li>Olmer, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+human+pluripotent+stem+cells+into+functional+endothelial+cells+in+scalable+suspension+culture.">Differentiation of human pluripotent stem cells into functional endothelial cells in scalable suspension culture.</a> Stem Cell Reports. 10 (5), 1657-1672 (2018).</li><li>Cossu, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lancet+Commission:+Stem+cells+and+regenerative+medicine.">Lancet Commission: Stem cells and regenerative medicine.</a> The Lancet. 391 (10123), 883-910 (2018).</li><li>Fox, I. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+differentiated+pluripotent+stem+cells+in+replacement+therapy+for+treating+disease.">Use of differentiated pluripotent stem cells in replacement therapy for treating disease.</a> Science. 345 (6199), 1247391 (2014).</li><li>Mahla, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cells+applications+in+regenerative+medicine+and+disease+therapeutics.">Stem cells applications in regenerative medicine and disease therapeutics.</a> International Journal of Cell Biology. 2016, 1-24 (2016).</li><li>Ebert, A. D., Liang, P., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cells+as+a+disease+modeling+and+drug+screening+platform.">Induced pluripotent stem cells as a disease modeling and drug screening platform.</a> Journal of Cardiovascular Pharmacology. 60 (4), 408-416 (2012).</li><li>Rowe, R. G., Daley, G. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cells+in+disease+modelling+and+drug+discovery.">Induced pluripotent stem cells in disease modelling and drug discovery.</a> Nature Reviews Genetics. 20 (7), 377-388 (2019).</li><li>Liu, C., Oikonomopoulos, A., Sayed, N., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+human+diseases+with+induced+pluripotent+stem+cells:+from+2D+to+3D+and+beyond.">Modeling human diseases with induced pluripotent stem cells: from 2D to 3D and beyond.</a> Development. 145 (5), (2018).</li><li>Wnorowski, A., Yang, H., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress,+obstacles,+and+limitations+in+the+use+of+stem+cells+in+organ-on-a-chip+models.">Progress, obstacles, and limitations in the use of stem cells in organ-on-a-chip models.</a> Advanced Drug Delivery Reviews. 140, 3-11 (2019).</li><li>Ramme, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autologous+induced+pluripotent+stem+cell-derived+four-organ-chip.">Autologous induced pluripotent stem cell-derived four-organ-chip.</a> Future Science OA. 5 (8), 1-12 (2019).</li><li>Ronaldson-Bouchard, K., Vunjak-Novakovic, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organs-on-a-Chip:+A+fast+track+for+engineered+human+tissues+in+drug+development.">Organs-on-a-Chip: A fast track for engineered human tissues in drug development.</a> Cell Stem Cell. 22 (3), 310-324 (2018).</li><li>Kane, N. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+endothelial+cells+from+human+embryonic+stem+cells+by+directed+differentiation:+analysis+of+microrna+and+angiogenesis+in+vitro+and+in+vivo.">Derivation of endothelial cells from human embryonic stem cells by directed differentiation: analysis of microrna and angiogenesis in vitro and in vivo.</a> Arteriosclerosis, Thrombosis, and Vascular Biology. 30 (7), 1389-1397 (2010).</li><li>Costa, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+endothelial+cells+from+human+embryonic+stem+cells+in+fully+defined+medium+enables+identification+of+lysophosphatidic+acid+and+platelet+activating+factor+as+regulators+of+eNOS+localization.">Derivation of endothelial cells from human embryonic stem cells in fully defined medium enables identification of lysophosphatidic acid and platelet activating factor as regulators of eNOS localization.</a> Stem Cell Research. 10 (1), 103-117 (2013).</li><li>Nguyen, M. T. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+human+embryonic+stem+cells+to+endothelial+progenitor+cells+on+laminins+in+defined+and+xeno-free+systems.">Differentiation of human embryonic stem cells to endothelial progenitor cells on laminins in defined and xeno-free systems.</a> Stem Cell Reports. 7 (4), 802-816 (2016).</li><li>Ikuno, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+and+robust+differentiation+of+endothelial+cells+from+human+induced+pluripotent+stem+cells+via+lineage+control+with+VEGF+and+cyclic+AMP.">Efficient and robust differentiation of endothelial cells from human induced pluripotent stem cells via lineage control with VEGF and cyclic AMP.</a> PLOS One. 12 (3), 0173271 (2017).</li><li>Aoki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+differentiation+and+purification+of+human+induced+pluripotent+stem+cell-derived+endothelial+progenitor+cells+and+expansion+with+the+use+of+inhibitors+of+ROCK,+TGF-B,+and+GSK3B.">Efficient differentiation and purification of human induced pluripotent stem cell-derived endothelial progenitor cells and expansion with the use of inhibitors of ROCK, TGF-B, and GSK3B.</a> Heliyon. 6 (3), 03493 (2020).</li><li>Lian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+differentiation+of+human+pluripotent+stem+cells+to+endothelial+progenitors+via+small-molecule+activation+of+Wnt+signaling.">Efficient differentiation of human pluripotent stem cells to endothelial progenitors via small-molecule activation of Wnt signaling.</a> Stem Cell Reports. 3 (5), 804-816 (2014).</li><li>Orlova, V. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation,+expansion+and+functional+analysis+of+endothelial+cells+and+pericytes+derived+from+human+pluripotent+stem+cells.">Generation, expansion and functional analysis of endothelial cells and pericytes derived from human pluripotent stem cells.</a> Nature Protocols. 9 (6), 1514-1531 (2014).</li><li>Kusuma, S., Gerecht, S., Turksen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+endothelial+cells+and+pericytes+from+human+pluripotent+stem+cells.">Derivation of endothelial cells and pericytes from human pluripotent stem cells.</a> Human Embryonic Stem Cell Protocols. , 213-222 (2014).</li><li>Bao, X., Lian, X., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+endothelial+progenitor+differentiation+from+human+pluripotent+stem+cells+via+wnt+activation+under+defined+conditions.">Directed endothelial progenitor differentiation from human pluripotent stem cells via wnt activation under defined conditions.</a> Methods in Molecular Biology. 1481, 183-196 (2016).</li><li>Xu, M., He, J., Zhang, C., Xu, J., Wang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+derivation+of+endothelial+lineages+from+human+stem+cells.">Strategies for derivation of endothelial lineages from human stem cells.</a> Stem Cell Research &amp; Therapy. 10 (1), 200 (2019).</li><li>Arora, S., Yim, E. K. F., Toh, Y. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+specification+of+pluripotent+stem+cell+derived+endothelial+cells+toward+arterial+and+venous+subtypes.">Environmental specification of pluripotent stem cell derived endothelial cells toward arterial and venous subtypes.</a> Frontiers in Bioengineering and Biotechnology. 7, 143 (2019).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communications. 8 (1), 2149 (2017).</li><li>Dalton, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linking+the+cell+cycle+to+cell+fate+decisions.">Linking the cell cycle to cell fate decisions.</a> Trends in Cell Biology. 25 (10), 592-600 (2015).</li><li>Wolf, K., Hu, H., Isaji, T., Dardik, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+identity+of+arteries,+veins,+and+lymphatics.">Molecular identity of arteries, veins, and lymphatics.</a> Journal of Vascular Surgery. 69 (1), 253-262 (2019).</li><li>Rocha, S. F., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+differentiation+and+specialization+of+vascular+beds.">Molecular differentiation and specialization of vascular beds.</a> Angiogenesis. 12 (2), 139-147 (2009).</li><li>Goldie, L. C., Lucitti, J. L., Dickinson, M. E., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+signaling+directing+the+formation+and+function+of+hemogenic+endothelium+during+murine+embryogenesis.">Cell signaling directing the formation and function of hemogenic endothelium during murine embryogenesis.</a> Blood. 112 (8), 3194-3204 (2008).</li><li>Chanda, B., Ditadi, A., Iscove, N. N., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoic+acid+signaling+is+essential+for+embryonic+hematopoietic+stem+cell+development.">Retinoic acid signaling is essential for embryonic hematopoietic stem cell development.</a> Cell. 155 (1), 215-227 (2013).</li><li>Marcelo, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemogenic+endothelial+cell+specification+requires+c-kit,+notch+signaling,+and+p27-mediated+cell-cycle+control.">Hemogenic endothelial cell specification requires c-kit, notch signaling, and p27-mediated cell-cycle control.</a> Developmental Cell. 27 (5), 504-515 (2013).</li><li>Dejana, E., Hirschi, K. K., Simons, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+endothelial+cell+plasticity.">The molecular basis of endothelial cell plasticity.</a> Nature Communications. 8 (1), 14361 (2017).</li><li>Ottersbach, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial-to-haematopoietic+transition:+an+update+on+the+process+of+making+blood.">Endothelial-to-haematopoietic transition: an update on the process of making blood.</a> Biochemical Society Transactions. 47 (2), 591-601 (2019).</li><li>Pauklin, S., Vallier, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cycle+state+of+stem+cells+determines+cell+fate+propensity.">The cell-cycle state of stem cells determines cell fate propensity.</a> Cell. 155 (1), 135-147 (2013).</li><li>Qiu, J., Nordling, S., Vasavada, H. H., Butcher, E. C., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoic+acid+promotes+endothelial+cell+cycle+early+g1+state+to+enable+human+hemogenic+endothelial+cell+specification.">Retinoic acid promotes endothelial cell cycle early g1 state to enable human hemogenic endothelial cell specification.</a> Cell Reports. 33 (9), 108465 (2020).</li><li>Sriram, G., Tan, J. Y., Islam, I., Rufaihah, A. J., Cao, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+differentiation+of+human+embryonic+stem+cells+to+arterial+and+venous+endothelial+cells+under+feeder-+and+serum-free+conditions.">Efficient differentiation of human embryonic stem cells to arterial and venous endothelial cells under feeder- and serum-free conditions.</a> Stem Cell Research &amp; Therapy. 6 (1), 261 (2015).</li><li>Ohta, R., Sugimura, R., Niwa, A., Saito, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemogenic+endothelium+differentiation+from+human+pluripotent+stem+cells+in+a+feeder-+and+xeno-free+defined+condition.">Hemogenic endothelium differentiation from human pluripotent stem cells in a feeder- and xeno-free defined condition.</a> Journal of Visualized Experiments: JoVE. (148), e59823 (2019).</li><li>Galat, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine-free+directed+differentiation+of+human+pluripotent+stem+cells+efficiently+produces+hemogenic+endothelium+with+lymphoid+potential.">Cytokine-free directed differentiation of human pluripotent stem cells efficiently produces hemogenic endothelium with lymphoid potential.</a> Stem Cell Research &amp; Therapy. 8 (1), 67 (2017).</li><li>Sidney, L. E., Branch, M. J., Dunphy, S. E., Dua, H. S., Hopkinson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+Evidence+for+CD34+as+a+common+marker+for+diverse+progenitors.">Concise review: Evidence for CD34 as a common marker for diverse progenitors.</a> Stem Cells. 32 (6), 1380-1389 (2014).</li></ol>

The author has nothing to disclose.

Herein, the steps for producing hemogenic endothelial cells from human embryonic stem cells in approximately 1 week using a murine feeder- and serum-free 2D culture system (Figure 1) are outlined. This protocol expands on a method described by Sriram et al. (2015) to obtain primordial ECs38. The primordial nature and specification potential of the CD31+ CD45- ECs is demonstrated by culturing these cells on DLL4-coated plates and observing gene expression changes consistent with arterial specification (Figure 3). Additionally, the gain of arterial identity is associated with late G1 cell cycle arrest (Figure 3), which is consistent with previous studies27. After culturing primordial ECs for an additional 3 days in the presence of 0.5 &#956;M RA, 25 ng/mL BMP4, and 50 ng/mL VEGF-A, it was possible to generate and FACS-isolate hemogenic ECs (Figure 2) that are capable of giving rise to CFU-erythroid, BFU-erythroid, CFU-granulocyte/macrophage, and CFU-granulocyte, erythrocyte, macrophage, and megakaryocyte colonies (Figure 4). Using this method in a recently published study, gene expression changes over an 8-day time period consistent with loss of pluripotency, primitive streak, and mesoderm induction, acquisition of endothelial cell identity, and finally hematopoietic identity were observed37. Furthermore, RA treatment induced early G1 cell cycle arrest to enable hemogenic EC specification37.
Recently, Ohta et al. (2019) described a protocol for the differentiation of hemogenic ECs from hPSCs39. However, the protocol described above offers significant advantages: 1) this method does not require the formation of spheroids; 2) this protocol utilizes a standard 37 &#176;C, 5% CO2 incubator rather than a hypoxic incubator, eliminating the need for dedicated specialty equipment; and 3) this protocol utilizes only one medium (pluripotent stem cell differentiation medium supplemented with PFHM), a cost-saving advantage, whereas the Ohta protocol requires two mediums for induction. Another recently published study by Galat et al. (2017) described a protocol in which CHIR99021 induction was utilized to generate a population of CD34+ hemogenic endothelial cells40. These cells also expressed CD31 and were capable of giving rise to endothelial cells when cultured under monolayer conditions or&#160;cells expressing myeloid and lymphoid markers after co-culturing with OP9 or OP9-DLL4 cells, respectively, in the presence of additional cytokines. The requirement for additional co-culture could lead to potential contamination of desired cell populations with murine cells. Additionally, although Ohta et al. and Galat et al. utilized a hemogenic induction period that was shorter than the one described here (4 days and 5 days, respectively vs. 8 days), both defined hemogenic ECs as CD34+, whereas this protocol utilized a more stringent definition: CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. While CD34 is recognized as a marker of hematopoietic cells, it is also expressed by other non-hematopoietic cell types, such as mesenchymal stromal cells and endothelial cells41. The definition of hemogenic ECs in this protocol (CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-) is therefore more rigorous and represents a more defined population.
One limitation to the use of hESCs or hiPSCs in therapeutic applications is the large number of cells required, and standard 2D derivation methods are primarily restricted to small-scale differentiations. Utilizing hiPSC lines, Olmer et al. (2018) demonstrated the feasibility of scaling up production of functional CD31+ ECs that expressed both arterial (DLL4) and venous (EPHB4) cell markers utilizing either suspension culture or a stirred-tank bioreactor6. Importantly, they showed that they were able to obtain 1.18 x 107 CD31+ ECs that co-express CD34 and KDR from a single flask containing 20 mL suspension culture. In order to obtain the requisite 3 x 108 ECs necessary for the majority of therapeutic applications, just over two 500 mL flasks would be required6. Future experiments should explore the application of scaling techniques to the protocol presented here for large-scale production of hemogenic ECs.

Endothelial cells (ECs) are a heterogeneous population of cells that perform multiple functions throughout the human body and in engineered tissues. In addition to supporting and regulating other cell types (i.e., cardiomyocytes1, osteoblastic cells2), these functions include forming a selective barrier between blood and tissues and assisting in tissue formation3. Differentiation of mature ECs during normal development requires diverse signaling pathways. Primordial ECs are derived from mesoderm progenitors, and are then specified toward mature arterial, venous, capillary and lymphatic phenotypes4. Additionally, a small subset of ECs in the extraembryonic yolk sac and embryonic Aorta-Gonad-Mesonephros (AGM) region are also specified to become hemogenic ECs, which give rise to hematopoietic stem and progenitor cells (HSPCs) that migrate to the fetal liver and fetal bone marrow, where they remain postnatally and generate all blood cell types throughout life4. The diverse range of EC phenotypes is essential for all tissue development and maintenance.
Thus, ECs and their derivatives are critical components of studies aimed at modeling, and elucidating mechanisms of, human development and/or disease, as well as regenerative medicine and tissue engineering applications5,6,7,8. However, the main limitation for these types of studies is the lack of availability of primary human ECs in the quantity required. It has been estimated that a minimum of 3 x 108 ECs would be required for the majority of therapeutic applications6. To solve this problem, the use of human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) has been proposed due to their diverse lineage potential and their ability to generate large numbers of progeny6,9.
Indeed, the usefulness of cells derived from hESCs or hiPSCs has been demonstrated in multiple studies focused on disease modeling and drug screening10,11,12. Organ-on-a-Chip (OOC) technology has been used to more faithfully recapitulate the physiology of the human body by integrating cells and tissues into three-dimensional scaffolds. Furthermore, connection of multiple individual OOCs (a so-called body- or human-on-a-chip, BOC/HOC) can be accomplished via microfluidics to allow for crosstalk between the organs of interest13,14,15. Supporting tissues, such as the vasculature, are critical components of OOCs and BOC/HOCs; incorporating vasculature allows for the transport of nutrients, oxygen, and paracrine factors throughout the tissues, thereby promoting the requisite tissue-specific microenvironment3,12. Thus, methods for deriving mature human ECs, such as arterial, venous, lymphatic, and hemogenic ECs, are crucial to advancing these tissue engineering approaches.
Multiple protocols have been published detailing steps for the derivation of human primordial or progenitor ECs from hESCs or hiPSCs5,16,17,18,19,20,21,22,23,24,25,26. Many of these protocols rely on embryoid body (EB) formation or co-culture of ESCs/iPSCs with a murine feeder layer of stromal cells. These strategies tend to be difficult and time consuming, with low EC yields and/or contamination of human ECs with murine cells. Protocols that rely strictly on 2D culture without the use of stromal cells often require long inductions, utilize complex combinations of growth factors and/or inhibitors for induction, have extended expansion periods following cell separation, or a combination of these factors. Advancing knowledge of signaling pathways and factors involved in the derivation of mature EC types in vivo provides the groundwork for a straightforward and robust in vitro differentiation protocol.
Previously, key roles for Notch and Retinoic Acid (RA) signaling pathways in the specification of murine arterial and hemogenic ECs, respectively, during development were identified. The Notch signaling pathway plays multiple roles in the specification and maintenance of the arterial EC phenotype. Work using the murine retinal vascularization model identified a pathway in which fluid shear stress induces a Notch-Cx37-p27 signaling axis, promoting G1 cell cycle arrest, which enables arterial EC specification27. Cell cycle states have been hypothesized to play a role in cell fate decisions by providing distinct windows of opportunity in which cells are receptive to certain signals that can induce gene expression and phenotypic changes28. This Notch-mediated G1 arrest enabled the expression of genes enriched in arterial ECs, including ephrinB2, Cx40, DLL4, Notch1, and Notch 4 (reviewed in29,30). It has also been shown that hemogenic EC specification is promoted in vivo via RA signaling31,32. Additional studies identified that, downstream of RA signaling, expression of c-Kit and Notch upregulate p27, which enables hemogenic specification in the murine yolk sac and AGM33. Murine hemogenic ECs can be minimally identified by expression of both endothelial (i.e., CD31, KDR) and hematopoietic (i.e., c-Kit, CD34) markers4. Finally, hemogenic ECs undergo an endothelial-to-hematopoietic transition (EHT) to form HSPCs, which can give rise to all blood cell types4,34,35.
Recent work tested whether this same signaling hierarchy can promote human hemogenic EC specification. To do so, a serum- and feeder-free 2D culture protocol to derive hemogenic ECs from hESCs was developed, and these hemogenic ECs were characterized on a single cell level as CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. This study also took advantage of the Fluorescent Ubiquitination Cell Cycle Indicator (FUCCI) reporter, which identifies different cell cycle states, using H9-hESCs that express the FUCCI reporter construct (H9-FUCCI-hESC)36. In studies with these cells, it was demonstrated that RA promotes early G1 cell cycle arrest in ECs, and early G1 state enables hemogenic specification in vitro37. Herein, a detailed protocol for the differentiation of these human hemogenic endothelial cells and assays confirming their identity are provided. This straightforward method provides a useful means of generating this specialized subset of ECs for future studies of mechanisms of human blood cell development.

<table><tbody><tr><td>15 cm dishes</td><td>Corning</td><td>430599</td><td>tissue culture treated</td></tr><tr><td>35 mm dishes</td><td>Corning</td><td>430165</td><td>tissue culture treated</td></tr><tr><td>6-well plates</td><td>Corning</td><td>3516</td><td>tissue culture treated</td></tr><tr><td>Antimicrobial reagent&lt;br/&gt; Brand Name: Normocin</td><td>Invitrogen</td><td>ant-nr-1</td><td></td></tr><tr><td>bFGF</td><td>R&amp;amp;D systems</td><td>233-FB-025</td><td>use at 50 ng/mL</td></tr><tr><td>BMP4</td><td>BioLegend</td><td>595202</td><td>use at 25 ng/mL</td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-1</td><td></td></tr><tr><td>Cell Detatchment Solution&lt;br/&gt; Brand Name: Accutase</td><td>Stemcell Technologies</td><td>7920</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)</td><td>Sigma Aldrich</td><td>D2650-100mL</td><td></td></tr><tr><td>Dispase</td><td>Stemcell Technologies</td><td>7913</td><td></td></tr><tr><td>DLL4</td><td>R&amp;amp;D systems</td><td>1506-D4/CF</td><td>recombinant human; use at 10 &amp;mu;g/mL</td></tr><tr><td>DMEM:F12</td><td>Gibco</td><td>11320-033</td><td></td></tr><tr><td>Dulbecco&#039;s Phosphate Buffered Saline (PBS)</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>Endothelial cell growth medium&lt;br/&gt; Brand Name: EGM-2 Endothelial Cell Growth Medium-2 BulletKit (EGM-2)</td><td>Lonza</td><td>CC-3162</td><td></td></tr><tr><td>FACS tubes</td><td>Corning</td><td>352235</td><td>polystyrene round bottom with filter cap</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Gemini Bio</td><td>100-106</td><td></td></tr><tr><td>Fibronectin</td><td>ThermoFisher Scientific</td><td>33016015</td><td>use at 4 &amp;mu;g/cm&lt;sup&gt;2&lt;/sup&gt;</td></tr><tr><td>GSK3i/CHIR99021</td><td>Stemgent</td><td>04-0004-02</td><td>10 mM stock; use at 5 &amp;mu;M</td></tr><tr><td>Hanks Balanced Salt Solution (HBSS)</td><td>Gibco</td><td>14175-095</td><td></td></tr><tr><td>Hydrochloric Acid (HCl)</td><td>Fisher Scientific</td><td>A144S-500</td><td></td></tr><tr><td>Matrix protein&amp;nbsp;&lt;br/&gt; Brand Name: Matrigel</td><td>Corning</td><td>356230</td><td>Growth factor reduced. Refer to the Certificate of Analysis for the lot to determine the protein (Matrigel) concentration. This concentration is required to calculate the volume of Matrigel that contains 1 mg of protein.</td></tr><tr><td>Methylcellulose-based medium&lt;br/&gt; Brand Name: MethoCult H4435 Enriched</td><td>Stemcell Technologies</td><td>4435</td><td></td></tr><tr><td>Pluripotent stem cell differentiation medium&lt;br/&gt; Brand Name: STEMdiff APEL 2</td><td>Stemcell Technologies</td><td>5270</td><td></td></tr><tr><td>Pluripotent stem cells: H1, H9, H9-FUCCI</td><td>WiCell</td><td>WA09 (H9), WA01 (H1)</td><td>human; H9-FUCCI were obtained from Dr. Ludovic Vallier&#039;s lab at Cambridge Stem Cell Institute</td></tr><tr><td>Protein-Free Hybridoma Medium (PFMH)</td><td>Gibco</td><td>12040077</td><td></td></tr><tr><td>Retinoic Acid</td><td>Sigma Aldrich</td><td>R2625-50mg</td><td>use at 0.5 &amp;mu;M</td></tr><tr><td>Reverse transcription master mix&lt;br/&gt; Brand Name: iScript Reverse Transcription Supermix</td><td>BioRad</td><td>1708840</td><td></td></tr><tr><td>RNA extraction kit&lt;br/&gt; Brand Name: RNeasy Mini Kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>Sodium Hydroxide (NaOH)</td><td>Fisher Scientific</td><td>SS255-1</td><td></td></tr><tr><td>Stem cell growth medium&lt;br/&gt; Brand Name: mTeSR1</td><td>Stemcell Technologies</td><td>85850</td><td></td></tr><tr><td>SYBR Green master mix&lt;br/&gt; Brand Name: iTaq Universal SYBR Green Master Mix</td><td>BioRad</td><td>1725121</td><td></td></tr><tr><td>Trypsin-EDTA</td><td>Gibco</td><td>25299956</td><td>0.25%</td></tr><tr><td>VEGF&lt;sub&gt;165&lt;/sub&gt; (VEGF-A)</td><td>PeproTech</td><td>100-20</td><td>use at 50 ng/mL</td></tr><tr><td>&amp;alpha;-CD31-FITC</td><td>BioLegend</td><td>303104</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>&amp;alpha;-CD34-Pacific Blue</td><td>BioLegend</td><td>343512</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>&amp;alpha;-CD45-APC/Cy7</td><td>BioLegend</td><td>304014</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>&amp;alpha;-c-Kit-APC</td><td>BioLegend</td><td>313206</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>&amp;alpha;-Flk-1-PE/Cy7</td><td>BioLegend</td><td>359911</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>&amp;alpha;-VE-Cadherin-PE</td><td>BioLegend</td><td>348506</td><td>2 &amp;mu;g/mL*</td></tr><tr><td>* Antibody fluorescent conjugates should be optimized based on the cell sorter used. Presented here are the final concentrations utilized in this study.</td><td></td><td></td><td></td></tr></tbody></table>

directed differentiation of hemogenic endothelial cells from human pluripotent stem cells

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial cells, which line blood vessel lumens, from human pluripotent stem cells is crucial for a multitude of tissue engineering and regeneration applications. In vivo, primordial endothelial cells are derived from the mesodermal lineage and are specified toward specific subtypes, including arterial, venous, capillary, hemogenic, and lymphatic. Hemogenic endothelial cells are of particular interest because, during development, they give rise to hematopoietic stem and progenitor cells, which then generate all blood lineages throughout life. Thus, creating a system to generate hemogenic endothelial cells in vitro would provide an opportunity to study endothelial-to-hematopoietic transition, and may lead to ex vivo production of human blood products and reduced reliance on human donors. While several protocols exist for the derivation of progenitor and primordial endothelial cells, generation of well-characterized hemogenic endothelial cells from human stem cells has not been described. Here, a method for the derivation of hemogenic endothelial cells from human embryonic stem cells in approximately 1 week is presented: a differentiation protocol with primitive streak cells formed in response to GSK3&#946; inhibitor (CHIR99021), then mesoderm lineage induction mediated by bFGF, followed by primordial endothelial cell development promoted by BMP4 and VEGF-A, and finally hemogenic endothelial cell specification induced by retinoic acid. This protocol yields a well-defined population of hemogenic endothelial cells that can be used to further understand their molecular regulation and endothelial-to-hematopoietic transition, which has the potential to be applied to downstream therapeutic applications.

A schematic outlining the specification of primordial ECs and hemogenic ECs from hESCs, and a representative image of cells 24 h after plating are shown in Figure 1. Following specification, primordial ECs and hemogenic ECs are FACS purified on days 5 and 8, respectively. Primordial ECs are defined as CD31+ CD45- and hemogenic ECs are defined as CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. A representative flow cytometric gating strategy for primordial ECs and hemogenic EC purification is shown in Figure 2. Cells are initially gated based on the negative expression of CD45 and positive expression of CD31 to obtain purified primordial ECs (Figure 2A). To obtain purified hemogenic ECs, cells are initially gated as in Figure 2A and are then further purified based on positive or negative expression of (in order) VE-Cadherin (CDH5), c-Kit (KIT), CD34, and KDR (Figure 2B).
To assess the potential of H9-Fucci-hES-derived primordial CD31+ CD45- endothelial cells, isolated via FACS at day 5 of differentiation (protocol section 4), to give rise to endothelial subtypes, the purified cells are seeded onto plates coated with either the Notch ligand DLL4 to induce arterial specification, or PBS (control), and incubated for 24 h in a 37 &#176;C, 5% CO2 incubator. The cells are then lysed with RNA lysis buffer, the RNA extracted, and reverse transcribed to cDNA, and qPCR is performed to compare gene expression levels in the DLL4-treated vs. control cells. As expected, endothelial cells grown on DLL4 have increased expression of the Notch-responsive gene HEY2, as well as the arterial-associated genes EFNB2, GJA5, and GJA4. Additionally, these cells also have decreased expression of the venous transcription factor NR2F2 (Figure 3A). Alternatively, to determine the effect of DLL4 treatment on cell cycle state, the FACS purified CD31+ CD45- cells are incubated on plates coated with either DLL4 or PBS for 24 h, lifted, and analyzed based on the expression of hCdt1(30/120)-mCherry (late G1) and hGem(1/110)-mVenus (S/G2/M). Consistent with the findings that Notch signaling promotes late G1 cell cycle arrest27, a greater percentage of primordial ECs are arrested in late G1 after growth in the presence of DLL4, compared to control cells (Figure 3B,C).
To verify the hematopoietic potential of hemogenic endothelial cells, the CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45- endothelial cells isolated through FACS (methods in section 7) are seeded in a methylcellulose-based medium formulated for growth of hematopoietic progenitor cells in colony-forming unit (CFU) assays and are allowed to grow for 14 days. CFU-E erythroid colonies and blast-forming unit (BFU)-E erythroid colonies are counted on day 8 (Figure 4A,B), and CFU-GM granulocyte/macrophage and GFU-GEMM (granulocyte, erythroid, macrophage, and megakaryocyte) multipotent hematopoietic progenitor colonies are counted on day 14 (Figure 4C and D). Per 1,000 hemogenic ECs plated, approximately 20 CFU are generated (Figure 4F). Cells with endothelial cell morphology can also be seen in the cultures (Figure 4E); these are the hemogenic endothelial cells that give rise to multi-lineage hematopoietic progenitors on a single cell level37.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62391/62391fig01.jpg" /> 
Figure 1: Protocol for the specification of primordial and hemogenic ECs. (A) Schematic diagram of the differentiation protocol. Embryonic stem cells are plated on Day -1 on matrix protein-coated plates and are allowed to attach overnight. The cells are then treated on Days 0 and 1 with GSK3i inhibitor (CHIR99021) and bFGF, respectively, to induce primitive streak and mesoderm specification, respectively. Beginning on Day 2, the cells are treated with a combination of BMP4 and VEGF-A to promote primordial EC development. Primordial ECs (red circle) are FACS purified on Day 5. Alternatively, to generate hemogenic ECs, the medium above the primordial ECs is exchanged on Day 5 to fresh hemogenic differentiation medium containing BMP4, VEGF-A, and RA. This medium is replaced daily until Day 8, when hemogenic ECs (red star) are FACS purified. (B) Colonies on Day 0 of differentiation, scale bar= 100 &#956;m. Panel A has been modified from Qiu et al.37 with permission from Elsevier. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62391/62391fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62391/62391fig02.jpg" /> 
Figure 2: FACS analysis of hemogenic ECs derived from hESCs. Representative flow cytometric gating strategy for the purification of (A) primordial ECs and (B) hemogenic ECs. Note that since hemogenic ECs are derived from primordial ECs, the flow cytometry gating strategy for CD45 and CD31 is identical for both cell populations. Shown in the top row of each panel (sample) are cells that were differentiated to hemogenic ECs as described in protocol section 6 and stained with antibodies as described in protocol section 7.3.8. Shown in the bottom row of each panel (control) are unstained&#160;cells that were differentiated for 8 days without RA treatment. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62391/62391fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62391/62391fig03.jpg" /> 
Figure 3: DLL4-induction of H9-Fucci CD31+ CD45- primordial endothelial cells results in late G1 arrest and increased arterial gene expression. (A) DLL4 treatment of CD31+ CD45- H9-hESC- derived primordial endothelial cells expressing the Fucci construct purified at day 5 of differentiation results in increased expression of arterial genes (i-iii) and the Notch responsive gene Hey2 (v), which is accompanied by a concomitant decrease in the expression of the venous gene NR2F2 (iv). (B) Representative FACS plots showing the cell cycle state distribution of 5,000 H9-Fucci-derived CD31+ CD45- grown on PBS (control) or DLL4 for 24 h. (C) DLL4 induction results in a 15% increase in cells in the late G1 phase compared to control. Data are the average of triplicate samples from the same experiment shown in panel (B). Error bars indicate standard deviation. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62391/62391fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62391/62391fig04.jpg" /> 
Figure 4: Analysis of hematopoietic potential of hemogenic ECs derived from hESCs. Representative images showing morphology of H1-hESC derived (A) CFU-E erythroid colony (scale bar = 35 &#956;m), (B) BFU-E erythroid colony (scale bar = 75 &#956;m), (C) CFU-GM granulocyte/macrophage colony, (D) CFU-GEMM multipotent hematopoietic progenitor colony, and (E) CFU-GM granulocyte/macrophage colony with underlying endothelial cells (ECs) (red arrows). (F) number and distribution of CFUs formed per 1,000 plated hemogenic endothelial cells. Scale bar = 100 &#956;m in (C-E). Additional images of CFUs differentiated using this protocol can be found in Qiu et al.37. Panel F has been modified from Qiu et al.37 with permission from Elsevier. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62391/62391fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Forward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>EFNB2</td>
			<td>TATGCAGAACTGCGATTTCCAA</td>
			<td>TGGGTATAGTACCAGTCCTTGTC</td>
		</tr>
		<tr>
			<td>EPHB4</td>
			<td>CGCACCTACGAAGTGTGTGA</td>
			<td>GTCCGCATCGCTCTCATAGTA</td>
		</tr>
		<tr>
			<td>GJA5</td>
			<td>CCGTGGTAGGCAAGGTCTG</td>
			<td>ATCACACCGGAAATCAGCCTG</td>
		</tr>
		<tr>
			<td>GJA4</td>
			<td>ACACCCACCCTGGTCTAC</td>
			<td>CACTGGCGACATAGGTGCC</td>
		</tr>
		<tr>
			<td>HEY2</td>
			<td>GCCCGCCCTTGTCAGTATC</td>
			<td>CCAGGGTCGGTAAGGTTTATTG</td>
		</tr>
		<tr>
			<td>NR2F2</td>
			<td>GGACCACATACGGATCTTCCAA</td>
			<td>ACATCAGACAGACCACAGGCAT</td>
		</tr>
	</tbody>
</table>
Table 1: qPCR primer information

Watch this Scientific Journal Video about Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells at JoVE.com

Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells

Presented here is a simple protocol for the directed differentiation of hemogenic endothelial cells from human pluripotent stem cells in approximately 1 week.

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial ...

directed-differentiation-hemogenic-endothelial-cells-from-human

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

2.1K Views.  University of Virginia. Dit protocol beschrijft een methode om een goed gekarakteriseerde populatie van menselijke hemogene endotheelcellen te genereren. Deze cellen kunnen worden gebruikt om de moleculaire regulatie en endotheel-naar-hematopoietische overgang te bestuderen. Begin met het kweken van menselijke embryonale stamcellen gedurende vier dagen om ze te differentiëren in primordiale endotheelcellen.Op dag vijf aspirateer je het medium boven de cellen. Was de cellen vervolgens voorzichtig met één mi...

Video: Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro is essential for mechanistic studies of the endothelial-hematopoietic transition and hematopoietic specification. Here, we describe a method for the efficient induction of HE from human pluripotent stem cells (hPSCs) by way of overexpression of different sets of transcription factors. The combination of ETV2 and GATA1 or GATA2 TFs is used to induce HE with pan-myeloid potential, while a combination of GATA2 and TAL1 transcription factors allows for the production of HE with erythroid and megakaryocytic potential. The addition of LMO2 to GATA2 and TAL1 combination substantially accelerates differentiation and increases erythroid and megakaryocytic cells production. This method provides an efficient and rapid means of HE induction from hPSCs and allows for the observation of the endothelial-hematopoietic transition in a culture dish. The protocol includes hPSCs transduction procedures and post-transduction analysis of HE and blood progenitors.

This protocol describes the efficient induction of hemogenic endothelium and multipotential hematopoietic progenitors from human pluripotent stem cells via the forced expression of transcription factors.

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Feeder-free Derivation of Melanocytes from Human Pluripotent Stem Cells

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can direct the differentiation of hPSCs into the cell type of interest by manipulating the culture conditions to recapitulate signals seen during development. One such cell type is the melanocyte, a pigment-producing cell of neural crest (NC) origin responsible for protecting the skin against UV irradiation. This protocol presents an extension of a currently available in vitro Neural Crest differentiation protocol from hPSCs to further differentiate NC into fully pigmented melanocytes. Melanocyte precursors can be enriched from the Neural Crest protocol via a timed exposure to activators of WNT, BMP, and EDN3 signaling under dual-SMAD-inhibition conditions. The resultant melanocyte precursors are then purified and matured into fully pigmented melanocytes by culture in a selective medium. The resultant melanocytes are fully pigmented and stain appropriately for proteins characteristic of mature melanocytes.

This work describes an in vitro differentiation protocol to produce pigmented, mature melanocytes from human pluripotent stem cells via a neural crest and melanoblast intermediate stage using a feeder-free, 25 day protocol.

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, and is necessary for the emergence of definitive HSPC from the murine extra embryonic yolk sac, placenta, umbilical vessels, and the embryonic aorta-gonad-mesonephros (AGM) region. The transient nature and small size of this cell population renders its reproducible isolation for careful quantification and experimental applications technically difficult. We have established a fluorescence-activated cell sorting (FACS)-based protocol for simultaneous isolation of hemogenic endothelial cells and HSPC during their peak generation times in the yolk sac and AGM. We demonstrate methods for dissection of yolk sac and AGM tissues from mouse embryos, and we present optimized tissue digestion and antibody conjugation conditions for maximal cell survival prior to identification and retrieval via FACS. Representative FACS analysis plots are shown that identify the hemogenic endothelial cell and HSPC phenotypes, and describe a methylcellulose-based assay for evaluating their blood forming potential on a clonal level.

Hematopoietic stem and progenitor cells (HSPC) derive from specialized (hemogenic) endothelial cells during development, yet little is known about the process by which some endothelial cells specify to become blood forming. We demonstrate a flow-cytometry based method allowing simultaneous isolation of hemogenic endothelial cells and HSPC from murine embryonic tissues.

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Directed Differentiation of Induced Pluripotent Stem Cells towards T Lymphocytes

Adoptive cell transfer (ACT) of antigen-specific CD8+ cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of malignancies 1. CTLs can recognize malignant cells by interacting tumor antigens with the T cell receptors (TCR), and release cytotoxins as well as cytokines to kill malignant cells. It is known that less-differentiated and central-memory-like (termed highly reactive) CTLs are the optimal population for ACT-based immunotherapy, because these CTLs have a high proliferative potential, are less prone to apoptosis than more differentiated cells and have a higher ability to respond to homeostatic cytokines 2-7. However, due to difficulties in obtaining a high number of such CTLs from patients, there is an urgent need to find a new approach to generate highly reactive Ag-specific CTLs for successful ACT-based therapies.
TCR transduction of the self-renewable stem cells for immune reconstitution has a therapeutic potential for the treatment of diseases 8-10. However, the approach to obtain embryonic stem cells (ESCs) from patients is not feasible. Although the use of hematopoietic stem cells (HSCs) for therapeutic purposes has been widely applied in clinic 11-13, HSCs have reduced differentiation and proliferative capacities, and HSCs are difficult to expand in in vitro cell culture 14-16. Recent iPS cell technology and the development of an in vitro system for gene delivery are capable of generating iPS cells from patients without any surgical approach. In addition, like ESCs, iPS cells possess indefinite proliferative capacity in vitro, and have been shown to differentiate into hematopoietic cells. Thus, iPS cells have greater potential to be used in ACT-based immunotherapy compared to ESCs or HSCs.
Here, we present methods for the generation of T lymphocytes from iPS cells in vitro, and in vivo programming of antigen-specific CTLs from iPS cells for promoting cancer immune surveillance. Stimulation in vitro with a Notch ligand drives T cell differentiation from iPS cells, and TCR gene transduction results in iPS cells differentiating into antigen-specific T cells in vivo, which prevents tumor growth. Thus, we demonstrate antigen-specific T cell differentiation from iPS cells. Our studies provide a potentially more efficient approach for generating antigen-specific CTLs for ACT-based therapies and facilitate the development of therapeutic strategies for diseases.

Generation of T lymphocytes from induced pluripotent stem (iPS) cells gives an alternative approach of using embryonic stem cells for T cell-based immunotherapy. The method shows that by utilizing either in vitro or in vivo induction system, iPS cells are able to differentiate into both conventional and antigen-specific T lymphocytes.

Adoptive cell transfer (ACT) of antigen-specific CD8+  cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of  malignancies 1. CTLs can  ...

Immunology and Infection

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs). Until recently, efforts to differentiate hPSCs into HSCs have predominantly generated hematopoietic progenitors that lack HSC potential, and instead resemble yolk sac hematopoiesis.&#160;These resulting hematopoietic progenitors may have limited utility for in vitro disease modeling of various adult hematopoietic disorders, particularly those of the lymphoid lineages. However, we have recently described methods to generate erythro-myelo-lymphoid multilineage definitive hematopoietic progenitors from hPSCs using a stage-specific directed differentiation protocol, which we outline here. Through enzymatic dissociation of hPSCs on basement membrane matrix-coated plasticware, embryoid bodies (EBs) are formed. EBs are differentiated to mesoderm by recombinant BMP4, which is subsequently specified to the definitive hematopoietic program by the GSK3&#946; inhibitor, CHIR99021. Alternatively, primitive hematopoiesis is specified by the PORCN inhibitor, IWP2. Hematopoiesis is further driven through the addition of recombinant VEGF and supportive hematopoietic cytokines. The resulting hematopoietic progenitors generated using this method have the potential to be used for disease and developmental modeling, in vitro.

Here, we present human pluripotent stem cell (hPSC) culture protocols, used to differentiate hPSCs into CD34+ hematopoietic progenitors. This method uses stage-specific manipulation of canonical WNT signaling to specify cells exclusively to either the definitive or primitive hematopoietic program.

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Hemogenic Endothelium Differentiation from Human Pluripotent Stem Cells in A Feeder- and Xeno-free Defined Condition

Deriving functional hematopoietic stem and progenitor cells (HSPCs) from human pluripotent stem cells (PSCs) have been an elusive goal for autologous transplants to treat hematological and malignant disorders. Hemogenic endothelium (HE) is an amenable platform to produce functional HSPCs by transcription factors or to induce lymphocytes in a robust manner. However, current methods to derive HE are either costly or variable in yield. In this protocol, we established a cost-effective and precise method to derive HE within 4 days in a feeder- and xeno-free defined condition. The resultant HE underwent an endothelial-to-hematopoietic transition and produced CD34+CD45+ clonogenic hematopoietic progenitors. The potential capacity of our platform for generating functional HSPCs will have broad applications in disease modeling and screening for therapeutic compounds.

Here, we present a protocol to precisely form hemogenic endothelium from human pluripotent stem cells in a feeder- and xeno-free condition. This method will have broad applications in disease modeling and screening for therapeutic compounds.

Deriving functional hematopoietic stem and progenitor cells (HSPCs) from human pluripotent stem cells (PSCs) have been an elusive goal for autologous ...

Hemogenic Reprogramming of Human Fibroblasts by Enforced Expression of Transcription Factors

The cellular and molecular mechanisms underlying specification of human hematopoietic stem cells (HSCs) remain elusive. Strategies to recapitulate human HSC emergence in vitro are required to overcome limitations in studying this complex developmental process. Here, we describe a protocol to generate hematopoietic stem and progenitor-like cells from human dermal fibroblasts employing a direct cell reprogramming approach. These cells transit through a hemogenic intermediate cell-type, resembling the endothelial-to-hematopoietic transition (EHT) characteristic of HSC specification. Fibroblasts were reprogrammed to hemogenic cells via transduction with GATA2, GFI1B and FOS transcription factors. This combination of three factors induced morphological changes, expression of hemogenic and hematopoietic markers and dynamic EHT transcriptional programs. Reprogrammed cells generate hematopoietic progeny and repopulate immunodeficient mice for three months. This protocol can be adapted towards the mechanistic dissection of the human EHT process as exemplified here by defining GATA2 targets during the early phases of reprogramming. Thus, human hemogenic reprogramming provides a simple and tractable approach to identify novel markers and regulators of human HSC emergence. In the future, faithful induction of hemogenic fate in fibroblasts may lead to the generation of patient-specific HSCs for transplantation.

This protocol demonstrates the induction of a hemogenic program in human dermal fibroblasts by enforced expression of the transcription factors GATA2, GFI1B and FOS to generate hematopoietic stem and progenitor cells.

The cellular and molecular mechanisms underlying specification of human hematopoietic stem cells (HSCs) remain elusive. Strategies to recapitulate human ...

Differentiation and Characterization of Osteoclasts from Human Induced Pluripotent Stem Cells

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a single-cell suspension for further use in embryoid body induction. Following mesodermal induction, embryoid bodies undergo hematopoietic differentiation, producing a floating hematopoietic cell population. Subsequently, the harvested hematopoietic cells undergo a macrophage colony-stimulating factor maturation step and, finally, osteoclast differentiation. After osteoclast differentiation, osteoclasts are characterized by staining for TRAP in conjunction with a methyl green nuclear stain. Osteoclasts are observed as multinucleated, TRAP+ polykaryons. Their identification can be further supported by Cathepsin K staining. Bone and mineral resorption assays allow for functional characterization, confirming the identity of bona fide osteoclasts. This protocol demonstrates a robust and versatile method to differentiate human osteoclasts from iPSCs and allows for easy adoption in applications requiring large quantities of functional human osteoclasts. Applications in the areas of bone research, cancer research, tissue engineering, and endoprosthesis research could be envisioned.

This protocol presents the differentiation of human osteoclasts from induced pluripotent stem cells (iPSCs) and describes methods for the characterization of osteoclasts and osteoclast precursors.

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a ...

Differentiation of Human Induced Pluripotent Stem Cells to Brain Microvascular Endothelial Cell-Like Cells with a Mature Immune Phenotype

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous system (CNS). Due to the limited access to disease-related BBB samples, it is still not well understood whether BBB malfunction is causative for disease development or rather a consequence of the neuroinflammatory or neurodegenerative process. Human induced pluripotent stem cells (hiPSCs) therefore provide a novel opportunity to establish in vitro BBB models from healthy donors and patients, and thus to study disease-specific BBB characteristics from individual patients. Several differentiation protocols have been established for deriving brain microvascular endothelial cell (BMEC)-like cells from hiPSCs. Consideration of the specific research question is mandatory for the correct choice of the respective BMEC-differentiation protocol. Here, we describe the extended endothelial cell culture method (EECM), which is optimized to differentiate hiPSCs into BMEC-like cells with a mature immune phenotype, allowing the study of immune cell-BBB interactions. In this protocol, hiPSCs are first differentiated into endothelial progenitor cells (EPCs) by activating Wnt/&#946;-catenin signaling. The resulting culture, which contains smooth muscle-like cells (SMLCs), is then sequentially passaged to increase the purity of endothelial cells (ECs) and to induce BBB-specific properties. Co-culture of EECM-BMECs with these SMLCs or conditioned medium from SMLCs allows for the reproducible, constitutive, and cytokine-regulated expression of EC adhesion molecules. Importantly, EECM-BMEC-like cells establish barrier properties comparable to primary human BMECs, and due to their expression of all EC adhesion molecules, EECM-BMEC-like cells are different from other hiPSC-derived in vitro BBB models. EECM-BMEC-like cells are thus the model of choice for investigating the potential impact of disease processes at the level of the BBB, with an impact on immune cell interaction in a personalized fashion.

Here, we describe a protocol, the extended endothelial cell culture method (EECM), that allows differentiation of pluripotent stem cells to brain microvascular endothelial cell (BMEC)-like cells. These cells show endothelial cell adhesion molecule expression and are thus a human blood-brain barrier model suitable to study immune cell interactions in vitro.

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous ...

Bioengineering

Differentiating Human-Induced Pluripotent Stem Cells into Brain Microvascular Endothelial Cells

Source: Pong, S. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/61629">Derivation, Expansion, Cryopreservation and Characterization of Brain Microvascular Endothelial Cells from Human Induced Pluripotent Stem Cells.</a> J. Vis. Exp. (2020)
This video demonstrates a multi-step process for differentiating human iPSCs into brain microvascular endothelial cells. The resulting differentiated cells closely mimic brain microvascular endothelial cells, characterized by tight junctions, making them ideal for research on brain diseases.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
NOTE: Briefly, fibroblasts were ...

Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video