This work was supported by &#34;Fondazione Varrone&#34; and Rieti University Hub &#34;Sabina Universitas&#34; to Vincenzo Mattei.
Figure 5 (A, B) reprinted by permission of the publisher Taylor &#38; Francis Ltd from: Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Martellucci, S., Manganelli V., Santacroce C., Santilli F., Piccoli L., Sorice M., Mattei V. Prion. 2018 Mar 4. Taylor &#38; Francis Ltd.

Third molars used in the study were excised from patients (13-19 years old) with no prior history of drug or alcohol consumption, all non-smoking and with appropriate oral hygiene. On the day of explanation, at the Department of Science Dentistry and Maxillofacial of &#34;Sapienza&#34; University of Rome, informed consent was obtained from the patients or the parents. Informed consent was obtained based on ethical considerations and approval of the ethics committee.
1. Tooth and Dental Pulp Extraction
<ol>
	<li>Preparation of appropriate medium for the conservation or transportation.
	<ol>
		<li>Prepare Dulbecco&#39;s Modified Eagle&#39;s medium low concentration of glucose (DMEM-L) with L-glutamine (494.5 mL).</li>
		<li>Add 5 mL of penicillin/streptomycin (1%) and 0.5 mL of amphotericin (0.1%).</li>
	</ol>
	</li>
	<li>Extract the third molar from the patient, quickly rinse it with PBS, put in a 15 mL test tube with the medium and transfer it to the laboratory in less than 2 h.</li>
	<li>Under a biohazard hood, open the tooth with a cutter by coronal cutting pass parallel and tangent through the roof of the pulp chamber.</li>
	<li>Gently remove the pulp with a small excavator and place it in a test tube.</li>
	<li>Wash with PBS three times and centrifuge at 2,500 x g for 10 min at RT.</li>
</ol>
2. Processing of the Dental Pulp and Stem Cell Release
<ol>
	<li>Remove the supernatant, resuspend the pellet in Hank&#39;s solution and place it in a Petri dish. Incubate for 2 h at 37 &#176;C in 5% CO2.</li>
	<li>Type IV collagenase solution preparation.
	<ol>
		<li>Prepare 0.8 mL of DMEM-L.</li>
		<li>Melt 1 mg of type IV collagenase in 0.8 mL of DMEM-L and vortex for several min.</li>
		<li>Add DMEM-L up to 1 mL to have a final concentration 1 mg/mL.</li>
		<li>Filter the solution with a 0.22 &#181;M filter.</li>
	</ol>
	</li>
	<li>Remove Hank&#39;s solution by centrifugation at 2,500 x g for 10 min at RT and divide the pulp into small slices approximatively 1 mm each one with a disposable scalpel.</li>
	<li>Place the pulp slices in a petri dish and incubate with 1 mL of type IV collagenase for 15 min at 37 &#176;C in 5% CO2.</li>
	<li>Medium culture preparation (500 mL).
	<ol>
		<li>To 445 mL of DMEM-L with L-glutamine.</li>
		<li>Add 50 mL of Fetal Bovine Serum (FBS) (10%).</li>
		<li>Add 5 mL of penicillin/streptomycin (1%).</li>
	</ol>
	</li>
	<li>Centrifuge the sample at 2,500 x g for 10 min at RT, remove the supernatant, resuspend the pellet in the medium (step 2.5) and culture in T25 flask specific for stem cell at 37 &#176;C in 5% CO2.</li>
</ol>
3. Stem Cell Culture and Propagation
<ol>
	<li>Every day check the culture and, after 3 days of growth, observe different clones of adherent cells within the flask.</li>
	<li>Every 3 days change the culture medium.</li>
	<li>Between 7 and 12 days, once the adherent cells have reach confluence, detach them by treating the cells with 1 mL of trypsin-EDTA for 3 min at 37 &#176;C or gently using a cell scraper.</li>
	<li>Add 4 ml (ratio 1:5) of the culture medium (step 2.5) to stop trypsin action.</li>
	<li>Centrifuge the cell suspension for 6 min at 259 x g, remove the supernatant and place the cells in a T25 flask to propagate. 
	NOTE: Every 3 days the cells reach confluence.</li>
	<li>Propagate the cells up to 21 or 28 days (approximately 6-8 passages) to avoid the presence of non-stem like cells in the culture.</li>
	<li>Detach the cells with 1 mL of trypsin-EDTA for 3 min at 37 &#176;C or gently scraping. Centrifuge the cell suspension for 6 min at 259 x g.</li>
	<li>Remove the supernatant and test the cells for cytofluorimetric analysis (step 6).</li>
</ol>
4. Transient PrPC Silencing by siRNA
<ol>
	<li>Culture the hDPSCsin 6-well plates (2 x 105 cell/mL) with 2 mL of culture medium (step 2.5) for 24 h.</li>
	<li>The day after, prepare siRNA PrP medium (400 &#181;L).
	<ol>
		<li>To a sterile test tube, add 384 &#181;L DMEM-L.</li>
		<li>Add 1 &#181;L for each type of siRNA PrP to DMEM-L to have a final concentration of 5 nM (4 siRNA PrP were used and verified by the supplier to guarantee a knockdown efficiency &#8805;70%).</li>
		<li>Add 12 &#181;L of transfectionreagent to DMEM-L.</li>
		<li>Vortex the mixture and incubate for 10 min at RT to allow the formation of transfection complexes.</li>
	</ol>
	</li>
	<li>Add 400 &#956;L of siRNA PrP medium to each sample and incubate for 6 h at 37 &#176;C.</li>
	<li>Without discarding siRNA PrP medium, add 1.6 mL (ratio of 1 to 5) of culture medium (step 2.5).</li>
	<li>Leave the cells for 72 h at 37 &#176;C.</li>
	<li>Remove the supernatant and wash 3 times with 2 mL of PBS at RT.</li>
	<li>Add 2 mL of neuronal culture medium for 7 and/or 14 days (step 5.1).</li>
	<li>Change the neuronal culture medium every 3 days. 
	NOTE: Replace the siRNA PrP solution each time replace the neuronal culture medium.</li>
	<li>At end of the time, wash 3 times with 2 mL of PBS at RT and test for neuronal surface antigens by Western Blot analysis.</li>
</ol>
5. Neuronal Induction Process of hDPSCs
<ol>
	<li>Neuronal culture medium preparation (500 mL).
	<ol>
		<li>Prepare 444.7 mL of basal media formulated to neuronal cells.</li>
		<li>To the medium add 50 mL of serum-free supplement used for supporting the long-term viability of embryonic and adult neuronal stem cells (10%).</li>
		<li>Add 200 &#181;L of basic Fibroblast Growth Factor (bFGF) (final concentration 40 ng/mL) and 100 &#181;L of Epidermal Growth Factor (EGF) to the medium (final concentration 20 ng/mL).</li>
		<li>Add 5 mL of penicillin/streptomycin (1%) to the medium.</li>
	</ol>
	</li>
	<li>Culture hDPSCs in 6-well plates (2 x 105 cell/mL) up to 28 days from the pulp separation and stimulate them with 2 mL of neuronal culture medium.</li>
	<li>Every 3 days discard the supernatant, wash 3 times with 2 mL of PBS at RT and replace 2 mL of the neuronal culture medium.</li>
	<li>After 7 and/or 14 days, detach the cells with 1 mL of trypsin-EDTA for 3 min at 37 &#176;C or gently with a scraper.</li>
	<li>Add 4 mL (ratio 1:5) of culture medium (step 2.5) to stop trypsin action.</li>
	<li>Test for the presence of neuronal surface antigens (step 6) or prion protein expression (step 7) by flow cytometry analysis.</li>
</ol>
6. Characterization of hDPSCs by Flow Cytometry
<ol>
	<li>Select mesenchymal stromal (MSC)-specific or neuronal surface antigens.</li>
	<li>Culture the hDPSCs in 6-well plates (2 x 105 cell/mL) with 2 mL of culture medium (step 2.5).</li>
	<li>Detach hDPSCs at 28 days from dental pulp separation or after 14 days of neuronal culture medium (step 5.1) with 1 mL of trypsin-EDTA for 3 min at 37 &#176;C or gently scraper.</li>
	<li>add 4 ml (ratio 1:5) of culture medium (step 2.5) to stop trypsin action and centrifugate at 259 x g for 6 min at RT. Wash another 2 times with 2 mL of PBS at RT.</li>
	<li>Fix the untreated or treated hDPSCs with 4% paraformaldehyde in PBS for 10 min at 4 &#176;C.</li>
	<li>Permeabilize hDPSCS with 0.1% (v/v) non-ionic surfactant in PBS for additional 10 min at RT.</li>
	<li>Perform the blocking with 5% nonfat dried milk in 1 mL of PBS for 1 h at RT.</li>
	<li>Wash 3 times with 1 mL of PBS and incubate the cells with anti-CD105 (1:100/5 x 105 cells), anti-CD44 (1:100/5 x 105 cells), anti-STRO-1 (1:100/5 x&#160;105 cells), anti-CD90 (1:100/5 x 105 cells), anti-CD73 (1:100/5 x 105 cells), anti &#946;3-Tubulin (1:100/5 x 105 cells), anti-NFH (1:100/5 x 105 cells) and anti-GAP43 (1:100/5 x 105 cells) mAb for 1 h at RT.</li>
	<li>Wash the cells 3 times with 1 mL of PBS and incubate with anti-mouse PE (1:50/5 x 105 cells) or anti-rabbit CY5 (1:50/5 x 105 cells) mAb for additional 1 h at RT.</li>
	<li>Use the secondary antibodies for gating the immunopositive cells (anti-mouse PE or anti-rabbit CY5 mAb) and analyze all samples with a Flow cytometer and acquire at least 20,000 events.</li>
</ol>
7. Evaluation of PrPC Expression in hDPSCs by Flow Cytometry Analysis
<ol>
	<li>Culture the hDPSCsin 6-well plates (2 x 105 cell/mL) with 2 mL of culture medium (step 2.5).</li>
	<li>Detach hDPSCs at 21 and 28 days from dental pulp separation and after 7 and/or 14 days with neuronal culture medium (step 5.1) with 1 mL of trypsin-EDTA and stop the trypsin action as described in step 6.4. Fix the specimens with 4% paraformaldehyde in PBS for 10 min at 4 &#176;C.</li>
	<li>Permeabilize with 0.1% (v/v) non-ionic surfactantin PBS for 10 min at RT. Remove the supernatant and stain the cells with rabbit anti-PrP mAb EP1802Y (1:50/5 x 105 cells) mAb for 1 h at RT. Incubate with anti-rabbit CY5 (1:50/5 x 105 cells) mAb for additional 1 h at RT.</li>
	<li>Analyze all samples with a Flow cytometer and acquire at least 20,000 events.</li>
</ol>

<ol>
	<li>Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+marrow+stromal+cell+assays:+in+vitro+and+in+vivo.">Bone marrow stromal cell assays: in vitro and in vivo.</a> Methods in Molecular Biology. 1130, 279-293 (2014).</li><li>Jiang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pluripotency+of+mesenchymal+stem+cells+derived+from+adult+marrow.">Pluripotency of mesenchymal stem cells derived from adult marrow.</a> Nature. 418, 1-49 (2002).</li><li>Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+mesenchymal+stem+cells+from+bone+marrow,+umbilical+cord+blood,+or+adipose+tissue.">Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue.</a> Stem Cells. 24, 1294-1301 (2006).</li><li>Zannettino, A. C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-potential+Human+adipose-derived+stromal+stem+cells+exhibit+a+perivascular+phenotype+in+vitro+and+in+vivo.">Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo.</a> Journal of Cellular Physiology. 214, 413-421 (2008).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+lipid+rafts+in+neuronal+differentiation+of+dental+pulp-derived+stem+cells.">Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells.</a> Experimental Cell Research. 339, 231-240 (2015).</li><li>Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hematopoietic+stem+cells+from+the+peripheral+blood.">Transplantation of hematopoietic stem cells from the peripheral blood.</a> Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).</li><li>Young, F. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonal+heterogeneity+in+the+neuronal+and+glial+differentiation+of+dental+pulp+stem/progenitor+cells.">Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells.</a> Stem Cells International. 2016, 1290561 (2016).</li><li>Pisciotta, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+dental+pulp+stem+cells+(hDPSCs):+isolation,+enrichment+and+comparative+differentiation+of+two+sub-populations.">Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations.</a> BMC Developmental Biology. 15, 14 (2015).</li><li>Atari, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+pulp+of+the+third+molar:+a+new+source+of+pluripotent-like+stem+cells.">Dental pulp of the third molar: a new source of pluripotent-like stem cells.</a> Journal of Cell Science. 125, 3343-3356 (2012).</li><li>Koyama, N., Okubo, Y., Nakao, K., Bessho, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+pluripotency+in+human+dental+pulp+cells.">Evaluation of pluripotency in human dental pulp cells.</a> Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).</li><li>Gronthos, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+properties+of+human+dental+pulp+stem+cells.">Stem cell properties of human dental pulp stem cells.</a> Journal of Dental Research. 81, 531-535 (2002).</li><li>Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+human+dental+pulp+stem+cells+differentiate+toward+functionally+active+neurons+under+appropriate+environmental+cues.">Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues.</a> Stem Cells. 7, 1787-1795 (2008).</li><li>Lee, Y. J., Baskakov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+form+of+the+prion+protein+is+involved+in+controlling+cell+cycle+dynamics,+self-renewal,+and+the+fate+of+human+embryonic+stem+cell+differentiation.">The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation.</a> Journal of Neurochemistry. 124, 310-322 (2013).</li><li>Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prion+protein+(PrPc)+positively+regulates+neural+precursor+proliferation+during+developmental+and+adult+mammalian+neurogenesis.">Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).</li><li>Wulf, M. A., Senatore, A., Aguzzi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biological+function+of+the+cellular+prion+protein:+an+update.">The biological function of the cellular prion protein: an update.</a> BMC Biology. 15, 34 (2017).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+cellular+prion+protein+to+mitochondrial+raft-like+microdomains+contributes+to+apoptosis+execution.">Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution.</a> Molecular Biology of the Cell. 22, 4842-4853 (2011).</li><li>Linden, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Biological+Function+of+the+Prion+Protein:+A+Cell+Surface+Scaffold+of+Signaling+Modules.">The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules.</a> Frontiers in Molecular Neuroscience. 10, 77 (2017).</li><li>Garofalo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+mitochondrial+raft-like+microdomains+in+the+regulation+of+cell+apoptosis.">Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis.</a> Apoptosis. , 621-634 (2015).</li><li>Watt, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reactive+oxygen+species-mediated+beta-cleavage+of+the+prion+protein+in+the+cellular+response+to+oxidative+stress.">Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress.</a> The Journal of Biological Chemistry. 280, 35914-35921 (2005).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphine+Withdrawal+Modifies+Prion+Protein+Expression+in+Rat+Hippocampus.">Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus.</a> PLoS One. 12, 0169571 (2017).</li><li>Hu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prion+proteins:+physiological+functions+and+role+in+neurological+disorders.">Prion proteins: physiological functions and role in neurological disorders.</a> Journal of the Neurological Sciences. 264, 1-8 (2008).</li><li>Sorice, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trafficking+of+PrPC+to+mitochondrial+raft-like+microdomains+during+cell+apoptosis.">Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis.</a> Prion. 6, 354-358 (2012).</li><li>Martellucci, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Prion+protein-EGFR+multimolecular+complex+during+neuronal+differentiation+of+human+dental+pulp-derived+stem+cells.">Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells.</a> Prion. 12 (2), 117-126 (2018).</li><li>Lee, Y. J., Baskokov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+form+of+the+prion+protein+guides+the+differentiation+of+human+embryonic+stem+cell+into+neuron-,+oligodendrocyte-+and+astrocyte-committed+lineages.">The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages.</a> Prion. 8, 266-275 (2014).</li><li>Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+characterization+of+human+dental+pulp+cells:+various+isolation+methods+and+culturing+environments.">In vitro characterization of human dental pulp cells: various isolation methods and culturing environments.</a> Cell and Tissue Research. 324, 225-236 (2006).</li><li>Suchanek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+pulp+stem+cells+and+their+characterization.">Dental pulp stem cells and their characterization.</a> Biomedical papers of the Medical Faculty of the University Palack&#253;. 153, 31-35 (2009).</li><li>Bressan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Donor+age-related+biological+properties+of+human+dental+pulp+stem+cells+change+in+nanostructured+scaffolds.">Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds.</a> PLoS One. 7 (11), 49146 (2012).</li></ol>

The authors have nothing to disclose.

In this work, we focused on methodology for isolation and neuronal differentiation of hDPSCs; moreover, we evaluated the role of PrPC in this process. There are several methods to isolate and differentiate hDPSCs in neuron-like cells and critical steps during the process. hDPSCs are able to differentiate in several lineages such as chondroblasts, adipocytes, osteoblasts, and neurons. In our paper, we investigated the mechanisms of neuronal differentiation and the presence of PrPC. As discussed above, these cells express typical mesenchymal stromal-specific surface antigens such as CD44, CD90, CD105, CD73, and STRO-110,25,26.
In the protocol, several critical steps can cause the failure of the separation procedure. The first critical step is represented by the choice of patients27. In our experience, we found that increasing age of donors (&#62;20) gradually reduces the ability of proliferation and differentiation of stem cells. In our experiments, we used third molars excised from patients aged 13-19 years old and with no prior history of drug or alcohol consumption, all non-smoking and with appropriate oral hygiene.
The second critical step is represented by the choice of the enzyme to separate the cells from the pulp tissue, which could represent the main hot step of stem cells separation procedure. In fact, we realized that a wide use of collagenase I and II, enzymes that can be too aggressive, could damage the cells present in the pulp tissue during the separation process. For this reason, we decided to use collagenase IV because this kind of collagenase as lower tryptic activity than collagenase type I and II. Following exactly the procedure, it is possible to obtain stem cells in 90% of the treated teeth.
After the separation, the solution containing hDPSCs is cultured in appropriate flasks until the 6&#176; passage (approximatively 21-28 days) to avoid the presence of non-stem cells in the culture. At 28 days, they were tested for the presence of typical mesenchymal antigens (as referenced above) and used for experiments only when they were positive. In fact, despite the progress made throughout years on hDPSCs, there are still important limitations represented by the extreme heterogeneity of the population.
As shown by several authors, there are different cell population types in the dental pulp and, to date, it&#39;s unknown what is the best phenotypes able to differentiate into each mesenchymal lineage (chondroblasts, adipoblasts, osteoblasts or neurons). To avoid the current limitations of our and other procedures, the next step will be to select cellular populations with specific phenotypes using specific monoclonal antibodies.
In previous work, we showed that PrPC is expressed from hDPSCs. In fact, it is possible to observe a weak positivity at 21 days and an increase of PrPC content at 28 days. Furthermore, we observed that during EGF/bFGF-mediated neuronal induction, PrPC content was further increased. Moreover, we investigated the role of endogenous PrPC in neuronal induction process of hDPSCs. The transient silencing of PrPC prevented the differentiation process of hDPSCs induced by EGF/bFGF23.
We fine-tuned and improved the methods of isolation, separation and in vitro cultivation of hDPSCs with simple and versatile procedures. These innovations allow obtaining more efficient cell clones and the large-scale expansion of the mesenchymal stem cells. Also, we suggest that the hDPSCs are an excellent experimental model to study cellular and molecular mechanisms of MSCs neuronal differentiation process.

Mesenchymal stem cells have been isolated from several tissues, including bone marrow, umbilical cord blood, human dental pulp, adipose tissue, and blood1,2,3,4,5,6. As reported by several authors, hDPSCs show plastic adherence, a typical fibroblast-like morphology. These represent a highly heterogeneous population with distinct clones and differences in proliferative and differentiating capacity7,8. hDPSCs express specific markers for mesenchymal stem cells (i.e. CD44, CD90, CD73, CD105, STRO-1), they are negative for some hematopoietic markers (such as CD14 and CD19) and are capable of in vitro multilineage differentiation9,10,11.
Several authors have shown that these cells are able to differentiate into neuron-like cells using different protocols, that include the addition of NGF, bFGF, EGF in combination&#160;with&#160;the specific media and supplements7,12. Also, many proteins are involved during neuronal differentiation process and, among these, several papers show a relevant role and significant expression of cellular prion protein (PrPC), both in embryonic and adult stem cells13,14. PrPC represents a pleiotropic molecule capable of performing different functions inside cells as copper metabolism, apoptosis, and resistance to oxidative stress15,16,17,18,19,20,21,22.
In our previous paper23, we investigated the role of PrPC in the hDPSCs neuronal differentiation process. In fact, hDPSCs express precociously PrPC and, after neuronal differentiation, it was possible to observe an additional increase. Other authors hypothesized a possible role of PrPC in neuronal differentiation processes of stem cells. Indeed, PrPC drives the differentiation of human embryonic stem cells into neurons, oligodendrocytes, and astrocytes24. The purpose of this study was to emphasize the methodology for obtaining stem cells from dental pulp, its differentiation process and the role of PrPC during neuronal differentiation.

<table><tbody><tr><td>Amphotericin B solution</td><td>Sigma-Aldrich</td><td>A2942</td><td>It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce</td></tr><tr><td>Anti-B3tubulin</td><td>Cell Signaling Technology&amp;nbsp;</td><td>#4466</td><td>One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system</td></tr><tr><td>Anti-CD105&amp;nbsp;</td><td>BD Biosciences</td><td>611314</td><td>Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail</td></tr><tr><td>Anti-CD44</td><td>Millipore</td><td>CBL154-20ul</td><td>Positive cell markers antibodies directed against mesenchymal stem cells</td></tr><tr><td>Anti-CD73&amp;nbsp;</td><td>Cell Signaling Technology&amp;nbsp;</td><td>13160</td><td>CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides</td></tr><tr><td>Anti-CD90</td><td>Millipore</td><td>CBL415-20ul</td><td>Positive cell markers antibodies directed against mesenchymal stem cells</td></tr><tr><td>Anti-GAP43&amp;nbsp;</td><td>Cell Signaling Technology&amp;nbsp;</td><td>#8945</td><td>Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity</td></tr><tr><td>Anti-mouse PE&amp;nbsp;</td><td>Abcam</td><td>ab7003</td><td>Is an antibody used in in flow cytometry or FACS analysis</td></tr><tr><td>Anti-NFH&amp;nbsp;</td><td>Cell Signaling Technology&amp;nbsp;</td><td>#2836</td><td>Is an antibody that detects endogenous levels of total Neurofilament-H protein</td></tr><tr><td>Anti-PrP mAb EP1802Y&amp;nbsp;</td><td>Abcam</td><td>ab52604</td><td>Rabbit monoclonal [EP 1802Y] to Prion protein PrP</td></tr><tr><td>Anti-rabbit CY5&amp;nbsp;</td><td>Abcam</td><td>ab6564</td><td>Is an antibody used in in flow cytometry or FACS analysis</td></tr><tr><td>Anti-STRO 1</td><td>Millipore</td><td>MAB4315-20ul</td><td>Positive cell markers antibodies directed against mesenchymal stem cells</td></tr><tr><td>B27 Supp XF CTS</td><td>Gibco by life technologies</td><td>A14867-01</td><td>B-27&amp;nbsp; can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture</td></tr><tr><td>BD Accuri C6 flow cytometer&amp;nbsp;</td><td>BD Biosciences</td><td>AC6531180187</td><td>Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm)</td></tr><tr><td>BD Accuri C6 Software&amp;nbsp;</td><td>BD Biosciences</td><td></td><td>Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results</td></tr><tr><td>bFGF</td><td>PeproThec, DBA</td><td>100-18B</td><td>basic Fibroblast Growth Factor&amp;nbsp;</td></tr><tr><td>Centrifuge CL30R</td><td>Termo fisher Scientific</td><td>11210908</td><td>it is a device that is used for the separation of fluids,gas or liquid, based on density</td></tr><tr><td>CO2 Incubator 3541</td><td>Termo fisher Scientific</td><td>317527-185</td><td>it ensures optimal and reproducible growth conditions for cell cultures</td></tr><tr><td>Collagenase, type IV&amp;nbsp;</td><td>Life Technologies</td><td>17104019</td><td>Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen</td></tr><tr><td>Disposable scalpel&amp;nbsp;</td><td>Swann-Morton</td><td>501</td><td>It is use to cut tissues</td></tr><tr><td>DMEM-L</td><td>Euroclone</td><td>ECM0060L</td><td>Dulbecco&#039;s Modified Eagle&#039;s Medium Low Glucose with L-Glutamine with Sodium Pyruvate</td></tr><tr><td>EGF</td><td>PeproThec, DBA</td><td>AF-100-15</td><td>Epidermal Growth Factor&amp;nbsp;</td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco by life technologies</td><td>10270-106</td><td>FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems</td></tr><tr><td>Filtropur BT50 0.2,500 mL Bottle top filter</td><td>Sarstedt</td><td>831,823,101</td><td>it is a device that is used for filtration of solutions</td></tr><tr><td>Flexitube GeneSolution for PRNP</td><td>Qiagen</td><td>GS5621</td><td>4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA&amp;nbsp; N.2 CAGCAAATAACCATTGGTTAA&amp;nbsp; N.3. CTGAATCGTTTCATGTAAGAA&amp;nbsp; N.4&amp;nbsp; CAGTGACTATGAGGACCGTTA</td></tr><tr><td>Hank&#039;s solution 1x</td><td>Gibco by life technologies</td><td>240200083</td><td>The essential function of Hanks&amp;prime; Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells</td></tr><tr><td>HiPerFect Transfection Reagent&amp;nbsp;</td><td>Qiagen</td><td>301705</td><td>HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations</td></tr><tr><td>Neurobasal A&amp;nbsp;</td><td>Gibco by life technologies</td><td>10888022</td><td>Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons&amp;nbsp;</td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich</td><td>30525-89-4</td><td>Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures</td></tr><tr><td>penicillin/streptomycin&amp;nbsp;</td><td>Euroclone</td><td>ECB3001D&amp;nbsp;</td><td>It is use to supplement cell culture media to control bacterial contamination</td></tr><tr><td>Phosphate buffered saline&amp;nbsp; (PBS)</td><td>Euroclone</td><td>ECB4004LX10&amp;nbsp;</td><td>PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range</td></tr><tr><td>TC-Platte 6 well, Cell+,F</td><td>Sarstedt</td><td>833,920,300</td><td>It is a growth surface for adherent cells</td></tr><tr><td>Tissue culture flask T-25,Cell+,Vented Cap</td><td>Sarstedt</td><td>833,910,302</td><td>Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag</td></tr><tr><td>Triton X-100&amp;nbsp;</td><td>Sigma-Aldrich</td><td>9002-93-1</td><td>Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions</td></tr><tr><td>Trypsin-EDTA&amp;nbsp;</td><td>Euroclone</td><td>ECB3052D&amp;nbsp;</td><td>Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface</td></tr><tr><td>Tube</td><td>Sarstedt</td><td>62,554,502</td><td>Tube 15 mL, 120 mm x17 mm, PP</td></tr><tr><td>VBH 36 C2 Compact</td><td>Steril</td><td>ST-003009000</td><td>Offers totally protection for the enviroment and worker</td></tr><tr><td>ZEISS Axio Vert.A1 &amp;ndash; Inverted&amp;nbsp;Microscope</td><td>Zeiss</td><td>3849000962</td><td>ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods.</td></tr></tbody></table>

isolation, propagation, and prion protein expression during neuronal differentiation of human dental pulp stem cells

Bioethical issues related to the manipulation of embryonic stem cells have hindered advances in the field of medical research. For this reason, it is very important to obtain adult stem cells from different tissues such as adipose, umbilical cord, bone marrow and blood. Among the possible sources, dental pulp is particularly interesting because it is easy to obtain in respect of bioethical considerations. Indeed, human Dental Pulp Stem Cells (hDPSCs) are a type of adult stem cells able to differentiate in neuronal-like cells and can be obtained from the third molar of healthy patients (13-19 ages). In particular, the dental pulp was removed with an excavator, cut into small slices, treated with collagenase IV and cultured in a flask. To induce the neuronal differentiation, hDPSCs were stimulated with EGF/bFGF for 2 weeks. Previously, we have demonstrated that during the differentiation process the content of cellular prion Protein (PrPC) in hDPSCs increased. The cytofluorimetric analysis showed an early expression of PrPC that increased after neuronal differentiation process. Ablation of PrPC by siRNA PrP prevented neuronal differentiation induced by EGF/bFGF. In this paper, we illustrate that as we enhanced the isolation, separation and in vitro cultivation methods of hDPSCs with several easy procedures, more efficient cell clones were obtained and large-scale expansion of the mesenchymal stem cells (MSCs) was observed. We also show how the hDPSCs, obtained with methods detailed in the protocol, are an excellent experimental model to study the neuronal differentiation process of MSCs and subsequent cellular and molecular processes.

The isolation and separation procedures of hDPSCs from dental pulp, obtained from the third molar, are complex processes in which small changes can lead a ruinous result. In this paper, we use the protocol of Arthur et al.12 with several improvements. A representative scheme of procedures is shown in Figure 1.
hDPSCs represents a heterogeneous population of cells with distinct clones and differences in proliferative and differentiating capacity7,8. After pulp separation and seeding of tiny fragments of pulp, we observed clusters of cells expanding on the periphery. Figure 2 shows a small cluster of cells at 1 day (left panel), 4 days (central panel) and 7 days (right panel) from dental pulp separation. Generally, these clusters of cells grow up to reach the confluence approximately between 7 and 12 days.
These cells, after neuronal differentiation induced by EGF/bFGF, reduce their growth and, after two weeks it was possible to observe significant changes in the cell morphology and neurites outgrowth (Figure 3).
In Figure 4, we show that untreated hDPSCs express multipotent mesenchymal stromal specific surface antigens such as CD44, CD90, CD105, CD73, and STRO-15,9. Otherwise, after appropriate neuronal induction stimuli, hDPSCs express specific neuronal markers such as &#946;3-Tubulin, NFH, and GAP43. hDPSCs, untreated or treated with neuronal induction stimuli, do not express hematopoietic markers such as CD14 and CD19.
In Figure 5, we show that hDPSCs express precociously PrPC (21 and 28 days) and, after neuronal differentiation process induced by EGF/bFGF for additional 7 and 14 days, the PrPC content increased (Figure 5A). Since several authors reported that PrPC is involved in the cellular neuronal differentiation, we evaluated the role of endogenous PrPC in this process. Therefore, a small interfering RNA (siRNA PrP) was applied to ablate PrPC and its function. Pretreatment with siRNA for 72 h before EGF/bFGF stimuli for 14 days prevents the expression of neuronal markers B3-tubulin and NHF (Figure 5B). The data show that silencing of PrPC by siRNA affected the neuronal differentiation process of hDPSCs, induced by EGF/bFGF after 2 weeks.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59282/59282fig1.jpg" /> 
Figure 1: Scheme of Dental pulp separation from the third molar. The tooth has been opened with a cutter by coronal cutting pass parallel and tangent through the roof of the pulp chamber and the pulp was gently removed under sterile conditions with a small excavator and placed in a test tube. The pulp, after hank&#39;s solution treatment, was cut into slices and treated with collagenase IV for 15 min and propagated in a T25 flask. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59282/59282fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59282/59282fig2.jpg" /> 
Figure 2: hDPSCs morphology at different days from dental pulp separation by phase contrast microscope. Morphology of hDPSCs from dental pulp at different days (1, 4, 7) from dental pulp separation. Scale bars = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59282/59282fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59282/59282fig3.jpg" /> 
Figure 3:&#160;Neurite outgrowth of hDPSCs by phase contrast microscope. Morphology of hDPSCs from dental pulp untreated or treated with EGF/bFGF for 14 days. Scale bars = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59282/59282fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59282/59282fig4.jpg" /> 
Figure 4: hDPSCs characterization. Flow cytometry analysis of CD44, CD90, CD105, CD73, STRO-1, CD14, CD19, &#946;3-Tubulin, NFH and GAP43 expression in hDPSCs untreated or treated with EGF/bFGF for 14 days. Histograms represent log fluorescence vs cell number, gated on cell population of a side scatter/forward scatter (SS/FS) histogram. Each panel was compared with the corresponding secondary antibodies as a negative control. A representative experiment among 3 is shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59282/59282fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59282/59282fig5.jpg" /> 
Figure 5: Role of PrPC during neuronal differentiation of hDSPCs. (A) Cytofluorimetric analysis of PrPC expression untreated (21 and 28 days from dental pulp separation) and after additional 7 and 14 days with neuronal induction media EGF/bFGF. Each panel was compared with the corresponding IgG negative isotype control. A representative experiment among 3 is shown. (B) Western blot analysis of neuronal markers &#946;3-Tubulin and NFH expression (28 days from dental pulp separation) and after additional 14 days with neuronal induction media EGF/bFGF in the presence or absence of siRNA PrP. This figure 5 (A, B) has been modified from &#34;Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells&#34; 23. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59282/59282fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells at JoVE.com

Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells

Here we present a protocol for human Dental Pulp Stem Cells isolation and propagation in order to evaluate the prion protein expression during neuronal differentiation process.

Bioethical issues related to the manipulation of embryonic stem cells have hindered advances in the field of medical research. For this reason, it is very ...

isolation-propagation-prion-protein-expression-during-neuronal

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

7.3K Views.  Sabina Universitas - Rieti University Hub. De standaard manier om een stamcel te verkrijgen uit tandheelkundige pulp is slecht efficiënt, en dit hangt af van verschillende variabele. Ons protocol toegestaan om een succesvolle isolatie van stamcel van behandelde tanden te verkrijgen in 90% van de gevallen. Het verkrijgen van een hoog aantal cellen in een paar weken is het belangrijkste voordeel.Dat stelt ons in staat om de cel te gebruiken in regeneratieve geneeskunde en om een biobank te creëren die andere wetenschappers van ...

Video: Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

Isolation and Differentiation of Adipose-Derived Stem Cells from Porcine Subcutaneous Adipose Tissues

Obesity is an unconstrained worldwide epidemic. Unraveling molecular controls in adipose tissue development holds promise to treat obesity or diabetes. Although numerous immortalized adipogenic cell lines have been established, adipose-derived stem cells from the stromal vascular fraction of subcutaneous white adipose tissues provide a reliable cellular system ex vivo much closer to adipose development in vivo. Pig adipose-derived stem cells (pADSC) are isolated from 7- to 9-day old piglets. The dorsal white fat depot of porcine subcutaneous adipose tissues is sliced, minced and collagenase digested. These pADSC exhibit strong potential to differentiate into adipocytes. Moreover, the pADSC also possess multipotency, assessed by selective stem cell markers, to differentiate into various mesenchymal cell types including adipocytes, osteocytes, and chondrocytes. These pADSC can be used for clarification of molecular switches in regulating classical adipocyte differentiation or in direction to other mesenchymal cell types of mesodermal origin. Furthermore, extended lineages into cells of ectodermal and endodermal origin have recently been achieved. Therefore, pADSC derived in this protocol provide an abundant and assessable source of adult mesenchymal stem cells with full multipotency for studying adipose development and application to tissue engineering of regenerative medicine.

This protocol describes the isolation of pig adipose-derived stem cells (pADSC) from subcutaneous adipose tissues with examination of multipotency. The multipotent pADSC are used to delineate processes of adipocyte differentiation and study transdifferentiation into multiple cell lineages of mesodermal mesenchyme or further lineages of ectoderm and endoderm for regenerative studies.

Obesity is an unconstrained worldwide epidemic. Unraveling molecular controls in adipose tissue development holds promise to treat obesity or diabetes. ...

Isolation, Characterization and MicroRNA-based Genetic Modification of Human Dental Follicle Stem Cells

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such as initial massive cell death and low therapeutic effects, impaired their broad clinical translation. Genetic engineering of stem cells prior to transplantation emerged as a promising method to optimize therapeutic stem cell effects. However, safe and efficient gene delivery systems are still lacking. Therefore, the development of suitable methods may provide an approach to resolve current challenges in stem cell-based therapies.
The present protocol describes the extraction and characterization of human dental follicle stem cells (hDFSCs) as well as their non-viral genetic modification. The postnatal dental follicle unveiled as a promising and easily accessible source for harvesting adult multipotent stem cells possessing high proliferation potential. The described isolation procedure presents a simple and reliable method to harvest hDFSCs from impacted wisdom teeth. Also this protocol comprises methods to define stem cell characteristics of isolated cells. For genetic engineering of hDFSCs, an optimized cationic lipid-based transfection strategy is presented enabling highly efficient microRNA introduction without causing cytotoxic effects. MicroRNAs are suitable candidates for transient cell manipulation, as these small translational regulators control the fate and behavior of stem cells without the hazard of stable genome integration. Thus, this protocol represents a safe and efficient procedure for engineering of hDFSCs that may become important for optimizing their therapeutic efficacy.

This protocol describes the transient genetic engineering of dental stem cells extracted from the human dental follicle. The applied non-viral modification strategy may become a basis for the improvement of therapeutic stem cell products.

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such ...

Genetics

Rapid Neuronal Differentiation of Induced Pluripotent Stem Cells for Measuring Network Activity on Micro-electrode Arrays

Neurons derived from human induced Pluripotent Stem Cells (hiPSCs) provide a promising new tool for studying neurological disorders. In the past decade, many protocols for differentiating hiPSCs into neurons have been developed. However, these protocols are often slow with high variability, low reproducibility, and low efficiency. In addition, the neurons obtained with these protocols are often immature and lack adequate functional activity both at the single-cell and network levels unless the neurons are cultured for several months. Partially due to these limitations, the functional properties of hiPSC-derived neuronal networks are still not well characterized. Here, we adapt a recently published protocol that describes production of human neurons from hiPSCs by forced expression of the transcription factor neurogenin-212. This protocol is rapid (yielding mature neurons within 3 weeks) and efficient, with nearly 100% conversion efficiency of transduced cells (&#62;95% of DAPI-positive cells are MAP2 positive). Furthermore, the protocol yields a homogeneous population of excitatory neurons that would allow the investigation of cell-type specific contributions to neurological disorders. We modified the original protocol by generating stably transduced hiPSC cells, giving us explicit control over the total number of neurons. These cells are then used to generate hiPSC-derived neuronal networks on micro-electrode arrays. In this way, the spontaneous electrophysiological activity of hiPSC-derived neuronal networks can be measured and characterized, while retaining interexperimental consistency in terms of cell density. The presented protocol is broadly applicable, especially for mechanistic and pharmacological studies on human neuronal networks.

We modify and implement a previously published protocol describing the rapid, reproducible, and efficient differentiation of human&#160;induced&#160;Pluripotent Stem Cells (hiPSCs) into excitatory cortical neurons12. Specifically, our modification allows for control of neuronal cell density and use on micro-electrode arrays to measure electrophysiological properties at the network level.

Neurons derived from human induced Pluripotent Stem Cells (hiPSCs) provide a promising new tool for studying neurological disorders. In the past decade, ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Medicine

The Specification of Telencephalic Glutamatergic Neurons from Human Pluripotent Stem Cells

Here, a stepwise procedure for efficiently generating telencephalic glutamatergic neurons from human pluripotent stem cells (PSCs) has been described. The differentiation process is initiated by breaking the human PSCs into clumps which round up to form aggregates when the cells are placed in a suspension culture. The aggregates are then grown in hESC medium from days 1-4 to allow for spontaneous differentiation. During this time, the cells have the capacity to become any of the three germ layers. From days 5-8, the cells are placed in a neural induction medium to push them into the neural lineage. Around day 8, the cells are allowed to attach onto 6 well plates and differentiate during which time the neuroepithelial cells form. These neuroepithelial cells can be isolated at day 17. The cells can then be kept as neurospheres until they are ready to be plated onto coverslips. Using a basic medium without any caudalizing factors, neuroepithelial cells are specified into telencephalic precursors, which can then be further differentiated into dorsal telencephalic progenitors and glutamatergic neurons efficiently. Overall, our system provides a tool to generate human glutamatergic neurons for researchers to study the development of these neurons and the diseases which affect them.

This procedure yields telencephalic neurons by going through checkpoints which are similar to those observed during human development. The cells are allowed to spontaneously differentiate, are exposed to factors which push them towards the neural lineage, are isolated, and are plated onto coverslips to allow for terminal differentiation and maturation.

Here, a stepwise procedure for efficiently generating telencephalic glutamatergic neurons from human pluripotent stem cells (PSCs) has been described. The ...

Neuroscience

A Co-Culture Method to Study Neurite Outgrowth in Response to Dental Pulp Paracrine Signals

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. Without sensory innervation, daily oral activities would cause irreparable damage. Despite its importance, the roles of innervation in tooth development and maintenance have been largely overlooked. Several studies have demonstrated that DP cells secrete extracellular matrix proteins and paracrine signals to attract and guide TG axons into and throughout the tooth. However, few studies have provided detailed insight into the crosstalk between the DP mesenchyme and neuronal afferents. To address this gap in knowledge, researchers have begun to utilize co-cultures and a variety of techniques to investigate these interactions. Here, we demonstrate the multiple steps involved in co-culturing primary DP cells with TG neurons dispersed on an overlying transwell filter with large diameter pores to allow axonal growth through the pores. Primary DP cells with the gene of interest flanked by loxP sites were utilized to facilitate gene deletion using an Adenovirus-Cre-GFP recombinase system. Using TG neurons from the Thy1-YFP mouse allowed for precise afferent imaging, with expression well above background levels by confocal microscopy. The DP responses can be investigated via protein or RNA collection and analysis, or alternatively, through immunofluorescent staining of DP cells plated on removable glass coverslips. Media can be analyzed using techniques such as proteomic analyses, although this will require albumin depletion due to the presence of fetal bovine serum in the media. This protocol provides a simple method that can be manipulated to study the morphological, genetic, and cytoskeletal responses of TG neurons and DP cells in response to the controlled environment of a co-culture assay.

We describe the isolation, dispersion and plating of dental pulp (DP) primary cells with trigeminal (TG) neurons cultured atop overlying transwell filters. Cellular responses of DP cells can be analyzed with immunofluorescence or RNA/protein analysis. Immunofluorescence of neuronal markers with confocal microscopy permits the analysis of neurite outgrowth responses.

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. ...

Isolation, Culture, and Characterization of Dental Pulp Stem Cells from Human Deciduous and Permanent Teeth

In the realm of regenerative medicine and therapeutic applications, stem cell research is rapidly gaining traction. Dental pulp stem cells (DPSCs), which are present in both deciduous and permanent teeth, have emerged as a vital stem cell source due to their accessibility, adaptability, and innate differentiation capabilities. DPSCs offer a readily available and abundant reservoir of mesenchymal stem cells, showcasing impressive versatility and potential, particularly for regenerative purposes. Despite their promise, the main hurdle lies in effectively isolating and characterizing DPSCs, given their representation as a minute fraction within dental pulp cells. Equally crucial is the proper preservation of this invaluable cellular resource. The two predominant methods for DPSC isolation are enzymatic digestion (ED) and outgrowth from tissue explants (OG), often referred to as spontaneous growth. This protocol concentrates primarily on the enzymatic digestion approach for DPSC isolation, intricately detailing the steps encompassing extraction, in-lab processing, and cell preservation. Beyond extraction and preservation, the protocol delves into the differentiation prowess of DPSCs. Specifically, it outlines the procedures employed to induce these stem cells to differentiate into adipocytes, osteoblasts, and chondrocytes, showcasing their multipotent attributes. Subsequent utilization of colorimetric staining techniques facilitates accurate visualization and confirmation of successful differentiation, thereby validating the caliber and functionality of the isolated DPSCs. This comprehensive protocol functions as a blueprint encompassing the entire spectrum of dental pulp stem cell extraction, cultivation, preservation, and characterization. It underscores the substantial potential harbored by DPSCs, propelling forward stem cell exploration and holding promise for future regenerative and therapeutic breakthroughs.

This protocol emphasizes the extraction, culture, and preservation of multipotent stem cells from dental pulp through enzymatic digestion. Additionally, it demonstrates their potential to differentiate into osteoblasts, adipocytes, and chondrocytes, highlighting the importance of precision and consistency in the process.

In the realm of regenerative medicine and therapeutic applications, stem cell research is rapidly gaining traction. Dental pulp stem cells (DPSCs), which ...

Bioengineering

Establishing the Primary Culture of Dental Pulp Stem Cells

Primary Culture of Dental Pulp Stem Cells

The human dental pulp represents a promising multipotent stem cell reservoir with pre-eminent regenerative competence that can be harvested from an extracted tooth. The neural crest-derived ecto-mesenchymal origin of dental pulp stem cells (DPSCs) bestows a high degree of plasticity that owes to its multifaceted benefits in tissue repair and regeneration. There are various practical ways of harvesting, maintaining, and proliferating adult stem cells being investigated for their use in regenerative medicine. In this work, we demonstrate the establishment of a primary mesenchymal stem cell culture from dental tissue by the explant culture method. The isolated cells were spindle-shaped and adhered to the plastic surface of the culture plate. The phenotypic characterization of these stem cells showed positive expression of the international society of cell therapy (ISCT)-recommended cell surface markers for MSC, such as CD90, CD73, and CD105. Further, negligible expression of hematopoietic (CD45) and endothelial markers (CD34), and less than 2% expression of HLA-DR markers, confirmed the homogeneity and purity of the DPSC cultures. We further illustrated their multipotency based on differentiation to adipogenic, osteogenic, and chondrogenic lineages. We also induced these cells to differentiate into hepatic-like and neuronal-like cells by adding corresponding stimulation media. This optimized protocol will aid in the cultivation of a highly expandable population of mesenchymal stem cells to be utilized in the laboratory or for preclinical studies. Similar protocols can be incorporated into clinical setups for practicing DPSC-based treatments.

Author Spotlight: Advancing Tissue Regeneration and Disease Modeling with Dental Pulp Stem Cells

This article provides a stepwise guide to establish a primary culture of dental pulps stem cells using the explant culture method and characterization of these cells based on ICSCRT guidelines. The cells isolated by this protocol can be considered as mesenchymal stem cells for further applications.

The human dental pulp represents a promising multipotent stem cell reservoir with pre-eminent regenerative competence that can be harvested from an ...

Biology

Establishing a Co-Culture of Dental Pulp Cells and Trigeminal Neurons for Cross-Communication

Source: Barkley, C. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/60809">A Co-Culture Method to Study Neurite Outgrowth in Response to Dental Pulp Paracrine Signals.</a>&#160;J. Vis. Exp. (2020).
This video showcases a technique for establishing a co-culture of trigeminal neurons and primary dental pulp cells using a transwell filter. In this physically separated condition, mesenchymal cells obtained from dental pulp tissue secrete paracrine signaling molecules that traverse through the pores, promoting the differentiation and migration of neurons towards the mesenchymal cells establishing a co-culture system.

1. Plate Preparation
NOTE: Be sure the plate lid is on during all incubation and rinsing steps outside of the sterile tissue culture hood to prevent ...

Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells

Samenvatting

Meer video's verkennen