The authors thank Jan Appel for his excellent technical assistance during the establishment of this protocol. Work in the Rada-Iglesias laboratory is supported by CMMC intramural funding, DFG Research Grants (RA 2547/1-1, RA 2547/2-1, and TE 1007/3-1), the UoC Advanced Researcher Group Grant, and the CECAD Grant.

<ol>
	<li>Jenuwein, T., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+the+histone+code.">Translating the histone code.</a> Science. 293 (5532), 1074-1080 (2001).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128 (4), 693-705 (2007).</li><li>Wang, Z., Schones, D. E., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+epigenomes.">Characterization of human epigenomes.</a> Curr Opin. Genet Dev. 19 (2), 127-134 (2009).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S. A., Flynn, R. A., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+chromatin+signature+uncovers+early+developmental+enhancers+in+humans.">A unique chromatin signature uncovers early developmental enhancers in humans.</a> Nature. 470 (7333), 279-283 (2011).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Nat Acad Sci USA. 107 (50), 21931-21936 (2010).</li><li>Benayoun, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K4me3+breadth+is+linked+to+cell+identity+and+transcriptional+consistency.">H3K4me3 breadth is linked to cell identity and transcriptional consistency.</a> Cell. 158 (3), 673-688 (2014).</li><li>Rehimi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenomics-Based+Identification+of+Major+Cell+Identity+Regulators+within+Heterogeneous+Cell+Populations.">Epigenomics-Based Identification of Major Cell Identity Regulators within Heterogeneous Cell Populations.</a> Cell Rep. 17 (11), 3062-3076 (2016).</li><li>Whyte, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Master+transcription+factors+and+mediator+establish+super-enhancers+at+key+cell+identity+genes.">Master transcription factors and mediator establish super-enhancers at key cell identity genes.</a> Cell. 153 (2), 307-319 (2013).</li><li>Valouev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+transcription+factor+binding+sites+based+on+ChIP-Seq+data.">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data.</a> Nat Methods. 5 (9), 829-834 (2008).</li><li>Dahl, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+histone+H3K4me3+domains+in+mouse+oocytes+modulate+maternal-to-zygotic+transition.">Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition.</a> Nature. 537 (7621), 548-552 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nat Biotech. 33 (11), 1165-1172 (2015).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nat Methods. 12 (10), 963-965 (2015).</li><li>Zhang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allelic+reprogramming+of+the+histone+modification+H3K4me3+in+early+mammalian+development.">Allelic reprogramming of the histone modification H3K4me3 in early mammalian development.</a> Nature. 537 (7621), 553-557 (2016).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Dev Dynam. 195 (4), 231-272 (1951).</li><li>Ho, J. W. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+metazoan+chromatin+organization.">Comparative analysis of metazoan chromatin organization.</a> Nature. 512 (7515), 449-452 (2014).</li><li>Calo, E., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+enhancer+chromatin:+what,+how,+and+why?.">Modification of enhancer chromatin: what, how, and why?.</a> Mol Cell. 49 (5), 825-837 (2013).</li><li>Spitz, F., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors:+from+enhancer+binding+to+developmental+control.">Transcription factors: from enhancer binding to developmental control.</a> Nat Rev Genetics. 13 (9), 613-626 (2012).</li></ol>

The authors do not have any competing financial interests to be disclosed.

Epigenomic profiling of histone modification using ChIP-seq can be used to improve the functional annotation of vertebrate genomes in different cellular contexts4,5,18. These epigenomic profiles can be used, among other things, to identify enhancer elements, to define the regulatory state of enhancers (i.e., active, primed, or poised), and to define major cell identity regulators in different biological or pathological contexts (e.g., broad H3K4me3 promoter domains and super-enhancers)6,7,9,10,11,19. However, due to the inherent limitation of the ChIP assay, which typically requires millions of cells, most histone modification profiles have been generated in in vitro cell lines and cell types that can be sorted in vivo in large quantities4. Most recently, several ChIP-seq protocols have been described that are compatible with extremely low cell numbers, thus dramatically expanding the range of cell types and tissues in which epigenomic profiles can, in principle, be generated13,14,15,16. These new ChIP-seq protocols each rely on specific ad hoc library preparation methods that, at least in some cases, require non-standard equipment and/or reagents14,15,16.
Here, we describe a ChIP protocol that works with low to intermediate cell numbers (5 x 104 - 5 x 105 cells) obtained in vivo from different embryonic tissues10. To increase the sensitivity of our ChIP assays, we have eliminated several steps normally used during ChIP, such as sequential cell and nuclear lysis, which can result in a progressive loss of valuable material. Thus, after crosslinking, samples are treated with a single lysis buffer and are subsequently sonicated to minimize sample loss. Importantly, our ChIP protocol is compatible with qPCR analysis, thus enabling the epigenomic analysis of selected loci of interest. Furthermore, our ChIP protocol can be combined with standard ChIP-seq library preparation methods, thus being potentially useful to most laboratories with access to next-generation sequencing technology.
ChIP and ChIP-seq protocols can be used not only to investigate the binding profiles of histone modifications but also to uncover the binding sites of other important transcriptional regulators, such as transcription factors and co-activators (e.g., p300 and CBP)20. Typically, ChIPs (and ChIP-seq) for transcription factors and co-activators, which are not as abundant as histones, require considerably more starting material than ChIPs for histone marks. Thus, the described protocol might not necessarily work for most transcription factors or co-activators unless the number of starting cells is considerably increased (e.g., 5 x 105 - 5 x 106 cells) and/or highly specific and efficient antibodies are available. Nevertheless, with further optimization and the constantly improving library preparation methods, we anticipate that ChIP-seq from limited cellular material will become feasible for most regulatory proteins.
Although our ChIP and ChIP-seq protocols have been extensively validated for a variety of histone modifications and embryonic tissues, we would like to highlight some critical steps that we consider essential to generating high-quality epigenomic profiles. First, the embryonic samples need to be freshly isolated under conditions that do not compromise chromatin integrity. These include performing dissections under cold conditions or flash-freezing pooled samples until sufficient material is accumulated. Another critical step is sonication, which needs to be accurately optimized to perform high-quality ChIPs. Optimal sonication conditions frequently vary, depending on the tissue type, the amount of tissue, or the sonicator being used. Last but not least, a successful ChIP ultimately relies on the availability of specific and ChIP-compatible antibodies against the proteins of interest.

Histone post-translational modifications are directly involved in various chromatin-dependent processes, including transcription, replication and DNA repair1,2,3. Moreover, different histone modifications show positive (e.g., H3K4me3 and H3K27ac) or negative (e.g., H3K9me3 and H3K27me3) correlations with gene expression and can be broadly defined as activating or repressive histone marks, respectively2,3. Consequently, global histone modification maps, also referred to as epigenomic maps, have emerged as powerful and universal tools to functionally annotate vertebrate genomes4,5. For example, distal regulatory sequences such as enhancers can be identified based on the presence of specific chromatin signatures (e.g., active enhancers: H3K4me1 and H3K27ac), which distinguish them from proximal promoter regions (e.g., active promoters: H3K4me3)6,7,8. On the other hand, genes with major cell identity regulatory functions are typically found with broad chromatin domains marked with H3K4me3 or H3K27me3, depending on the transcriptionally active or inactive status of the underlying genes, respectively9,10. Similarly, the expression of major cell identity genes seems to be frequently controlled by multiple and spatially clustered enhancers (i.e., super-enhancers), which can be identified as broad H3K27ac-marked domains11.
Currently, histone modification maps are generated using ChIP-seq technology, which in comparison to previous approaches such as ChIP-chip (ChIP coupled to microarrays) provides higher resolution, fewer artifacts, less noise, greater coverage, and lower costs12. Nevertheless, the generation of epigenomic maps using ChIP-seq technology has its inherent limitations, mostly associated with the capacity to successfully perform ChIP in the samples of interest. Traditional ChIP protocols typically required millions of cells, which limit the applicability of this method to in vitro cell lines or cells that can easily be isolated in vivo (e.g., blood cells). In the last few years, a number of modified ChIP protocols compatible with low cell numbers have been described13,14,15,16. However, these protocols are specifically designed to be coupled with next-generation sequencing (i.e., ChIP-seq), and they typically use ad hoc library preparation methods13,14,15,16.
Here, we described a ChIP protocol that can be used to investigate histone modification profiles using low to intermediate cell numbers (5 x 104 - 5 x 105 cells) at either selected loci (i.e., ChIP-qPCR) or globally (i.e., ChIP-seq) (Figure 1). When coupled to ChIP-seq technology, our ChIP protocol can be used together with standard library preparation methods, thus making it broadly accessible to many laboratories10. This protocol has been used to investigate several histone marks (e.g., H3K4me3, H3K27me3, and H3K27ac) in different chicken embryonic tissues (e.g., spinal neural tube (SNT), frontonasal prominences, and epiblast). However, we anticipate that it should be broadly applicable to other organisms in which biologically and/or clinically relevant samples can be only obtained in low amounts.

<table><tbody><tr><td>&lt;strong&gt;Reagent&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>BSA powder</td><td>Carl Roth</td><td>3737.3</td><td></td></tr><tr><td>Phosphate Saline buffer (PBS)</td><td>Sigma Aldrich</td><td>D8537</td><td></td></tr><tr><td>Tris-HCL pH 8.0</td><td>Sigma Aldrich</td><td>T1503</td><td></td></tr><tr><td>NaCl</td><td>Carl Roth</td><td>3957.2</td><td></td></tr><tr><td>EDTA</td><td>Carl Roth</td><td>8043.2</td><td></td></tr><tr><td>EGTA</td><td>Carl Roth</td><td>3054.2</td><td></td></tr><tr><td>Na-Deoxycholate</td><td>Sigma Aldrich</td><td>D6750-24</td><td></td></tr><tr><td>N-lauroylsarcosine</td><td>Sigma Aldrich</td><td>61743-25G</td><td></td></tr><tr><td>Hepes</td><td>Applichem</td><td>A3724,0250</td><td></td></tr><tr><td>LiCl</td><td>Carl Roth</td><td>3739.2</td><td></td></tr><tr><td>NP-40</td><td>Sigma Aldrich</td><td>I3021-100ml</td><td></td></tr><tr><td>SDS</td><td>Carl Roth</td><td>1833</td><td></td></tr><tr><td>Protein G/magnetic beads</td><td>Invitrogen</td><td>1004D</td><td></td></tr><tr><td>37% Formaldehyde</td><td>Sigma Aldrich</td><td>252549-1L</td><td></td></tr><tr><td>Glycine</td><td></td><td></td><td></td></tr><tr><td>RNase</td><td>Peqlab</td><td>12-RA-03</td><td></td></tr><tr><td>Proteinase K</td><td>Sigma Aldrich</td><td>46.35 E</td><td></td></tr><tr><td>Na-butyrate</td><td>Sigma Aldrich</td><td>SLB2659V</td><td></td></tr><tr><td>Proteinase inhibitor</td><td>Roche</td><td>5892791001</td><td></td></tr><tr><td>SYBRgreen Mix</td><td>biozym</td><td>617004</td><td></td></tr><tr><td>dH&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma Aldrich</td><td>W4502</td><td></td></tr><tr><td>1 Kb ladder</td><td>Thermofisher</td><td>SM1333</td><td></td></tr><tr><td>Orange G</td><td>Sigma Alrich</td><td>03756-25</td><td></td></tr><tr><td>Agarose</td><td>Invitrogen</td><td>16500-500</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x)</td><td>Gibco</td><td>25200-072</td><td></td></tr><tr><td>Octylphenol Ethoxylate (Triton X 100)</td><td>Roth</td><td>3051.4</td><td></td></tr><tr><td>DMEM (Dulbecco&amp;acute;s Modified Eagle Medium)</td><td>Gibco</td><td>31331-028</td><td></td></tr><tr><td>Gel loading tips Multiflex</td><td>A.Hartenstein</td><td>GS21</td><td></td></tr><tr><td>qPCR Plates</td><td>Sarstedt</td><td>721,985,202</td><td></td></tr><tr><td>384 well</td><td>Sarstedt</td><td>721,985,202</td><td></td></tr><tr><td>1.5 mL tubes</td><td>Sarstedt</td><td>72,706</td><td></td></tr><tr><td>100 - 1,000 &amp;micro;L Filter tips</td><td>Sarstedt</td><td>70,762,211</td><td></td></tr><tr><td>2 - 20 &amp;micro;L Filter tips</td><td>Sarstedt</td><td>70,760,213</td><td></td></tr><tr><td>2 - 200 &amp;micro;L Filter tips</td><td>Sarstedt</td><td>70,760,211</td><td></td></tr><tr><td>0.5 - 10 &amp;micro;L Filter tips</td><td>Sarstedt</td><td>701,116,210</td><td></td></tr><tr><td>H3K27me3 antibody</td><td>Active Motif</td><td>39155</td><td></td></tr><tr><td>H3K27ac antibody</td><td>Active Motif</td><td>39133</td><td></td></tr><tr><td>H3K4me3 antibody</td><td>Active Motif</td><td>39159</td><td></td></tr><tr><td>H3K4me2 antibody</td><td>Active Motif</td><td>39141</td><td></td></tr><tr><td>End Repair Mix</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>Paramagnetic beads</td><td>Beckman Coulter</td><td>A63881</td><td></td></tr><tr><td>Resuspension buffer</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>A-Tailing Mix</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>Ligation Mix</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>RNA Adapter Indexes</td><td>Illumina</td><td>RS-122-2101</td><td></td></tr><tr><td>Stop Ligation Buffer</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>PCR Primer Cocktail</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>Enhanced PCR Mix</td><td>Illumina</td><td>FC-121-4001</td><td></td></tr><tr><td>Genomic DNA ladder</td><td>Agilent</td><td>5067-5582</td><td></td></tr><tr><td>Elution Buffer</td><td>Agilent</td><td>19086</td><td></td></tr><tr><td>Sample Buffer</td><td>Agilent</td><td>5067-5582</td><td></td></tr><tr><td>Library Quantification Kit</td><td>Kapa Biosystems</td><td>KK4835 &amp;ndash; 07960204001</td><td></td></tr><tr><td>Fertile chicken white eggs</td><td>LSL Rhein Main</td><td>KN: 15968</td><td></td></tr><tr><td>Needle (Neoject)</td><td>A.Hartenstein</td><td>10001</td><td></td></tr><tr><td>Syringe (Ecoject 10 mL)</td><td>Dispomed witt oHG</td><td>21010</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Centrifuge</td><td>Hermle</td><td>Z 216 MK</td><td></td></tr><tr><td>Thermoshaker</td><td>ITABIS</td><td>MKR13</td><td></td></tr><tr><td>Sonicator</td><td>Active Motive</td><td>EpiShear probe sonicator</td><td></td></tr><tr><td>Sonicator</td><td>Diagenode</td><td>Bioruptor Plus</td><td></td></tr><tr><td>Rotator</td><td>Stuart</td><td>SB3</td><td></td></tr><tr><td>Variable volume (5 &amp;ndash;1,000 &amp;mu;L) pipettes</td><td>Eppendorf</td><td>N/A</td><td></td></tr><tr><td>Timer</td><td>Sigma</td><td>N/A</td><td></td></tr><tr><td>Magnetic holder</td><td>Thermo Fisher</td><td>DynaMag-2 12321D</td><td></td></tr><tr><td>Table spinner</td><td>Heathrow Scientific</td><td>Sprout</td><td></td></tr><tr><td>Mixer</td><td>LMS</td><td>VTX 3000L</td><td></td></tr><tr><td>Real-Time PCR Cycler</td><td>Roche</td><td>Light Cycler; Serial Nr.5662</td><td></td></tr><tr><td>PCR Cycler</td><td>Applied Biosystems</td><td>Gene Amp PCR System 9700</td><td></td></tr><tr><td>DNA and RNA quality control system</td><td>Agilent</td><td>Agilent 4200 TapeStation System</td><td></td></tr><tr><td>Forceps</td><td>Dumont</td><td>5-Inox-H</td><td></td></tr><tr><td>Perforated spoon</td><td>World precision instruments</td><td>501997</td><td></td></tr></tbody></table>

chromatin immunoprecipitation (chip) protocol for low-abundance embryonic samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

To illustrate the performance of our ChIP protocol, we performed ChIP-seq experiments using pooled SNT sections from HH19 chicken embryos, maxillary prominences of HH22 chicken embryos, and stage-HH3 chicken embryos to investigate the binding profiles of various histone modifications (i.e., H3K4me2, H3K27ac, H3K4me3, and H3K27me3). Once ChIP DNAs were obtained, the sonication efficiency was evaluated by agarose gel electrophoresis of the corresponding input DNAs (Figure 3). Then, the ChIP and input DNAs were used for ChIP-qPCR analysis to measure the enrichments at loci expected to be either bound or unbound by the investigated histone modifications (Figure 4A). In the example shown in Figure 4A, H3K27me3 and H3K4me3 enrichment levels in HH19 SNT sections were evaluated by ChIP-qPCR around the promoter regions of SOX17 and SOX2, two genes that are inactive and active in the SNT, respectively. As expected, the SOX2 promoter was strongly marked by H3K4me3 but not by H3K27me3, while the SOX17 promoter showed the opposite pattern (Figure 4A). By evaluating a few loci, it is possible to estimate the quality of the ChIP without losing much DNA material for downstream ChIP-seq analysis. Once the quality of the ChIPs was confirmed, ChIP-seq libraries were prepared and sequenced. Representative loci are shown for each of the investigated chicken embryonic tissues: (i) profiles for H3K27me3 and H3K4me3 in the SNT of HH19 chick embryos around PAX7 (Figure 4B); (ii) profiles for H3K4me2 and H3K27ac in the maxillary prominences of HH22 chicken embryos around SNAI1 (Figure 4C); and (iii) profile for H3K27me3 in HH3-stage chicken embryos around the TBX3/TBX5 locus (Figure 4D). These ChIP-seq experiments clearly illustrate that our ChIP protocol can be used to generate epigenomic profiles from limited amounts of biological material in a broad range of embryonic tissues.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56186/56186fig1.jpg" /> 
Figure 1: Schematic Overview of ChIP Protocol for Low-abundance Embryonic Samples Isolated from Chicken Embryos. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56186/56186fig2.jpg" /> 
Figure 2: Brief Overview of the SNT Microdissection Protocol. The transverse SNT segment is cut off at the brachial level of an HH19 chicken embryo. After trypsin treatment, the non-neural tissue is removed mechanically using forceps. Not, notochord; SNT, spinal neural tube; and SO, somite. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56186/56186fig3.jpg" /> 
Figure 3: Example of Optimal Sonication. A chicken SNT HH19 sample was sonicated for 11 cycles, with 30 s ON and 45 s OFF pulses at &#34;high&#34; amplitude using a sonicator. The crosslinks were reversed and the purified DNA was resolved on a 1.5% agarose gel. The optimal fragment size is observed after 11 cycles, ranging from 200 - 500 bp. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56186/56186fig4.jpg" /> 
Figure 4: Representative Examples of ChIP Analysis by ChIP-qPCR or ChIP-seq. (A) H3K27me3 (left) and H3K4me3 (right) levels at the indicated regions were measured by ChIP-qPCR analysis performed using SNT sections isolated from HH19 chick embryos. The SOX2 promoter region is active in the SNT and is thus marked by H3K4me3 but not by H3K27me3; the SOX17 promoter region is inactive in the SNT and is therefore enriched in H3K27me3 but not in H3K4me3; Chr6 Neg represents an intergenic region in chicken chromosome 6 and serves as a negative control. Error bars represent the standard deviation from three technical replicates. (B) ChIP-seq (H3K27me3 in magenta, H3K4me3 in blue, and input in red) profiles from the SNTs of HH14 chick embryos are shown around the PAX7 locus. (C) ChIP-seq (H3K4me2 in orange, H3K27ac in green, and input in red) profiles from the maxillary prominences of HH22 chick embryos are shown around the SNAI1 locus. (D) ChIP-seq (H3K27me3 in magenta and input in red) profiles from HH3 chick embryos are shown around the TBX3/TBX5 locus. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56186/56186fig5.jpg" /> 
Figure 5: Example of ChIP-seq Library Validation using the Automated RNA Quality-control System. The same ChIP-seq libraries were analyzed with the automated RNA quality-control system before (A) and after (B) primer dimer cleanup. Primer dimers can be seen as a weak ~135 bp band in (A). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Problem</td>
			<td>Possible reason</td>
			<td>Solution</td>
		</tr>
		<tr>
			<td>1,2,3,4 5 and 11</td>
			<td>Low ChIP signal to noise ratios according to ChIP-qPCR and/or ChIP-seq</td>
			<td>Tissue quality compromised.</td>
			<td>Perform micro-dissections in cold conditions; otherwise chromatin integrity could be compromised.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Sample loss after centrifugation of crosslinked samples.</td>
			<td>Use DMEM medium with 10 - 20% serum or repeat centrifugation step and increase time to&#160;10 min.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Cross-linking duration.</td>
			<td>Optimize the crosslinking time. Increased crosslinking times can facilitate the detection of certain proteins, such as co-activators and co-repressors that do not bind to DNA directly.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Sample loss due to multiple washes in PBS.</td>
			<td>Reduce the number of washes ; centrifugation steps can be repeated at 1,500 x g.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Suboptimal sonication resulting in either too long or too short DNA sizes.</td>
			<td>Perform a time course experiment to optimize sonication conditions. Optimal fragment sizes ranging from 200 to 500 bp</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Antibody not suitable for ChIP.</td>
			<td>Use a different antibody against the endogenous protein or an antibody against a tag added to an exogenously expressed proteins (e.g. Flag, HA).</td>
		</tr>
		<tr>
			<td>12</td>
			<td>Low or no signals in qPCR, even for input DNA</td>
			<td>Suboptimal primers</td>
			<td>Check the primer efficiency and specificity; design new primers.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Insufficient amount of DNA</td>
			<td>Not enough starting material. Increase the amount of DNA used per qPCR reaction.</td>
		</tr>
	</tbody>
</table>
Table 1: Troubleshooting Guide for Various Steps Involved in the Protocol.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>SOX2-F</td>
			<td>CCTTGCTGGGAGTACGACAT</td>
		</tr>
		<tr>
			<td>SOX2-R</td>
			<td>GCCCTGCAGTACAACTCCAT</td>
		</tr>
		<tr>
			<td>SOX17-F</td>
			<td>CCCTGAACTGTCATGTGTGG</td>
		</tr>
		<tr>
			<td>SOX17-R</td>
			<td>CAAACAGTTGCCTTTGAGCA</td>
		</tr>
		<tr>
			<td>Chr6-neg-F</td>
			<td>CCGTCAATCTCTGCTTGTGA</td>
		</tr>
		<tr>
			<td>Chr6-neg-R</td>
			<td>TGGAATCTGCTTGTCACTGC</td>
		</tr>
	</tbody>
</table>
Table 2: Primer Sequences for ChIP-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Preincubation</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td colspan="2">5 min</td>
		</tr>
		<tr>
			<td colspan="3">Amplification</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>10 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>10 s</td>
			<td>45</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>10 s</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td colspan="3">Melting Curve</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td>65 &#176;C</td>
			<td colspan="2">1 min</td>
		</tr>
		<tr>
			<td colspan="3">Cooling</td>
		</tr>
		<tr>
			<td>40 &#176;C</td>
			<td colspan="2">30 s</td>
		</tr>
	</tbody>
</table>
Table 3: PCR Conditions for ChIP-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Initial denaturation</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td colspan="2">3 min</td>
		</tr>
		<tr>
			<td colspan="3">Amplification</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>98 &#176;C</td>
			<td>20 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>15 s</td>
			<td>15</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>30 s</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td colspan="3">Final extension</td>
		</tr>
		<tr>
			<td>Temperature</td>
			<td colspan="2">Time</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td colspan="3">Cooling</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td colspan="2">hold</td>
		</tr>
	</tbody>
</table>
Table 4: PCR Conditions for Amplification of DNA Fragments during ChIP-seq Library Preparation.

Watch this Scientific Journal Video about Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples at JoVE.com

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

chromatin-immunoprecipitation-chip-protocol-for-low-abundance

Nanyang Technological University

Research

JoVE Journal

Genetics

15.7K Views.  University of Cologne. Hier beschrijven we een chromatine immunoprecipitation (ChIP) en ChIP-seq de protocol van de voorbereiding van de bibliotheek voor het genereren van wereldwijde epigenomic profielen van lage-overvloed kip embryonale monsters.

Video: Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

The question of how chromatin regulators and chromatin states affect the genome in vivo is key to our understanding of how early cell fate decisions are made in the developing embryo. ChIP-Seq&#8212;the most popular approach to investigate chromatin features at a global level&#8212;is outlined here for Xenopus embryos.

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

Developmental Biology

Epigenetic Regulation of Cardiac Differentiation of Embryonic Stem Cells and Tissues

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated by transcription factors which bind genomic regulatory regions including enhancers and promoters of cardiac constitutive genes. DNA is wrapped around histones that are subjected to chemical modifications. Modifications of histones further lead to repressed, activated or poised gene transcription, thus bringing another level of fine tuning regulation of gene transcription. Embryonic Stem cells (ES cells) recapitulate within embryoid bodies (i.e., cell aggregates) or in 2D culture the early steps of cardiac development. They provide in principle enough material for chromatin immunoprecipitation (ChIP), a technology broadly used to identify gene regulatory regions. Furthermore, human ES cells represent a human cell model of cardiogenesis. At later stages of development, mouse embryonic tissues allow for investigating specific epigenetic landscapes required for determination of cell identity. Herein, we describe protocols of ChIP, sequential ChIP followed by PCR or ChIP-sequencing using ES cells, embryoid bodies and cardiac specific embryonic regions. These protocols allow to investigating the epigenetic regulation of cardiac gene transcription.

A fine tuning regulation of gene transcription underlies embryonic cell fate decision. Herein, we describe chromatin immunoprecipitation assays used to investigate epigenetic regulation of both cardiac differentiation of stem cells and cardiac development of mouse embryos.

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated ...

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

Biology

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, epigenetic regulators, and post-translation modifications of histones that combinatorially influence the gene expression state of nearby genes. RNA has also been shown to interact with various proteins to regulate chromatin dynamics&#160;and gene expression. Chromatin-associated RNA immunoprecipitation (CARIP) followed by next-generation sequencing (CARIP-Seq) is a novel method to survey RNAs associated with chromatin proteins, while chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq) is a powerful genomics technique to map the location of post-translational modification of histones, transcription factors, and epigenetic modifiers on a global-scale in ES cells. Here, we describe methods to perform CARIP-Seq and ChIP-Seq, including library construction for next-generation sequencing, to generate global chromatin-associated RNA and epigenomic maps in ES cells.

Here, we describe methods to perform ChIP-Seq and CARIP-Seq, including library preparation for next-generation sequencing, to generate global epigenomic and chromatin-associated RNA maps in ES cells.

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Chromatin Immunoprecipitation Assay for Tissue-specific Genes using Early-stage Mouse Embryos

Chromatin immunoprecipitation (ChIP) is a powerful tool to identify protein:chromatin interactions that occur in the context of living cells 1-3. This technique has been widely exploited in tissue culture cells, and to a lesser extent, in primary tissue. The application of ChIP to rodent embryonic tissue, especially at early times of development, is complicated by the limited amount of tissue and the heterogeneity of cell and tissue types in the embryo. Here we present a method to perform ChIP using a dissociated embryonic day 8.5 (E8.5) embryo. Sheared chromatin from a single E8.5 embryo can be divided into up to five aliquots, which allows the investigator sufficient material for controls and for investigation of specific protein:chromatin interactions.
We have utilized this technique to begin to document protein:chromatin interactions during the specification of tissue-specific gene expression programs. The heterogeneity of cell types in an embryo necessarily restricts the application of this technique because the result is the detection of protein:chromatin interactions without distinguishing whether the interactions occur in all, a subset of, or a single cell type(s). However, examination of tissue-specific genes during or following the onset of tissue-specific gene expression is feasible for two reasons. First, immunoprecipitation of tissue specific factors necessarily isolates chromatin from the cell type where the factor is expressed. Second, immunoprecipitation of coactivators and histones containing post-translational modifications that are associated with gene activation should only be found at genes and gene regulatory sequences in the cell type where the gene is being or has been activated. The technique should be applicable to the study of most tissue-specific gene activation events.
In the example described below, we utilized E8.5 and E9.5 mouse embryos to examine factor binding at a skeletal muscle specific gene promoter. Somites, which are the precursor tissues from which the skeletal muscles of the trunk and limbs will form, are present at E8.5-9.54,5. Myogenin is a regulatory factor required for skeletal muscle differentiation 6-9. The data demonstrate that myogenin is associated with its own promoter in E8.5 and E9.5 embryos. Because myogenin is only expressed in somites at this stage of development 6,10, the data indicate that myogenin interactions with its own promoter have already occurred in skeletal muscle precursor cells in E8.5 embryos.

We demonstrate a chromatin immunoprecipitation (ChIP) method to identify factor interactions at tissue-specific genes during or after the onset of tissue-specific gene expression in mouse embryonic tissue. This protocol should be widely applicable for the study of tissue-specific gene activation as it occurs during normal embryonic development.

Chromatin immunoprecipitation (ChIP) is a powerful tool to identify protein:chromatin interactions that occur in the context of living cells 1-3. This ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. Additionally, epigenetic chromatin modifications, like histone methylation, have an important role for establishing and maintaining specific cell fates within this process. The vast majority of histone methylation occurs on the flexible histone tail, which is accessible to histone modifiers, erasers, and histone reader proteins. In contrast, H3K79 methylation is located in the globular domain of histone 3 and is implicated in different developmental functions. H3K79 methylation is evolutionarily conserved and can be found in a wide range of species from Homo sapiens to Saccharomyces cerevisiae. The modification occurs in different cell populations within organisms, including neural progenitors. The location of H3K79 methylation in the globular domain of histone 3 makes it difficult to assess. Here, we present methods to isolate and culture cortical progenitor cells (CPCs) from embryonic cortical brain tissue (E11.5-E14.5) or cerebellar granular neuron progenitors (CGNPs) from postnatal tissue (P5-P7), and to efficiently immunoprecipitate H3K79me2 for quantitative PCR (qPCR) and genome-wide sequencing.

We present an effective and reproducible method to isolate and culture neural progenitor cells from embryonic and postnatal brain tissue for chromatin immunoprecipitation (ChIP) of histone 3 lysine 79 dimethylation (H3K79me2) - a histone mark located within the globular domain of histone 3.

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Neuroscience

Efficient Chromatin Immunoprecipitation using Limiting Amounts of Biomass

Chromatin immunoprecipitation (ChIP) is a widely-used method for determining the interactions of different proteins with DNA in chromatin of living cells. Examples include sequence-specific DNA binding transcription factors, histones and their different modification states, enzymes such as RNA polymerases and ancillary factors, and DNA repair components. Despite its ubiquity, there is a lack of up-to-date, detailed methodologies for both bench preparation of material and for accurate analysis allowing quantitative metrics of interaction. Due to this lack of information, and also because, like any immunoprecipitation, conditions must be re-optimized for new sets of experimental conditions, the ChIP assay is susceptible to inaccurate or poorly quantitative results.
Our protocol is ultimately derived from seminal work on transcription factor:DNA interactions1,2 , but incorporates a number of improvements to sensitivity and reproducibility for difficult-to-obtain cell types. The protocol has been used successfully3,4 , both using qPCR to quantify DNA enrichment, or using a semi-quantitative variant of the below protocol.
This quantitative analysis of PCR-amplified material is performed computationally, and represents a limiting factor in the assay. Important controls and other considerations include the use of an isotype-matched antibody, as well as evaluation of a control region of genomic DNA, such as an intergenic region predicted not to be bound by the protein under study (or anticipated not to show changes under the experimental conditions). In addition, a standard curve of input material for every ChIP sample is used to derive absolute levels of enrichment in the experimental material. Use of standard curves helps to take into account differences between primer sets, regardless of how carefully they are designed, and also efficiency differences throughout the range of template concentrations for a single primer set. Our protocol is different from others that are available5-8 in that we extensively cover the later, analysis phase.

We describe a robust method for chromatin immunoprecipitation using primary T cells. The method is founded on standard approaches, but uses a specific set of conditions and reagents that improve efficiency for limited a quantities of cells. Importantly, a detailed description of the data analysis phase is presented.

Chromatin immunoprecipitation (ChIP) is a  widely-used method for determining the interactions of different proteins with  DNA in chromatin of living ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Samenvatting

Meer video's verkennen