We thank Dr. Gonzalo Quasollo for his invaluable help with imaging and Dr. Andrea Pellegrini for cell culture technical support.
This research was supported by grants from: the National Institute of Health, USA (#RO1AG058778-01A1, Subaward Agreement No 165148/165147 between UTHSCSA-Instituto Investigaci&#243;n M&#233;dica M y M Ferreyra) and from the National Agency of Agencia Nacional de Scientific and Technological Promotion, Argentina (ANPCyT, PICT 2017 #0618).

The animal procedures are performed following approved protocols of the National Institute of Health Guide for the Care and Use of Laboratory Animals. Approval to conduct the study is granted by the Animal Care and Ethics Committee (CICUAL) of INIMEC-CONICET-UNC (Resolution numbers 014/2017 B and 006/2017 A).
1. Primary rat cortical neuron cultures
<ol>
	<li>Anesthetize E18 Wistar pregnant rats in a CO2 chamber with a mixture of 80% CO2/20% O2 for 60 s of exposure and then sacrifice then by dislocate the cervical vertebrae.</li>
	<li>Perform the following steps in a laminar flow hood. Extract encephalon from the embryos with a forceps style # 3 and straight sharp small spring scissors (Table of Materials) to Hanks solution in cell culture dishes.</li>
	<li>Dissect the tissue under 20x magnifying glass, using two fine-tipped forceps style #5, separating the frontal cortex from the meninges. Transfer the frontal cortex to a 15 mL conical tube and incubate the tissue with 3-4 mL of Trypsin-EDTA (0.25%) for 15 min, at 37 &#176;C for chemical digestion.</li>
	<li>After digestion, dilute it with 3-4mL of Dulbecco&#39;s modified eagle medium (DMEM) plus 10% fetal calf serum (FCS). Then wash it 3 times with Ca2+/Mg2+ free Hanks Balanced Salt solution and 0.1% glucose by centrifugation (3000 g for 5 min).</li>
	<li>Mechanically dissociate the tissue 10 times by pipetting up and down using a 1000 &#181;L tip, in&#160;DMEM&#160;plus 10% FCS&#160;(Table of Materials). Then centrifuge the homogenate at 100 x g for 1 min, collect the supernatant and complete the remaining volume to 1000 &#181;L.</li>
	<li>Plate the cell suspension on cell culture dishes at a density of 520 cell/mm2 with 2 mL of DMEM containing 10% FCS, 1% penicillin/streptomycin and 1% of an essential aminoacid additive (see Table of Material). Then incubate at 37 &#176;C in a humidified environment with 5% CO2 for 2 h.
	<ol>
		<li>Organic matter removal and poly-L-lysine coating of cell culture dishes
		<ol>
			<li>Remove the organic matter by placing the glass material in a reaction chamber and add 96% ethyl alcohol to just about cover the material. Then add 68% (w/v) nitric acid drop by drop until brownish-greenish bubbles start to appear. Once this happens, partially cover the container and allow the reaction to continue until explosion ceases. 
			NOTE: Remove the organic matter under a gas extraction cabin to avoid exposure to noxious gases.</li>
			<li>Before poly-L-lysine coating, rinse the glasses with sterile Mili-Q water about ten times. Then incubate the culture glasses and dishes with 0.1 &#956;g/&#956;L poly-L-lysine for 4 h before using them. After incubation, rinse the glasses with sterile Mili-Q water about ten times.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>To allow neural cell differentiation, change the medium for a serum-free neurobasal medium, with the serum-free supplement (Table of Materials). Keep cultures at 37 &#176;C with 5% CO2 until treatment.</li>
</ol>
2. Lentivirus production
NOTE: The oligonucleotides containing the sequences targeting the 3&#39;UTRs of either the CN-A&#945; isoform or CHOP and with the non-targeting sequences (scrambles) are listed in Table 1.
<ol>
	<li>For annealing, mix two single-stranded oligonucleotides with complementary sequences in equal molar amounts, using Annealing Buffer (10 mM Tris-HCl, pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA).</li>
	<li>Heat at 95 &#176;C for 2 min and then cool slowly by transferring samples from the heat block or water bath to a bench-top at room temperature. Dilute the resulting product [short hairpin RNA, (shRNA) with cohesive ends] to a final concentration of 0.5 &#181;M, aliquot them and store at -20 &#176;C.</li>
	<li>Clone the shRNA insert into lentiviral vector pLKO.3G, with GFP as a green fluorescent marker. For this, digest 1 &#181;g of vector with EcoRI and PacI restriction enzymes by mixing the following in a sterile tube: 2 &#181;L of 10x restriction enzyme buffer (100 mM bis-Tris propane-HCl, pH 6.5, 100 mM MgCl2, 1 mg/mL bovine serum albumin), 1 &#181;L of 1 &#181;g/&#181;L pLKO.3G, 0.5 &#181;L of 10 U/&#181;L ECoRI, 0.5 &#181;L of PacI (10 U/&#181;L), and 16 &#181;L of sterile ionized water.
	<ol>
		<li>Mix gently by pipetting. Incubate the reaction for 3-4 h at 37 &#176;C. 
		NOTE: Overnight digestions are generally unnecessary and may result in DNA degradation.</li>
	</ol>
	</li>
	<li>For ligation, mix the digested vector and insert in a molar ratio of 3:1 and incubate it with the T4 ligase and ligase buffer (provided by manufacturer) overnight at 16 &#176;C. 
	NOTE: At this point ligation reaction can be stored at 4 &#176;C until further use.</li>
	<li>Transform DH5&#945; competent cells (Table of Materials) or another suitable E. coli strain with the ligation reaction as follows.
	<ol>
		<li>Mix competent E. coli with the total volume of ligation reaction and chill it on ice for 15 min, place it in a 42 &#176;C bath for 2 min and then chill it on ice again for 15 min.</li>
		<li>Transfer the total volume subjected to heat shock to a 15 mL tube and complete the volume to 1000 &#181;L with Luria-Bertani (LB) liquid medium that has been previously maintained at 37 &#176;C. Shake the bacteria for 90 min at 37 &#176;C in an orbital shaker at approximately 330 rpm.</li>
		<li>Centrifuge them at 5,000 x g for 5 min at 4 &#176;C and discard 900 &#181;L of supernatant. Use the remaining supernatant to resuspend the pellet. Spread bacteria suspension evenly over a solid ampicillin (100 &#181;g/mL) LB plate.</li>
		<li>Incubate at 37 &#176;C overnight, then check bacterial growth. At this point, the bacteria may be stored at 4 &#176;C for 4-5 days.</li>
		<li>Pick a single colony to transfer into a 50 mL tube with 10 mL of LB liquid medium and ampicillin (100 &#181;g/mL). Shake the bacteria ON at 37 &#176;C at approximately 330 rpm.</li>
		<li>Centrifuge the culture to pellet the bacteria at 5,000 x g for 5 min at 4 &#176;C, discard the supernatant and conserve the bacterial pellet. This can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Purify the plasmid with a DNA purification kit from bacteria pellet following manufacturer&#39;s instructions (Table of Materials). Calculate the DNA concentration by measuring the absorbance at 260 nm and multiplying by the dilution factor, using the following relationship: A260 of 1.0 = 50 &#181;g/mL pure double strand (ds) DNA.</li>
</ol>
3. Lentivirus infection
NOTE: Perform the lentivirus generation procedure in a Class II laminar flow hood.
<ol>
	<li>24 h before transfection, seed 1-5 &#215; 106 HEK 293 cells into 100 mm of diameter culture dishes in 8 mL of growth medium and incubate them at 37 &#176;C, 5% CO2 overnight.</li>
	<li>Mix 14 &#181;g of pKLO.3G vector with specific insert, 10.5 &#181;g of packing plasmid psPAX and 3.5 &#181;g of envelope plasmid pMD2.G (Table of Materials). Dilute 45 &#181;L of plasmid transfection reagent (Table of Materials) in 700 &#181;L of reduced serum media (Table of Materials) and incubate for 5 min at room temperature. Then combine the DNA mixture with the diluted plasmid transfection reagent, mix gently, and incubate for 20 min at room temperature.</li>
	<li>Meanwhile, change for fresh DMEM the medium of the culture dish of HEK 293 cell cultures (70% confluent at the time of transfection). Then add the entire volume of the DNA solution drop by drop. Rock the dish gently.It is not necessary to add/change medium after transfection.</li>
	<li>Incubate the cells at 37 &#176;C, 5% CO2 for 48 h- 72 h to allow shRNAs to reach their optimum transduction checked by GFP fluorescence using a fluorescence microscope. Afterwards, collect the medium with lentivirus and store at 4 &#176;C.</li>
	<li>Filtrate viral supernatant with a 0.45 &#181;m nylon membrane. Aliquot the flow-through in 1 mL. Next, centrifuge at 17,000 x g for 4 h. Discard the supernatant and conserve the pellet. Allow invisible pellet to dry, and, once dried, store at - 80 &#176;C.
	<ol>
		<li>Perform viral titration by flux cytometry. Seed 4 x 105 HEK 293 cells in 24-well plates and incubate at 37 &#176;C for 24 h. Then resuspend the viral particles in 200 &#181;L of DMEM culture medium (Table of Materials) and add 0.05, 0.02, and 0.005 &#181;L to each well.</li>
		<li>Incubate viral infection for 72 h, remove medium and trypsinize (0.05% trypsin, 1 mL) for 3 min. Add 1 mL of DMEM in 10% FCS solution and centrifuge at 500 x g for 5 min. Discard the supernatant and wash the pellet twice with PBS.</li>
		<li>Resuspend the pellet with 100 &#181;L of PBS and fix the cells with 100 &#181;L of 2% paraformaldehyde (PFA) in PBS. Analyze the cells with a flux cytometer and determine the percentage of GFP fluorescent cells. Collect this data to calculate viral titration using the following formula: 
		Viral Titration 
		<img alt="Equation1" src="/files/ftp_upload/61974/61974eq01.jpg" /></li>
	</ol>
	</li>
</ol>
4. Primary neuron cultures stressed with ganglioside GM2 accumulation and immunocytochemistry using anti-MAP2 antibody
<ol>
	<li>Infect the primary cortical neuron cultures (15 days in vitro) with specific shRNA oligonucleotides targeting the 3&#39; UTRs of either CN-A&#945; or CHOP and incubate them at 37 &#176;C with 5% CO2 for 1 day. 
	NOTE: Primary cortical neuron cultures of 7-8 days in vitro could also be used if the cells show high neurite growth.
	<ol>
		<li>Prepare a 500 &#181;M stock solution of ganglioside GM2 in ethanol and sonicate it for 1 h.</li>
		<li>Add GM2 stock solution to the culture dishes medium at a final concentration of 2 &#181;M. Allow to incubate at 37 &#176;C with 5% CO2 for 16, 24, and 48 h.</li>
	</ol>
	</li>
	<li>Use some cultures to prepare cellular homogenate for western blot analysis (for antibody specification, see the Table of Materials).</li>
	<li>Follow steps 1.4. and 1.5. and then fix the cells with 4% PFA and 120 mM sucrose in PBS for 20 min at 37 &#176;C, and then wash it with PBS. Perform this procedure on an anti-slipping membrane in a wet chamber. Afterwards, add permeabilization solution (0.2% Triton X-100 in PBS) for 5 min and wash with PBS.
	<ol>
		<li>Use 5% BSA diluted in PBS for 45 min to allow blocking, then incubate with anti-MAP2 antibody, diluted 1:800 in blocking solution, at 4 &#176;C overnight.</li>
		<li>At the end of the incubation time, wash twice with PBS and incubate with secondary antibody (Table of Materials) for 1 h. Then wash the cells with PBS and mount the glasses onto slides using an aqueous mounting medium (Table of Materials).</li>
	</ol>
	</li>
</ol>
5. Neurite atrophy analysis
<ol>
	<li>Obtain images with a 20x air lens (NA 0.8) using an epifluorescence-inverted microscope equipped with a CCD-camera. Analyze images with ImageJ plug-ins. For this, load the picture to ImageJ and subtract the background by clicking on Process | Subtract Background.</li>
	<li>Click on Image | Adjust | Threshold or type the following keys: Ctrl (or Cmd) + Shift + T. A window pops open to adjust minimum values, allowing path and soma tracings to be distinguishable. Click on the binary image (neurites and somas are white colored). On this image, use freehand selection to delete somas; the selected soma area turns black again.</li>
	<li>Select traces and click Edit | Selection | Create Selection. Get the ROI by clicking Ctrl (or Cmd) and T keys of the selection and conserve it. Open the original image, then click on the ROI manager panel and select the belonging ROI, previously obtained. Then click on the original image.</li>
	<li>Once the ROI traces on the image, type Ctrl (or Cmd) and M keys (Analyze | Measure). A window pops open; copy the mean value (arbitrary units a.u.) to process statistical analysis. 
	NOTE: To obtain values as &#181;m, click on Analyze | Set Scale. A window pops up open to set values. Be sure to add the correct scale (Analyze | Set Scale) depending on the characteristics of the microscope used.</li>
</ol>

<ol><li>Schroder, M., Kaufman, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+mammalian+unfolded+protein+response%5BTitle%5D)+AND+%22Annual+Review+of+Biochemistry%22%5BJournal%5D)">The mammalian unfolded protein response.</a> Annual Review of Biochemistry. 74, 739-789 (2005).</li>
<li>Cui, W., Li, J., Ron, D., Sha, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+structure+of+the+PERK+kinase+domain+suggests+the+mechanism+for+its+activation%5BTitle%5D)+AND+%22Acta+Crystallographica.+Section+D%2C+Biological+Crystallography%22%5BJournal%5D)">The structure of the PERK kinase domain suggests the mechanism for its activation.</a> Acta Crystallographica. Section D, Biological Crystallography. 67, 423-428 (2011).</li>
<li>Bollo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcineurin+interacts+with+PERK+and+dephosphorylates+calnexin+to+relieve+ER+stress+in+mammals+and+frogs%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Calcineurin interacts with PERK and dephosphorylates calnexin to relieve ER stress in mammals and frogs.</a> PLoS One. 5, 11925(2010).</li>
<li>Chen, Y., Holstein, D. M., Aime, S., Bollo, M., Lechleiter, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcineurin+beta+protects+brain+after+injury+by+activating+the+unfolded+protein+response%5BTitle%5D)+AND+%22Neurobiology+of+Disease%22%5BJournal%5D)">Calcineurin beta protects brain after injury by activating the unfolded protein response.</a> Neurobiology of Disease. 94, 139-156 (2016).</li>
<li>Harding, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+integrated+stress+response+regulates+amino+acid+metabolism+and+resistance+to+oxidative+stress%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">An integrated stress response regulates amino acid metabolism and resistance to oxidative stress.</a> Molecular Cell. 11, 619-633 (2003).</li>
<li>Hetz, C., Saxena, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ER+stress+and+the+unfolded+protein+response+in+neurodegeneration%5BTitle%5D)+AND+%22Nature+Reviews+Neurology%22%5BJournal%5D)">ER stress and the unfolded protein response in neurodegeneration.</a> Nature Reviews Neurology. 13, 477-491 (2017).</li>
<li>Lin, J. H., Li, H., Zhang, Y., Ron, D., Walter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Divergent+effects+of+PERK+and+IRE1+signaling+on+cell+viability%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Divergent effects of PERK and IRE1 signaling on cell viability.</a> PLoS One. 4, 4170(2009).</li>
<li>Virgolini, M. J., Feliziani, C., Cambiasso, M. J., Lopez, P. H., Bollo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neurite+atrophy+and+apoptosis+mediated+by+PERK+signaling+after+accumulation+of+GM2-ganglioside%5BTitle%5D)+AND+%22Biochimica+et+Biophysica+Acta+-+Molecular+Cell+Research%22%5BJournal%5D)">Neurite atrophy and apoptosis mediated by PERK signaling after accumulation of GM2-ganglioside.</a> Biochimica et Biophysica Acta - Molecular Cell Research. 1866, 225-239 (2019).</li>
<li>Ferreira, A., Busciglio, J., Landa, C., Caceres, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ganglioside-enhanced+neurite+growth%3A+evidence+for+a+selective+induction+of+high-molecular-weight+MAP-2%5BTitle%5D)+AND+%22The+Journal+of+Neuroscience%22%5BJournal%5D)">Ganglioside-enhanced neurite growth: evidence for a selective induction of high-molecular-weight MAP-2.</a> The Journal of Neuroscience. 10, 293-302 (1990).</li>
<li>Moore, C. B., Guthrie, E. H., Huang, M. T., Taxman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Short+hairpin+RNA+%28shRNA%29%3A+design%2C+delivery%2C+and+assessment+of+gene+knockdown%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown.</a> Methods in Molecular Biology. 629, 141-158 (2010).</li>
<li>Kaech, S., Banker, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Culturing+hippocampal+neurons%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Culturing hippocampal neurons.</a> Nature Protocols. 1, 2406-2415 (2006).</li>
<li>Rusnak, F., Mertz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcineurin%3A+form+and+function%5BTitle%5D)+AND+%22Physiological+Reviews%22%5BJournal%5D)">Calcineurin: form and function.</a> Physiological Reviews. 80, 1483-1521 (2000).</li>
<li>Hogan, P. G., Chen, L., Nardone, J., Rao, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptional+regulation+by+calcium%2C+calcineurin%2C+and+NFAT%5BTitle%5D)+AND+%22Genes+%26+Development%22%5BJournal%5D)">Transcriptional regulation by calcium, calcineurin, and NFAT.</a> Genes & Development. 17, 2205-2232 (2003).</li>
<li>Endo, M., Mori, M., Akira, S., Gotoh, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((C%2FEBP+homologous+protein+%28CHOP%29+is+crucial+for+the+induction+of+caspase-11+and+the+pathogenesis+of+lipopolysaccharide-induced+inflammation%5BTitle%5D)+AND+%22Journal+of+Immunology%22%5BJournal%5D)">C/EBP homologous protein (CHOP) is crucial for the induction of caspase-11 and the pathogenesis of lipopolysaccharide-induced inflammation.</a> Journal of Immunology. 176, 6245-6253 (2006).</li>
</ol>

The authors have no competing financial interests.

We describe an experimental system that enables molecular modulation of the transition from survival to apoptotic UPR phases in a neuronal cell model.
For a proper analysis of neurite atrophy, it is essential to obtain primary neuron cultures with numerous, long, highly branched processes9,11. This facilitates the examination of neuron process extension, allowing the clear differences between treatments to be detected. It is important to note that, if primary cortical neuron cultures at 7-8 days in vitro already show high neurite outgrowth, these may be used to induce stress and perform the subsequent analysis, instead of 15 days in vitro cultures.
Moreover, the inhibition percentage of ER stress-mediated CHOP overexpression should be about 65-70% or higher. Importantly, silencing of the CN-A&#945; expression level should affect only the ER stress-induced CN-A&#945; expression increase without modifying its basal level. This is to minimize the impact on CN functions not associated with PERK signaling12,13.
With respect to the neurite atrophy analysis procedure, this paper presents an alternative methodology that requires less manual work than specific ImageJ plug-ins that help to trace neurites. Commonly, these require that processes be individually traced for each neuron, while the steps followed in this paper trace the processes of multiple neurons at once using 5 sets of common accessible ImageJ commands. Both plug ins and this protocol enable the value of all the processes in the sample image to be quantified.
We previously demonstrated a novel cytoprotective role for the ubiquitous CN in the early phase of UPR, triggered either by pharmacological tools or ischemic processes3,4,8. Others and we described the impact of the inhibition of CHOP expression on cell survival in different systems8,11,14. Here we propose a methodology in which manipulating the expression of any of these genes enables to opposite modulate&#160;the beginning of the neuritic atrophy process in a cellular model of ER stress to be modulated in the opposite mode.
We envision that this methodology can be used to evaluate the susceptibility of neurons to undergo neuritic atrophy in different cell system models of ER stress and thus, contribute to understanding the molecular bases of the transition between acute and chronic phases of UPR in diverse neurodegenerative disease models.

Endoplasmic reticulum (ER) stress is defined as any perturbation that compromises protein-folding capacity in the organelle. The accumulation of unfolded proteins within the ER lumen activates a transduction cascade signal called the unfolded protein response (UPR). This complex signaling pathway is orchestrated by three stress sensors: PERK (protein kinase RNA [PKR]-like ER kinase), IRE1 (inositol-requiring enzyme 1) and ATF6 (activated transcription factor 6). All together attempt to restore homeostasis. But if stress persists, UPR eventually induces cell death by apoptosis1.
PERK, an ER transmembrane protein, upon ER stress, leads the phosphorylation of eukaryotic initiation factor-2 alpha (eIF2&#945;), reducing global protein synthesis and thus protein load in the ER2. We demonstrated that calcineurin A/B (CNA/B), a heterodimer Ca2+ phosphatase, directly binds the cytosolic domain of PERK, increasing its auto-phosphorylation and significantly enhancing inhibition of protein translation and cell viability3,4. Interestingly, CNA/B is abundant in the mammalian brain, distinguishing two isoforms of the subunit A of CN: &#945; and &#946;.
Under sustained ER stress, the PERK signaling pathway is the only UPR branch that remains activated, thus mediating both the pro-survival and the apoptotic response. In the chronic phase, one major downstream event is the induction of the transcription factor, CHOP (CCAAT/enhancer binding protein homologous protein)5. Chronic ER stress is also increasingly recognized as a common contributor to an extensive range of pathological disorders, including neurodegenerative diseases6. It is important to understand how UPR can facilitate cytoprotective signaling instead of cell death 7. However, at present little is known about the exact mechanism controlling the transition between these two UPR phases.
Recently, we found that, in cultured neurons, ganglioside GM2 accumulates in ER membranes and induces luminal calcium depletion. This in turn activates PERK signaling, which mediates neurite atrophy and apoptosis 8. In this study, the GM2 build-up in cultured neurons is used as a cell system model of ER stress-induced neurite atrophy. Specifically, two PERK factor expressions are manipulated, CN-A&#945; and CHOP, which switches the transition between early/protective events and a chronic/apoptotic phase. To accomplish this, the respective genes are silenced; thus, primary cortical neuron cultures are infected with lentivirus-delivered specific shRNA. Western blot analysis reveals a significant reduction of CN-A&#945; and CHOP expression levels in comparison with the control cells, which are infected with lentivirus that carry a scrambled shRNA. After this treatment, neurons are subjected to different incubation times of exogenous GM2, fixed, and immunostained with anti-microtubule associated protein 2 (MAP2) antibody9. Images are obtained with an epifluorescence microscope. The total neurite outgrowth is evaluated relative to total cell number.

<table><tbody><tr><td>Alexa Fluor 488 anti-Mouse</td><td>Thermo Fisher Scientific</td><td>#R37120</td><td></td></tr><tr><td>anti-CHOP</td><td>Thermo Fisher</td><td># MA1 - 250</td><td></td></tr><tr><td>Anti-CN-A&amp;alpha;</td><td>Millipore</td><td># 07-067</td><td></td></tr><tr><td>Anti-GM2</td><td>Matreya</td><td>#1961</td><td></td></tr><tr><td>anti-MAP2</td><td>Sigma Aldrich</td><td># M2320</td><td></td></tr><tr><td>anti-&amp;beta;-actin</td><td>Thermo Fisher</td><td># PA1 - 183</td><td></td></tr><tr><td>aprotinin</td><td>Santa Cruz Biotechnology</td><td>#3595</td><td></td></tr><tr><td>Axiovert 200 epifluorescence microscope</td><td>Zeiss</td><td></td><td></td></tr><tr><td>B27 supplement</td><td>Life Technologies</td><td>#17504944</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle&#039;s Medium (DMEM)</td><td>Life Technologies</td><td>#11966025</td><td></td></tr><tr><td>EcoRI</td><td>Promega</td><td>#R6011</td><td></td></tr><tr><td>Fetal Calf Serum (FCS)</td><td>Life Technologies</td><td>#16000044</td><td></td></tr><tr><td>Fine-tippeds forceps&amp;nbsp; style #5</td><td>Dumont</td><td></td><td></td></tr><tr><td>Forcep style #3</td><td>Dumont</td><td></td><td></td></tr><tr><td>HEK 293</td><td>ATCC</td><td>#CRL-1573</td><td></td></tr><tr><td>IRDye 680 CW secondary antibody</td><td>LI-COR Biosciences</td><td>#92632221</td><td></td></tr><tr><td>IRDye 680 secondary antibody</td><td>LI-COR Biosciences</td><td>#92632220</td><td></td></tr><tr><td>IRDye 800 CW secondary antibody</td><td>LI-COR Biosciences</td><td>#92632210</td><td></td></tr><tr><td>IRDye 800 CW secondary antibody</td><td>LI-COR Biosciences</td><td>#92632211</td><td></td></tr><tr><td>lentiviral envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>lentiviral packing plasmid psPAX2</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>lentiviral vector pLKO.3G</td><td>Addgene</td><td>#14748</td><td></td></tr><tr><td>Leupeptin hemisulfate</td><td>Santa Cruz Biotechnology</td><td>#295358</td><td></td></tr><tr><td>Lipofectamine LTX &amp;amp; Plus Reagent (plasmid transfection reagent)</td><td>Life Technologies</td><td>#A12621</td><td></td></tr><tr><td>MISSION shRNA</td><td>Sigma Aldrich</td><td></td><td></td></tr><tr><td>Monosialoganglioside GM2</td><td>Matreya</td><td>#1502</td><td></td></tr><tr><td>NanoDrop 2000</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>Neurobasal Medium</td><td>Life Technologies</td><td>#21103049</td><td></td></tr><tr><td>Nitrocellulose membrane 0.45 &amp;micro;m</td><td>BIO-RAD</td><td>#1620115</td><td></td></tr><tr><td>Odyssey infrared imaging system</td><td>LI-COR Bioscience</td><td></td><td></td></tr><tr><td>OneShot Top 10</td><td>Life Technology</td><td>#C404010</td><td></td></tr><tr><td>Opti-MEM (Reduced serum media)</td><td>Life Technologies</td><td>#105802</td><td></td></tr><tr><td>PacI</td><td>BioLabs</td><td>#R0547S</td><td></td></tr><tr><td>penicillin-streptomycin</td><td>Life Technologies</td><td>#15140122</td><td></td></tr><tr><td>Pepstatin A</td><td>Santa Cruz Biotechnology</td><td>#45036</td><td></td></tr><tr><td>phenylmethylsulfonyl fluoride</td><td>Santa Cruz Biotechnology</td><td>#329-98-6</td><td></td></tr><tr><td>Poly-L-lysine</td><td>sigma aldrich</td><td>P#2636</td><td></td></tr><tr><td>Straight sharp small spring scissors</td><td>Fine Science Tools</td><td></td><td></td></tr><tr><td>T4 DNA Ligase</td><td>Promega</td><td>#M1801</td><td></td></tr><tr><td>Trypsin-EDTA 0.25 %</td><td>Life Technologies</td><td>#25200056</td><td></td></tr><tr><td>Vibra-Cell Ultrasonic Liquid Processor (VCX 130)</td><td>Sonics</td><td></td><td></td></tr><tr><td>Wizard plus SV Minipreps DNA purification system</td><td>Promega</td><td>#A1330</td><td></td></tr></tbody></table>

molecular modulation by lentivirus-delivered specific shrnas in endoplasmic reticulum stressed neurons

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) through the activation of specialized sensors. UPR attempts first to restore homeostasis; but if damage persists the signaling induces apoptosis.
There is increasing evidence that sustained and unresolved ER stress contributes to many pathological conditions including neurodegenerative diseases. Because the UPR controls cell fate by switching between cytoprotective and apoptotic processes, it is essential to understand the events defining this transition, as well as the elements involved in its modulation.
Recently, we demonstrated that abnormal GM2 ganglioside accumulation causes depletion of ER Ca2+ content, which in turn activates PERK (PKR-like-ER kinase), one of the UPR sensors. Furthermore, PERK signaling participates in the neurite atrophy and apoptosis induced by GM2 accumulation. In this respect, we have established an experimental system that allows us to molecularly modulate the expression of downstream PERK components and thus change vulnerability of neurons to undergo neuritic atrophy.
We performed knockdown of calcineurin (cytoprotective) and CHOP (pro-apoptotic) expression in rat cortical neuronal cultures. Cells were infected with lentivirus-delivered specific shRNA and then treated with GM2 at different times, fixed and immunostained with anti-MAP2 (microtube-associated protein 2) antibody. Later, cell images were recorded using a fluorescence microscope and total neurite outgrowth was evaluated by using the public domain image processing software ImageJ. The inhibition of expression of those PERK signaling components clearly made it possible to either accelerate or delay the neuritic atrophy induced by ER stress.
This approach might be used in cell system models of ER stress to evaluate the vulnerability of neurons to neurite atrophy.

Here, we address the question of whether silencing two PERK downstream components affects the transition phase of UPR in an ER stress cell model.To achieve this, we silence the CN-A&#945; gene as well as the CHOP gene by two specific shRNA sequences for each (Table 1) in primary neuron cell culture for 1 day10. The expression is analyzed by Western blotting (Figure 1 and Figure 2). A clear inhibition is observed of ER stress-mediated CN-A&#945; and CHOP increase in knockdown cells, but not in control cells (shRNA scrambles). It should be noted that the basal CN expression level is not affected with this treatment condition. 
We also examine the possible link of GM2 accumulation-induced ER stress with neuronal degeneration by performing MAP2 immunostaining of primary neuronal cultures (Figure 3 and Figure 4).
Neurite atrophy is analyzed as total neurite outgrowth relative to the total cell number. This increases significantly after inducing ER stress by incubation of GM2 at 16-48 h. Interestingly, silencing of CN-A&#945; expression significantly enhances neurite atrophy, particularly at 16 h of GM2 accumulation, relative to GM2-untreated groups (Figure 3). Thus, CN-A&#945; knockdown accelerated the degeneration processes in neurons, corroborating the pro-survival effect of CN during the early phase of UPR. Conversely, CHOP knockdown resulted in significantly diminished neurite atrophy relative to controls, specifically at 16-24 h (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61974/61974fig01.jpg" /> 
Figure 1. Data analysis for CN-A&#945; silencing efficiency. Knockdown is evaluated by Western blot analysis using antibody against CN-A&#945; and GADPH (loading control). The primary antibody is visualized by near-infrared fluorescence imaging system. Numbers below represent relative intensity ratio between CN-A&#945; and GADPH bands. This figure has been republished from Virgolini, M.J. et al.4. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61974/61974fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61974/61974fig02.jpg" /> 
Figure 2.&#160;Data&#160;analysis for CHOP silencing efficiency. Knockdown is evaluated by Western blot analysis using an antibody against CHOP and &#946; actin (loading control). The primary antibody is visualized and then the data are analyzed as indicated in Figure 1. This figure has been republished from Virgolini, M.J. et al.4. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61974/61974fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61974/61974fig3v2.jpg" /> 
Figure 3.&#160;Data analysis for neuritic atrophy imaging in CN-A&#945; knockdown cells. (Top) Cultured primary neurons are loaded with GM2. Representative images of MAP2 immunostained cells are shown under control and experimental conditions. Images are recorded with an epifluorescence-inverted microscope equipped with a CCD-camera. Scale bars: 150 &#181;m (regular images), 75 &#181;m (magnified images). (Bottom) Histogram (mean &#177; SEM) represents neurite outgrowth with respect to total cells, analyzed by ImagJ plug-ins. *** and ###: p 0.0001 for comparison with the control, from one-way ANOVA. This figure has been republished from Virgolini, M.J. et al.4.&#160;
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61974/61974fig4v2.jpg" /> 
Figure 4. (Top) Data analysis for neuritic atrophy imaging in CHOP silencing cells. Primary neuron cultures are treated as indicated in Figure 3(top). (Bottom)&#160;Histograms and statistical notations as in Figure 3(Bottom) except ##: p&#8804; 0.001. This figure has been republished from Virgolini, M.J. et al.4. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61974/61974fig4v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Constructs</td>
			<td>Sequence 5&#8217; to 3&#8217; shRNA&#160;</td>
		</tr>
		<tr>
			<td>CN-A&#945; 1</td>
			<td>AATTGCCAGGAATTGGATTCAGTTTCTCGA 
			GAAACTGAATCCAATTCCTGGCTTTTTTTAT</td>
		</tr>
		<tr>
			<td>CN-A&#945; 2</td>
			<td>AATTCGCCAACCTTAACTCCATCAACTCGAG 
			TTGATGGAGTTAAGGTTGGCGTTTTTTTAT</td>
		</tr>
		<tr>
			<td>CN-A&#945; Scrb</td>
			<td>AATTGAGTGAATTGTCGCTCTAAGTCTCGAG 
			ACTTAGAGCGACAATTCACTCTTTTTTTAT</td>
		</tr>
		<tr>
			<td>CHOP 1</td>
			<td>AATTGGTCCTGTCCTCAGATGAAATCTCGAG 
			ATTTCATCTGAGGACAGGACCTTTTTTTAT</td>
		</tr>
		<tr>
			<td>CHOP 2</td>
			<td>AATTTGAAGAGAACGAGCGGCTCAACTCGA 
			GTTGAGCCGCTCGTTCTCTTCATTTTTTTAT</td>
		</tr>
		<tr>
			<td>CHOP Scrb&#160;</td>
			<td>AATTGAAGAGAGAAAGCGAACAATACTCGAG 
			TATTGTTCGCTTTCTCTCTTCTTTTTTTAT</td>
		</tr>
	</tbody>
</table>
Table 1. Forward construct sequences inserted to pKLG0.3 viral vector. Scrb: scramble.

Watch this Scientific Journal Video about Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons at JoVE.com

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

In the present study, the expression is knocked down of two downstream signaling components of the PERK pathway, the cytoprotective calcineurin and the pro-apoptotic CHOP, by using specific shRNAs. In opposite ways, these modulate the susceptibility of primary cortical neurons to neurite atrophy after induction of endoplasmic reticulum stress.

The accumulation of unfolded proteins within the endoplasmic reticulum (ER), caused by any stress condition, triggers the unfolded protein response (UPR) ...

molecular-modulation-lentivirus-delivered-specific-shrnas-endoplasmic

Nanyang Technological University

Research

JoVE Journal

Neuroscience

960 Views.  Universidad Nacional de Córdoba. Deze benadering kan worden gebruikt in celsysteemmodellen van endoplasmatische reticulumstress door de moleculaire expressie van downstream-paarcomponenten te manipuleren. Het belangrijkste voordeel van deze techniek is om de impact van gepaarde signalering te verwijderen door de visualisatie en meting van neurale paden. Deze methode kan bijdragen aan het begrijpen van de moleculaire basis van de overgang tussen acute en chronische fasen van ER-stress in diverse neurodegeneratieve ziektemodel...

Video: Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an entire gene expression pathway by inducing destruction and/or inhibiting translation of these targets. Several miRNAs play key roles in maintaining neuronal structure and function and in higher-level brain functions, and methods are sought for manipulating their levels for exploring these functions. Here, we present a direct in vivo method for examining the cognitive consequences of enforced miRNAs excess in mice by stereotactic injection of miRNA-encoding virus particles. Specifically, the current protocol involves injection into the hippocampal CA1 region, which contributes to mammalian memory consolidation, learning, and stress responses, and offers a convenient injection site. The coordinates are measured according to the mouse bregma and virus perfusion is digitally controlled and kept very slow. After injection, the surgery wound is sealed and the animals recover. Lentiviruses encoding silencers of the corresponding mRNA targets serve to implicate the specific miRNA/target interaction responsible for the observed effect, with na&iuml;ve mice, mice injected with saline and mice injected with "empty" lentivirus vectors as controls. One month post-injection, the animals are examined in the Morris Water Maze (MWM) for assessing their navigation learning and memory abilities. The MWM is a round tank filled with colored water with a small platform submerged 1 cm below the water surface. Steady visual cues around the tank allow for spatial navigation (sound and the earth's magnetic field may also assist the animals in navigating). Video camera monitoring enables measuring the route of swim and the time to find and amount the platform. The mouse is first taught that mounting the hidden platform offers an escape from the enforced swimming; it is then tested for using this escape and finally, the platform is removed and probe tests examine if the mouse remembers its previous location. Repeated tests over several consecutive days highlight improved performance of tested mice at shorter latencies to find and mount the platform, and as more direct routes to reach the platform or its location. Failure to show such improvement represents impaired learning and memory and/or anxiety, which may then be tested specifically (e.g. in the elevated plus maze). This approach enables validation of specific miRNAs and target transcripts in the studied cognitive and/or stress-related processes.

MicroRNAs have significant roles in brain structure and function. Here we describe a method to enforce hippocampal miRNA over-expression using stereotactic injection of an engineered miRNA-expressing lentivirus. This approach can serve as a relatively rapid way to assess the in vivo effects of over-expressed miRNAs in specific brain regions.

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an ...

Behavior

High Content Screening in Neurodegenerative Diseases

The functional annotation of genomes, construction of molecular networks and novel drug target identification, are important challenges that need to be addressed as a matter of great urgency1-4. Multiple complementary 'omics' approaches have provided clues as to the genetic risk factors and pathogenic mechanisms underlying numerous neurodegenerative diseases, but most findings still require functional validation5. For example, a recent genome wide association study for Parkinson's Disease (PD), identified many new loci as risk factors for the disease, but the underlying causative variant(s) or pathogenic mechanism is not known6, 7. As each associated region can contain several genes, the functional evaluation of each of the genes on phenotypes associated with the disease, using traditional cell biology techniques would take too long. 
	There is also a need to understand the molecular networks that link genetic mutations to the phenotypes they cause. It is expected that disease phenotypes are the result of multiple interactions that have been disrupted. Reconstruction of these networks using traditional molecular methods would be time consuming. Moreover, network predictions from independent studies of individual components, the reductionism approach, will probably underestimate the network complexity8. This underestimation could, in part, explain the low success rate of drug approval due to undesirable or toxic side effects. Gaining a network perspective of disease related pathways using HT/HC cellular screening approaches, and identifying key nodes within these pathways, could lead to the identification of targets that are more suited for therapeutic intervention.
	High-throughput screening (HTS) is an ideal methodology to address these issues9-12. but traditional methods were one dimensional whole-well cell assays, that used simplistic readouts for complex biological processes. They were unable to simultaneously quantify the many phenotypes observed in neurodegenerative diseases such as axonal transport deficits or alterations in morphology properties13, 14. This approach could not be used to investigate the dynamic nature of cellular processes or pathogenic events that occur in a subset of cells. To quantify such features one has to move to multi-dimensional phenotypes termed high-content screening (HCS)4, 15-17. HCS is the cell-based quantification of several processes simultaneously, which provides a more detailed representation of the cellular response to various perturbations compared to HTS. 
	HCS has many advantages over HTS18, 19, but conducting a high-throughput (HT)-high-content (HC) screen in neuronal models is problematic due to high cost, environmental variation and human error. In order to detect cellular responses on a 'phenomics' scale using HC imaging one has to reduce variation and error, while increasing sensitivity and reproducibility. 
	Herein we describe a method to accurately and reliably conduct shRNA screens using automated cell culturing20 and HC imaging in neuronal cellular models. We describe how we have used this methodology to identify modulators for one particular protein, DJ1, which when mutated causes autosomal recessive parkinsonism21. 
	Combining the versatility of HC imaging with HT methods, it is possible to accurately quantify a plethora of phenotypes. This could subsequently be utilized to advance our understanding of the genome, the pathways involved in disease pathogenesis as well as identify potential therapeutic targets.

We describe a methodology combining automated cell culturing with high-content imaging to visualize and quantify multiple cellular processes and structures, in a high-throughput manner. Such methods can aid in the further functional annotation of genomes as well as identify disease gene networks and potential drug targets.

The functional annotation of genomes, construction of molecular networks and novel drug target identification, are important challenges that need to be ...

Medicine

Lentivirus-mediated Genetic Manipulation and Visualization of Olfactory Sensory Neurons in vivo

Development of a precise olfactory circuit relies on accurate projection of olfactory sensory neuron (OSN) axons to their synaptic 
targets in the olfactory bulb (OB). The molecular mechanisms of OSN axon growth and targeting are not well understood. Manipulating gene expression and subsequent 
visualizing of single OSN axons and their terminal arbor morphology have thus far been challenging. To study gene function at the single cell level within a specified 
time frame, we developed a lentiviral based technique to manipulate gene expression in OSNs in vivo. Lentiviral particles are delivered to OSNs by microinjection 
into the olfactory epithelium (OE). Expression cassettes are then permanently integrated into the genome of transduced OSNs. Green fluorescent protein expression 
identifies infected OSNs and outlines their entire morphology, including the axon terminal arbor. Due to the short turnaround time between microinjection and 
reporter detection, gene function studies can be focused within a very narrow period of development. With this method, we have detected GFP expression within as 
few as three days and as long as three months following injection. We have achieved both over-expression and shRNA mediated knock-down by lentiviral microinjection. 
This method provides detailed morphologies of OSN cell bodies and axons at the single cell level in vivo, and thus allows characterization of candidate gene function 
during olfactory development.

Lentivirus-mediated Genetic Manipulation and Visualization of Olfactory Sensory Neurons in vivo

We present a lentiviral technique for genetic manipulation and visualization of single olfactory sensory neuron axon and its terminal arborization in vivo.

Development of a precise olfactory circuit relies on accurate projection of olfactory sensory neuron (OSN) axons to their synaptic 
targets in the ...

DNA Vector-based RNA Interference to Study Gene Function in Cancer

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA (siRNA) in gene silencing1, RNAi has become a powerful research tool in gene function studies. Compared to genetic deletion, RNAi-mediated gene silencing possesses many advantages, such as the ease with which it is carried out and its suitability to most cell lines. Multiple studies have demonstrated the applications of RNAi technology in cancer research. In particular, the development of the DNA vector-based technology to produce small hairpin RNA (shRNA) driven by the U6 or H1 promoter has made long term and inducible gene silencing possible2,3. Its use in combination with genetically engineered viral vectors, such as lentivirus, facilitates high efficiencies of shRNA delivery and/or integration into genomic DNA for stable shRNA expression. 
We describe a detailed procedure using the DNA vector-based RNAi technology to determine gene function, including construction of lentiviral vectors expressing shRNA, lentivirus production and cell infection, and functional studies using a mouse xenograft model. 
Various strategies have been reported in generating shRNA constructs. The protocol described here employing PCR amplification and a 3-fragment ligation can be used to directly and efficiently generate shRNA-containing lentiviral constructs without leaving any extra nucleotide adjacent to a shRNA coding sequence. Since the shRNA-expression cassettes created by this strategy can be cut out by restriction enzymes, they can be easily moved to other vectors with different fluorescent or antibiotic markers. Most commercial transfection reagents can be used in lentivirus production. However, in this report, we provide an economic method using calcium phosphate precipitation that can achieve over 90% transfection efficiency in 293T cells. Compared to constitutive shRNA expression vectors, an inducible shRNA system is particularly suitable to knocking down a gene essential to cell proliferation. We demonstrate the gene silencing of Yin Yang 1 (YY1), a potential oncogene in breast cancer4,5, by a Tet-On inducible shRNA system and its effects on tumor formation. Research using lentivirus requires review and approval of a biosafety protocol by the Biosafety Committee of a researcher's institution. Research using animal models requires review and approval of an animal protocol by the Animal Care and Use Committee (ACUC) of a researcher's institution.

RNA interference (RNAi) possesses many advantages over gene knockout and has been broadly used as a tool in gene functional studies. The invention of DNA vector-based RNAi technology has made long term and inducible gene knockdown possible, and also increased the feasibility of gene silencing in vivo.

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA ...

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes. The emergence of prion diseases in wildlife populations and their increasing threat to human health has led to increased efforts to find a treatment for these diseases. Recent studies have found numerous anti-prion compounds that can either inhibit the infectious PrPRes isomer or down regulate the normal cellular prion protein. However, most of these compounds do not cross the blood brain barrier to effectively inhibit PrPRes formation in brain tissue, do not specifically target neuronal PrPC, and are often too toxic to use in animal or human subjects. 
We investigated whether siRNA delivered intravascularly and targeted towards neuronal PrPC is a safer and more effective anti-prion compound. This report outlines a protocol to produce two siRNA liposomal delivery vehicles, and to package and deliver PrP siRNA to neuronal cells. The two liposomal delivery vehicles are 1) complexed-siRNA liposome formulation using cationic liposomes (LSPCs), and 2) encapsulated-siRNA liposome formulation using cationic or anionic liposomes (PALETS). For the LSPCs, negatively charged siRNA is electrostatically bound to the cationic liposome. A positively charged peptide (RVG-9r [rabies virus glycoprotein]) is added to the complex, which specifically targets the liposome-siRNA-peptide complexes (LSPCs) across the blood brain barrier (BBB) to acetylcholine expressing neurons in the central nervous system (CNS). For the PALETS (peptide addressed liposome encapsulated therapeutic siRNA), the cationic and anionic lipids were rehydrated by the PrP siRNA. This procedure results in encapsulation of the siRNA within the cationic or anionic liposomes. Again, the RVG-9r neuropeptide was bound to the liposomes to target the siRNA/liposome complexes to the CNS. Using these formulations, we have successfully delivered PrP siRNA to AchR-expressing neurons, and decreased the PrPC expression of neurons in the CNS.

The goal of this protocol is to use cationic/anionic liposomes with a neuro-targeting peptide as a CNS delivery system to enable siRNA to cross the BBB. The optimization of a delivery system for treatments, like siRNA, would allow for more treatment options for prion and other neurodegenerative diseases.

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...

Bioengineering

A Simple Alternative to Stereotactic Injection for Brain Specific Knockdown of miRNA

MicroRNAs (miRNAs) are key regulators of gene expression. In the brain, vital processes like neurodevelopment and neuronal functions depend on the correct expression of microRNAs. Perturbation of microRNAs in the brain can be used to model neurodegenerative diseases by modulating neuronal cell death. Currently, stereotactic injection is used to deliver miRNA knockdown agents to specific location in the brain. Here, we discuss strategies to design antagomirs against miRNA with locked nucleotide modifications (LNA). Subsequently describe a method for brain specific delivery of antagomirs, uniformly across different regions of the brain. This method is simple and widely applicable since it overcomes the surgery, associated injury and limitation of local delivery in stereotactic injections. We prepared a complex of neurotropic, cell-penetrating peptide Rabies Virus Glycoprotein (RVG) with antagomir against miRNA-29 and injected through tail vein, to specifically deliver in the brain. The antagomir design incorporated features that allow specific targeting of the miRNA and formation of non-covalent complexes with the peptide. The knock-down of the miRNA in neuronal cells, resulted in apoptotic cell death and associated behavioural defects. Thus, the method can be used for acute models of neuro-degeneration through the perturbation of miRNAs.

MicroRNAs play crucial roles in the brain and are potential targets for modeling neuro-degeneration. However, perturbing miRNA levels is challenging due to the short length of miRNA and inaccessibility of the brain tissue. This video presents a method for antagomir design and brain specific delivery using a neuropeptide in mice.

MicroRNAs (miRNAs) are key regulators of gene expression.  In the brain, vital processes like neurodevelopment and neuronal functions depend on the ...

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a workflow on how to combine artificial microRNA (miR)-mediated RNA interference with optogenetics to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices. The experimental approach involves the use of a single viral construct and a single neuron-specific promoter to drive the expression of both an optogenetic probe and artificial miR(s) against presynaptic gene(s). When stereotactically injected in the brain region of interest, the expressed construct makes it possible to stimulate with light exclusively the neurons with reduced expression of the gene(s) under investigation. This strategy does not require the development and maintenance of genetically modified mouse lines and can in principle be applied to other organisms and to any neuronal gene of choice. We have recently applied it to investigate how the knockdown of alternative splice isoforms of presynaptic P/Q-type voltage-gated calcium channels (VGCCs) regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses in acute hippocampal slices. A similar approach could also be used to manipulate and probe the neuronal circuitry in vivo.

This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

Studying ER Stress and UPR Activation During HIV-1 Infection in T-Cells

Measuring Endoplasmic Reticulum Stress and Unfolded Protein Response in HIV-1 Infected T-Cells and Analyzing its Role in HIV-1 Replication

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses have developed strategies to manipulate the host UPR, but there is a lack of detailed understanding of UPR modulation and its functional significance during HIV-1 infection in the literature. In this context, the current article describes the protocols used in our laboratory to measure ER stress levels and UPR during HIV-1 infection in T-cells and the effect of UPR on viral replication and infectivity. 
Thioflavin T (ThT) staining is a relatively new method used to detect ER stress in the cells by detecting protein aggregates. Here, we have illustrated the protocol for ThT staining in HIV-1 infected cells to detect and quantify ER stress. Moreover, ER stress was also detected indirectly by measuring the levels of UPR markers such as BiP, phosphorylated IRE1, PERK, and eIF2&#945;, splicing of XBP1, cleavage of ATF6, ATF4, CHOP, and GADD34 in HIV-1 infected cells, using conventional immunoblotting and quantitative reverse transcription polymerase chain reaction (RT-PCR). We have found that the ThT-fluorescence correlates with the indicators of UPR activation. This article also demonstrates the protocols to analyze the impact of ER stress and UPR modulation on HIV-1 replication by knockdown experiments as well as the use of pharmacological molecules. The effect of UPR on HIV-1 gene expression/replication and virus production was analyzed by Luciferase reporter assays and p24 antigen capture ELISA, respectively, whereas the effect on virion infectivity was analyzed by staining of infected reporter cells. Collectively, this set of methods provides a comprehensive understanding of the Unfolded Protein Response pathways during HIV-1 infection, revealing its intricate dynamics.

Author Spotlight: Exploring the Role of Unfolded Protein Response in HIV-1 Replication and Infectivity

Here, we describe some established methods to determine endoplasmic reticulum (ER) stress and unfolded protein response (UPR) activation, with particular emphasis on HIV-1 infection. This article also describes a set of protocols to investigate the effect of ER stress/UPR on HIV-1 replication and virion infectivity.

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses ...

Immunology and Infection

Visualizing Proteins in Primary Hippocampal Neurons by Live&#45;Cell Imaging

Using Live&#45;Cell Imaging to Measure the Effects of Pathological Proteins on Axonal Transport in Primary Hippocampal Neurons

Bidirectional transport of cargos along the axon is critical for maintaining functional synapses, neural connectivity, and healthy neurons. Axonal transport is disrupted in multiple neurodegenerative diseases, and projection neurons are particularly vulnerable because of the need to transport cellular materials over long distances and sustain substantial axonal mass. Pathological modifications of several disease-related proteins negatively affect transport, including tau, amyloid-&#946;, &#945;-synuclein, superoxide dismutase, and huntingtin, providing a potential common mechanism by which pathological proteins exert toxicity in disease. Methods to study these toxic mechanisms are necessary to understand neurodegenerative disorders and identify potential therapeutic interventions.
Here, cultured primary rodent hippocampal neurons are co-transfected with multiple plasmids to study the effects of pathological proteins on fast axonal transport using live-cell confocal imaging of fluorescently-tagged cargo proteins. We begin with the harvest, dissociation, and culturing of primary hippocampal neurons from rodents. Then, we co-transfect the neurons with plasmid DNA constructs to express fluorescent-tagged cargo protein and wild-type or mutant tau (used as an exemplar of pathological proteins). Axons are identified in live cells using an antibody that binds an extracellular&#160;domain of neurofascin, an axon initial segment protein, and an axonal region of interest is imaged to measure fluorescent cargo transport.
Using KymoAnalyzer, a freely available ImageJ macro, we extensively characterize the velocity, pause frequency, and directional cargo density of axonal transport, all of which may be affected by the presence of pathological proteins. Through this method, we identify a phenotype of increased cargo pause frequency associated with the expression of pathological tau protein. Additionally, gene-silencing shRNA constructs can be added to the transfection mix to test the role of other proteins in mediating transport disruption. This protocol is easily adaptable for use with other neurodegenerative disease-related proteins and is a reproducible method to study the mechanisms of how those proteins disrupt axonal transport.

Author Spotlight: Understanding the Impact of Pathological Proteins on Axonal Transport in Neurodegenerative Diseases

Here, we demonstrate how to combine transfection of primary hippocampal rodent neurons with live-cell confocal imaging to analyze pathological protein-induced effects on axonal transport and identify mechanistic pathways mediating these effects.

Bidirectional transport of cargos along the axon is critical for maintaining functional synapses, neural connectivity, and healthy neurons. Axonal ...

Tissue-Specific RNAi Tools to Identify Components for Systemic Stress Signaling

Over the past decade there has been a transformative increase in knowledge surrounding the regulation of protein quality control processes, unveiling the importance of intercellular signaling processes in the regulation of cell-nonautonomous proteostasis. Recent studies are now beginning to uncover signaling components and pathways that coordinate protein quality control from one tissue to another. It is therefore important to identify mechanisms and components of the cell-nonautonomous proteostasis network (PN) and its relevance for aging, stress responses and protein misfolding diseases. In the laboratory, we use genetic knockdown by tissue-specific RNAi in combination with stress reporters and tissue-specific proteostasis sensors to study this. We describe methodologies to examine and to identify components of the cell-nonautonomous PN that can act in tissues perceiving a stress condition and in responding cells to activate a protective response. We first describe how to generate hairpin RNAi constructs for constitutive genetic knockdown in specific tissues and how to perform tissue-specific genetic knockdown by feeding RNAi at different life stages. Stress reporters&#160;and behavioral assays function as&#160;valuable readouts&#160;that enable&#160;the fast screening of genes and conditions modifying systemic stress signaling processes. Finally, proteostasis sensors expressed in different tissues are utilized to determine changes in the tissue-specific capacity of the PN at different stages of development and aging. Thus, these tools should help clarify and allow monitoring the capacity of PN in specific tissues, while helping to identify components that function in different tissues to mediate cell-nonautonomous PN in an organism.

Maintenance of organismal proteostasis requires the coordination of protein quality control responses such as chaperone expression from one tissue to another. Here, we provide tools used in C. elegans that allow monitoring of proteostasis capacity in specific tissues and determine intercellular signaling responses.

Over the past decade there has been a transformative increase in knowledge surrounding the regulation of protein quality control processes, unveiling the ...

Molecular Modulation by Lentivirus-Delivered Specific shRNAs in Endoplasmic Reticulum Stressed Neurons

Samenvatting

Meer video's verkennen