저자들은 탁월한 기술적 도움을 준 Lisa Hansen과 Kirsten Vestergaard, 그리고 원고를 비판적으로 읽어준 P. Scherer, N. Joffin, C. Crewe에게 감사를 표한다. 저자들은 여기에 설명된 프로토콜 개발에 탁월한 지침과 도움을 준 UTSW 유세포분석 코어에 감사를 표합니다. R.K.G.는 NIH NIDDK R01 DK104789, NIDDK RC2 DK118620 및 NIDDK R01 DK119163에 의해 지원됩니다. JP는 Innovation Fund Denmark의 박사 전 상을 후원합니다.

모든 동물 프로토콜 및 절차는 텍사스 대학교 사우스웨스턴 메디컬 센터 기관 동물 사용 및 관리 위원회(University of Texas Southwestern Medical Center Institutional Animal Use and Care Committee)의 승인을 받았습니다.
1. 생식선 백색 지방 조직에서 기질 혈관 분획 (SVF)의 분리
<ol><li>6-8주 된 쥐의 생식선 백색 지방 조직을 절개하고 지방 패드를 1x PBS 용액에 넣습니다.</li>
	<li>최대 4개의 지방 저장소(1-2마리의 마우스에서 2-4개 저장소 권장)를 결합하고 200μL의 분해 완충액(1x HBSS, 1.5% BSA 및 1mg/mL 콜라겐분해효소 D)이 들어 있는 10mL 비커에 조직을 다집니다.</li>
	<li>다진 조직을 10mL 분해 완충액이 들어 있는 50mL 원심분리 튜브로 옮깁니다.</li>
	<li>혼합물을 37°C의 수조에서 흔들면서 1시간 동안 배양합니다.</li>
	<li>100μm 세포 여과기를 통해 소화된 조직을 여과하여 소화되지 않은 조직을 제거합니다.</li>
	<li>여과된 샘플을 2% FBS가 포함된 PBS를 사용하여 30mL로 희석하고 4°C에서 5분 동안 600 x g 으로 원심분리합니다. 성숙한 지방 세포를 포함하는 상층액을 흡인합니다.</li>
	<li>선호하는 세포 분리 방법으로 즉시 진행합니다.</li>
</ol>2. FACS를 사용한 APC 및 FIP 격리
<ol><li>튜브를 부드럽게 흔들어 펠릿을 1x RBC 용해 완충액 1mL에 녹입니다.</li>
	<li>실온에서 1-2분 동안 배양합니다.</li>
	<li>2% FBS/PBS 10mL를 넣고 40μm 세포 여과기를 통해 깨끗한 50mL 원심분리 튜브에 넣습니다.</li>
	<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
	<li>매체를 흡입하고 Fc 블록을 포함하는 2% FBS/PBS 400-800 μL에 펠릿을 재현탁시킵니다(1:200).</li>
	<li>4 °C에서 10분 동안 배양합니다.</li>
	<li>mL당 ≤10-6개의 세포를 포함하는 400 μL-800 μL의 세포 현탁액을 1.5 mL 튜브에 옮기고 항체를 추가합니다. 항체 농도는 Table of Materials(재료 표 ) 섹션에 나열되어 있습니다.<ol><li>1) 염색되지 않은 세포, 2) 단색 대조군 및 3) FMO(형광 마이너스 1) 대조군을 위한 별도의 대조 튜브를 준비합니다.</li>
		<li>PDGFRβ, CD45, CD31, CD9, LY6C 항체로 샘플을 염색합니다.</li>
	</ol></li>
	<li>4 °C에서 15분 동안 빛으로부터 보호하여 배양합니다.</li>
	<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
	<li>400μL의 2% FBS/PBS에서 배지를 흡인하고 세포를 재현탁시킵니다.</li>
	<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
	<li>배지를 흡인하고 400-800 μL의 2% FBS/PBS에서 세포를 재현탁시킵니다. 그런 다음 40μm 필터 캡을 5mL 폴리스티렌 둥근 바닥 튜브에 통과시켜 FACS를 만듭니다.</li>
	<li>게이팅을 위해 다음 단계를 따르십시오.<ol><li>보정을 위해 염색되지 않은 단색 컨트롤을 사용하십시오.</li>
		<li>FMO 컨트롤을 사용하여 실험 게이트를 설정합니다.</li>
		<li>그림 1에 표시된 게이팅 전략을 사용하여 APC 및 FIP를 얻을 수 있습니다. 게이트 APC는 CD45- CD31- PDGFRβ+ LY6C- CD9- 및 FIP는 CD45- CD31- PDGFRβ+ LY6C+ 세포로 게이트합니다.</li>
	</ol></li>
	<li>500μL의 100% 혈청이 들어 있는 튜브에서 분류된 세포를 수집하고 세포를 얼음 위에 유지합니다.</li>
	<li>600 x g 에서 4 °C에서 5 분 동안 셀을 원심 분리합니다. 2% FBS/PBS를 추가하여 4°C에서 5분 동안 600 x g 에서 다시 원심분리하여 세포를 세척합니다. 상층액을 버리고 펠릿 세포를 사용하십시오.</li>
	<li>펠릿화된 세포를 적절한 부피의 생식선 APC 배양 배지(세포 배양용) 또는 후속 분석을 위한 적절한 완충액에 재현탁시킵니다.</li>
</ol>3. adipogenic 및 non-adipogenic fractions의 면역자기 분리
<ol><li>1.1-1.7 단계에 따라 생식선 백색 지방 조직에서 SVF를 분리합니다.</li>
	<li>상층액을 흡입하고 SVF 펠릿을 10mL의 시판되는 1x MS 버퍼에 재현탁시킵니다.</li>
	<li>40μm 셀 스트레이너를 통해 셀 현탁액을 여과합니다.</li>
	<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
	<li>상층액을 흡인하고 펠릿 세포를 100μL의 1x MS 완충액에 재현탁시킵니다.</li>
	<li>아래 설명된 대로 CD31+ 및 CD45+ 세포 고갈을 수행합니다(그림 2A, 1단계). 이것은 내피 및 조혈 계통 세포를 제거하기 위해 수행됩니다.<ol><li>세포 카운터를 사용하여 세포 수를 세고 농도를 ≤ 1 x 108 cells/mL로 조정합니다.</li>
		<li>비오틴 접합 CD31 및 CD45 항체를 106 세포 당 ≤ 0.25 μg의 농도로 세포 현탁액에 추가하고 15분 동안 얼음에서 배양합니다.</li>
		<li>4mL의 1x MS 버퍼를 첨가하여 세포를 세척합니다.</li>
		<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
		<li>상층액을 흡입하고 100μL의 1x MS 완충액으로 펠릿을 재현탁시킵니다.</li>
		<li>10μL의 스트렙타비딘 나노비드를 넣고 15분 동안 얼음 위에서 세포를 배양합니다.</li>
		<li>4mL의 1x MS 버퍼를 추가하여 세포를 세척합니다.</li>
		<li>600 x g 에서 4 °C에서 5 분 동안 원심 분리 한 다음 상층액을 흡입합니다.</li>
		<li>2.5mL의 1x MS 완충액에 세포를 재현탁하고 5mL 폴리프로필렌 튜브로 옮깁니다.</li>
		<li>튜브를 자석 랙에 5분 동안 놓습니다.</li>
		<li>세포 현탁액을 깨끗한 15mL 원심분리 튜브에 주입하여 라벨이 없는 세포를 수집합니다. 알림: 원치 않는 세포 분획으로 인한 오염으로 이어질 수 있으므로 매달려 있는 방울을 흔들거나 잘라내지 마십시오.</li>
		<li>자석에서 튜브를 제거하고 3.6.9단계를 반복합니다. 을 3.6.11로 변경합니다. 두 번 더 세탁하면 총 3회 세탁할 수 있습니다.</li>
	</ol></li>
	<li>adipogenic 및 non-adipogenic fraction의 분리(그림 2A, 2단계)<ol><li>라벨링되지 않은 분획(즉, CD45-CD31-분획)으로 작업을 계속합니다.</li>
		<li>라벨링되지 않은 세포가 들어 있는 15mL 튜브를 600 x g 에서 4°C에서 5분 동안 원심분리합니다.</li>
		<li>상층액을 흡인하고 펠릿을 100μL의 1x MS 완충액에 재현탁시킵니다.</li>
		<li>비오틴 접합 LY6C 및 CD9 항체를 각각 106 세포 당 ≤ 0.25 μg의 농도로 첨가하고 얼음에서 15 분 동안 배양합니다.</li>
		<li>3.6.3단계를 수행합니다. 을 3.6.12로 변경합니다. 두 번째 분리를 완료합니다.</li>
		<li>결합되지 않은 분수를 수집합니다. 표지되지 않은 세포(LY6C- CD9-)는 APC를 포함하는 지방 분획을 나타냅니다(그림 2A, 단계 3).</li>
		<li>자석에서 튜브를 제거하고 1x MS 버퍼에서 결합된 셀을 재현탁 및 용리합니다. 용리액 또는 표지된 분획(LY6C+ CD9+)은 FIP를 포함하는 비지방성 분획을 나타냅니다(그림 2A, 3단계).</li>
		<li>600 x g 에서 5분 동안 라벨링 및 라벨링되지 않은 분획을 원심분리하여 4°C에서 펠릿 셀로 이동합니다.</li>
	</ol></li>
	<li>즉시 세포 배양을 진행하거나(6단계) 선호하는 분석을 위해 미분화 전구체를 사용합니다(4단계 및/또는 5단계).</li>
</ol>4. 유세포 분석을 통한 지방형성 및 비지방성 분획의 순도 평가
<ol><li>Fc 블록을 포함하는 2% FBS/PBS의 200-400 μL에 비드 분리 세포 분획을 재현탁시킵니다(1:200).</li>
	<li>4 °C에서 10분 동안 배양합니다.</li>
	<li>세포 현탁액을 1.5mL 튜브로 옮기고 항체를 추가합니다. 항체 농도는 재료 표에 나와 있습니다.<ol><li>1) 염색되지 않은 세포, 2) 단색 대조군 및 3) FMO 대조군을 위한 별도의 대조 튜브를 준비합니다.</li>
		<li>샘플에 CD45, CD31, CD9 및 LY6C 항체를 추가합니다.</li>
	</ol></li>
	<li>4 °C에서 15분 동안 빛으로부터 보호하여 배양합니다.</li>
	<li>600 x g 에서 4 °C에서 5분 동안 원심분리합니다.</li>
	<li>상층액을 흡인하고 400μL의 2% FBS/PBS에서 세포를 재현탁시킵니다.</li>
	<li>600 x g 에서 4 ° C에서 5 분 동안 현탁액을 원심 분리합니다.</li>
	<li>상층액을 흡인하고 400-800 μL의 2% FBS/PBS에서 세포를 재현탁시킵니다. 유세포 분석을 위해 40μm 필터 캡을 5mL 폴리스티렌 둥근 바닥 튜브로 여과합니다.</li>
	<li>순도를 평가하기 위한 유세포 분석<ol><li>보정을 위해 염색되지 않은 단색 컨트롤을 사용하십시오.</li>
		<li>FMO 컨트롤을 사용하여 실험 게이트를 설정합니다.</li>
		<li>그림 2B와 같이 라이브 셀과 단일 셀에 대해 gating 전략을 사용합니다.</li>
		<li>CD45, CD31, LY6C 및 CD9에 대해 그림 2B 와 같이 게이팅을 수행합니다.</li>
		<li>유세포 분석 소프트웨어를 사용하여 분리 분획 내에서 CD45-CD31-LY6C-CD9- 세포(APC) 및 CD45-CD31-LY6C+ 세포(FIP)의 빈도를 평가할 수 있습니다.</li>
	</ol></li>
</ol>5. FIP 및 APC의 순도를 평가하기 위해 정량적 PCR을 사용한 유전자 발현 분석
<ol><li>제조업체의 지침에 따라 시중에서 판매되는 추출 키트( 재료 표 참조)를 사용하여 자기 또는 FACS 분리 세포에서 mRNA를 추출합니다.</li>
	<li>제조업체의 지침에 따라 cDNA 역전사 효소 키트( 재료 표 참조)를 사용하여 1μg의 RNA를 사용하여 cDNA를 합성합니다.</li>
	<li>SYBR green PCR master mix를 사용하여 정량적 PCR로 APC 및 FIPs 선택적 유전자(표 1)의 상대적 mRNA 수준을 측정합니다.<ol><li>2x SYBR 녹색 염료 5μL, cDNA 1μL(~50ng/μL), 각 정방향 및 역방향 프라이머 0.5μL(10μM) 및 물 3μL와 같이 PCR에 대한 샘플 반응을 설정합니다.</li>
		<li>정량적 PCR 실행을 위해 다음 표준 PCR 조건을 사용하십시오: 홀드 스테이지: 2분 동안 50°C, 10분 동안 95°C; PCR 스테이지(40 사이클): 95°C에서 15초, 60°C에서 1분</li>
	</ol></li>
	<li>ΔΔ-Ct를 계산하여 가사 유전자(Rps18) 수준으로 값을 정규화합니다.</li>
	<li>통계적 유의성을 평가하려면 쌍을 이루지 않은 스튜던트 t-검정을 수행합니다.</li>
</ol>6. 세포 배양 및 분화
<ol><li>4 °C에서 5분 동안 600 x g 에서 자기 또는 FACS 절연 셀을 원심분리합니다.</li>
	<li>500 μL의 생식선 APC 배양 배지에 펠릿을 재현탁시키고 48웰 배양 플레이트의 각 분획에서 40K 세포/웰을 플레이트합니다.</li>
	<li>1-2일마다 미디어를 교체하십시오. APC는 합류점에 접근함에 따라 지방세포로 분화하기 시작합니다. 동일한 매체에서 유지되는 FIP는 지방 형성을 겪지 않습니다.</li>
</ol>

<ol>
	<li>Ouchi, N., Parker, J. L., Lugus, J. J., Walsh, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipokines+in+inflammation+and+metabolic+disease.">Adipokines in inflammation and metabolic disease.</a> Nature Reviews Immunology. 11 (2), 85-97 (2011).</li><li>Rosen, E. D., Spiegelman, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+we+talk+about+when+we+talk+about+fat.">What we talk about when we talk about fat.</a> Cell. 156 (1-2), 20-44 (2014).</li><li>Funcke, J. B., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+adiponectin+and+leptin:+adipose+tissue-derived+mediators+of+inter-organ+communication.">Beyond adiponectin and leptin: adipose tissue-derived mediators of inter-organ communication.</a> Journal of Lipid Research. 60 (10), 1648-1684 (2019).</li><li>Eto, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+structure+and+cellular+components+of+aspirated+and+excised+adipose+tissue.">Characterization of structure and cellular components of aspirated and excised adipose tissue.</a> Plastic and Reconstructive Surgery. 124 (4), 1087-1097 (2009).</li><li>Hirsch, J., Batchelor, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue+cellularity+in+human+obesity.">Adipose tissue cellularity in human obesity.</a> Clinics in Endocrinology and Metabolism. 5 (2), 299-311 (1976).</li><li>Ghaben, A. L., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipogenesis+and+metabolic+health.">Adipogenesis and metabolic health.</a> Nature Reviews Molecular Cell Biology. 20 (4), 242-258 (2019).</li><li>Hepler, C., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expanding+problem+of+adipose+depot+remodeling+and+postnatal+adipocyte+progenitor+recruitment.">The expanding problem of adipose depot remodeling and postnatal adipocyte progenitor recruitment.</a> Molecular Cell Endocrinology. 445, 95-108 (2017).</li><li>Jo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophy+and/or+Hyperplasia:+Dynamics+of+Adipose+Tissue+Growth.">Hypertrophy and/or Hyperplasia: Dynamics of Adipose Tissue Growth.</a> PLoS Computational Biology. 5 (3), 1000324 (2009).</li><li>Sun, K., Kusminski, C. M., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue+remodeling+and+obesity.">Adipose tissue remodeling and obesity.</a> Journal of Clinical Investigation. 121 (6), 2094-2101 (2011).</li><li>Kloting, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-sensitive+obesity.">Insulin-sensitive obesity.</a> American Journal of Physiology-Endocrinology and Metabolism. 299 (3), 506-515 (2010).</li><li>Vishvanath, L., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+adipogenesis+to+healthy+adipose+tissue+expansion+in+obesity.">Contribution of adipogenesis to healthy adipose tissue expansion in obesity.</a> Journal of Clinical Investigation. 129 (10), 4022-4031 (2019).</li><li>Choe, S. S., Huh, J. Y., Hwang, I. J., Kim, J. I., Kim, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+Tissue+Remodeling:+Its+Role+in+Energy+Metabolism+and+Metabolic+Disorders.">Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders.</a> Frontiers in Endocrinology (Lausanne). 7, 30 (2016).</li><li>Hepler, C., Vishvanath, L., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sorting+out+adipocyte+precursors+and+their+role+in+physiology+and+disease.">Sorting out adipocyte precursors and their role in physiology and disease.</a> Genes and Development. 31 (2), 127-140 (2017).</li><li>Burl, R. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Adipogenesis+Induced+by+beta3-Adrenergic+Receptor+Activation+with+Single-Cell+Expression+Profiling.">Deconstructing Adipogenesis Induced by beta3-Adrenergic Receptor Activation with Single-Cell Expression Profiling.</a> Cell Metabolism. 28 (2), 300-309 (2018).</li><li>Hepler, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+functionally+distinct+fibro-inflammatory+and+adipogenic+stromal+subpopulations+in+visceral+adipose+tissue+of+adult+mice.">Identification of functionally distinct fibro-inflammatory and adipogenic stromal subpopulations in visceral adipose tissue of adult mice.</a> Elife. 7, 39636 (2018).</li><li>Merrick, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+mesenchymal+progenitor+cell+hierarchy+in+adipose+tissue.">Identification of a mesenchymal progenitor cell hierarchy in adipose tissue.</a> Science. 364 (6438), 2501 (2019).</li><li>Schwalie, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stromal+cell+population+that+inhibits+adipogenesis+in+mammalian+fat+depots.">A stromal cell population that inhibits adipogenesis in mammalian fat depots.</a> Nature. 559 (7712), 103-108 (2018).</li><li>Bagchi, D. P., MacDougald, O. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Dissection+of+Diverse+Mouse+Adipose+Depots.">Identification and Dissection of Diverse Mouse Adipose Depots.</a> Journal of Visualized Experiments. (149), e59499 (2019).</li><li>Jeffery, E., Church, C. D., Holtrup, B., Colman, L., Rodeheffer, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+depot-specific+activation+of+adipocyte+precursor+cells+at+the+onset+of+obesity.">Rapid depot-specific activation of adipocyte precursor cells at the onset of obesity.</a> Nature Cell Biology. 17 (4), 376-385 (2015).</li><li>Kim, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+white+adipose+hyperplastic+potential+is+associated+with+enhanced+susceptibility+to+insulin+resistance.">Loss of white adipose hyperplastic potential is associated with enhanced susceptibility to insulin resistance.</a> Cell Metabolism. 20 (6), 1049-1058 (2014).</li><li>Vishvanath, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pdgfrbeta++Mural+Preadipocytes+Contribute+to+Adipocyte+Hyperplasia+Induced+by+High-Fat-Diet+Feeding+and+Prolonged+Cold+Exposure+in+Adult+Mice.">Pdgfrbeta+ Mural Preadipocytes Contribute to Adipocyte Hyperplasia Induced by High-Fat-Diet Feeding and Prolonged Cold Exposure in Adult Mice.</a> Cell Metabolism. 23 (2), 350-359 (2016).</li><li>Wang, Q. A., Tao, C., Gupta, R. K., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+adipogenesis+during+white+adipose+tissue+development,+expansion+and+regeneration.">Tracking adipogenesis during white adipose tissue development, expansion and regeneration.</a> Nature Medicine. 19 (10), 1338-1344 (2013).</li><li>Gao, Z., Daquinag, A. C., Su, F., Snyder, B., Kolonin, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PDGFRalpha/PDGFRbeta+signaling+balance+modulates+progenitor+cell+differentiation+into+white+and+beige+adipocytes.">PDGFRalpha/PDGFRbeta signaling balance modulates progenitor cell differentiation into white and beige adipocytes.</a> Development. 145 (1), 155861 (2018).</li><li>Rodeheffer, M. S., Birsoy, K., Friedman, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+white+adipocyte+progenitor+cells+in+vivo.">Identification of white adipocyte progenitor cells in vivo.</a> Cell. 135 (2), 240-249 (2008).</li><li>Church, C. D., Berry, R., Rodeheffer, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+study+of+adipocyte+precursors.">Isolation and study of adipocyte precursors.</a> Methods Enzymol. 537, 31-46 (2014).</li><li>Buffolo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+Paracrine+Signaling+Mechanism+Linking+CD34(high)+Progenitors+to+the+Regulation+of+Visceral+Fat+Expansion+and+Remodeling.">Identification of a Paracrine Signaling Mechanism Linking CD34(high) Progenitors to the Regulation of Visceral Fat Expansion and Remodeling.</a> Cell Reports. 29 (2), 270-282 (2019).</li><li>Shao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+adipocyte+differentiation+from+Pdgfrbeta(+)+preadipocytes+protects+against+pathologic+visceral+adipose+expansion+in+obesity.">De novo adipocyte differentiation from Pdgfrbeta(+) preadipocytes protects against pathologic visceral adipose expansion in obesity.</a> Nature Communications. 9 (1), 890 (2018).</li><li>Lee, P. Y., Wang, J. X., Parisini, E., Dascher, C. C., Nigrovic, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ly6+family+proteins+in+neutrophil+biology.">Ly6 family proteins in neutrophil biology.</a> Journal of Leukocyte Biology. 94 (4), 585-594 (2013).</li><li>Vijay, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+analysis+of+human+adipose+tissue+identifies+depot+and+disease+specific+cell+types.">Single-cell analysis of human adipose tissue identifies depot and disease specific cell types.</a> Nature Metabolism. 2 (1), 97-109 (2020).</li></ol>

T.A.P.는 Novo Nordisk A/S의 직원이자 주주입니다.

마우스의 C57BL/6 균주는 다이어트로 인한 비만 연구에서 가장 많이 사용되는 마우스 균주입니다. C57BL/6 마우스는 고지방 식단(HFD)을 섭취할 때 체중이 급격히 증가하고 비만과 관련된 대사 증후군의 두드러진 특징(예: 인슐린 저항성 및 고지혈증)이 발생합니다. 특히, 고지방 식단(HFD) 급여와 관련하여 발생하는 WAT 확장은 창고 특이적 방식으로 발생한다 19,20,21,22,23. 피하 서혜부 WAT 저장소(iWAT)의 확장은 거의 전적으로 지방 세포 비대를 통해 발생하는 반면, 생식선 WAT(gWAT)의 확장은 지방 세포 비대와 증식을 통해 발생합니다. 비만 쥐의 gWAT 저장소는 대사 염증의 주요 부위이기도 합니다. 따라서, 다이어트로 인한 비만 마우스의 gWAT 저장소는 비만과 관련된 지방 조직 리모델링의 여러 특징을 연구하기 위한 모델을 나타냅니다.
지난 몇 년 동안 지방 저장소에서 APC를 전향적으로 분리하기 위해 가장 일반적으로 사용되는 전략은 CD29, SCA-1 및 CD34 발현(CD29+ CD34+ SCA-1+ CD31- CD45-)24,25를 기반으로 세포를 선택하는 것입니다. 이 접근 방식은 iWAT 및 기타 WAT 저장소에서 APC를 선택하는 데 유용합니다. 그러나, 생식선 WAT 저장소 및 다른 복강 내 저장소에서는, CD34와 SCA-1 표정은 APCs15,26 보다는 오히려 반대로 adipogenic 세포에서 부유하게 됩니다. Buffolo et al.은 이에 대한 직접적인 증거를 제공하여 CD34(CD34high)의 높은 발현을 기반으로 선택된 gWAT 기질 세포가 anti-adipogenic26임을 입증합니다. 따라서 이 WAT 저장소에서 CD34 및 SCA-1의 발현을 기반으로 세포를 선택하면 FIP를 포함할 수 있는 이질적인 집단이 생성됩니다. 이러한 항-지방형성 세포의 존재는 사타구니 WAT 저장소(25)로부터의 상응하는 세포와 비교될 때 분리된 생식선 CD34+ SCA-1+ 세포가 시험관내에서 소유하는 지방형성 전위의 보고된 부족을 설명할 수 있다. 여기에서 설명하는 접근법은 체외에서 지방성이 높은 복강 내 WAT APC를 농축할 수 있습니다. 더욱이, 지방이영양성 마우스에 이식된 APC는 이소성 지방 패드(15)를 형성할 수 있다. 당사의 전략은 gWAT, 장간막 WAT 및 후복막 WAT15를 포함한 수컷 및 암컷 마우스의 여러 복강 내 저장소에서 APC를 분리할 수 있도록 합니다. 여러 유전적 계통 추적 연구에 따르면 HFD 섭식과 관련하여 gWAT에서 발생하는 지방세포는 Pdgfrb(PDGFRβ 단백질)를 발현하는 혈관 주위 기질 세포에서 유래합니다.21,23. 중요한 것은, 비만 마우스에서 gWAT의 건강은 PDGFRβ+ 세포의 지방 생성 능력에 달려 있다는 것이다27. 이러한 데이터는 여기에 설명된 접근 방식으로 분리된 gWAT APC가 생리학적 관련성이 있다는 개념을 뒷받침합니다.
이 접근법으로 분리된 Gonadal WAT APC는 2차원 배양에서 합류점에 도달하거나 합류 이전에 지방세포로 빠르게 분화합니다. 대부분의 확립된 지방세포전 세포주와 달리, 이러한 일차 APC는 일반적으로 사용되는 지방생성 인자(예: 덱사메타손, IMBX 또는 PPARγ 작용제)를 추가할 필요가 없습니다. 독자는 이 프로토콜에 사용된 상업적으로 사용되는 ITS 보충제에는 높은 수준의 인슐린이 포함되어 있다는 점에 유의해야 합니다. 또한, 지방세포 분화는 FBS의 공급원/로트에 따라 크게 달라질 수 있습니다. 분화를 지원하는 혈청을 찾기 위해 여러 로트의 FBS를 검사해야 하는 경우가 있습니다. 더욱이, FBS의 다양한 수준의 내독소는 APC 및 FIP의 기준선 전염증성 표현형에도 영향을 미칠 수 있습니다.
FACS는 지방 SVF에서 APC를 분리하는 데 일반적으로 사용되는 기술입니다. 이 접근 방식을 사용하면 세포 집단을 정밀하게 분리하고 파편과 죽은 세포를 제거할 수 있습니다. 그럼에도 불구하고, 세포에 가해지는 지속 시간 및 물리적 스트레스는 유전자 발현 및/또는 세포 기능에 영향을 미칠 수 있습니다. 또한 다중 채널 세포 분류기는 모든 연구자가 쉽게 사용할 수 있는 것은 아닙니다. 여기에서는 마그네틱 비드 분리를 통해 APC를 분리할 수 있는 방법에 대한 세부 정보를 제공합니다. 우리의 경험에 비추어 볼 때, 자기 비드 분리를 통한 두 집단의 수율은 FACS를 사용할 때 관찰된 것보다 낮습니다. 더욱이 위의 그림 2 에서 볼 수 있듯이 이 접근 방식은 어느 정도의 순도를 희생합니다. 그럼에도 불구하고 마그네틱 비드 분리는 지방 유발 가능성이 높은 APC의 배양을 수득합니다. 이 접근 방식을 통해 분리된 APC의 순도는 반복적인 세척 단계를 통해 증가할 수 있습니다. 그러나 이로 인해 수율이 저하될 수 있습니다. 프로토콜의 중요한 단계는 원하는 세포 또는 원하지 않는 세포 표면의 표적 항원에 대한 비오틴화 항체의 결합입니다. 배양 시간이 충분하지 않거나 항체 농도가 너무 낮으면 표적 세포는 라벨링되지 않은 상태로 유지됩니다. 조사관은 분리를 위해 항체 농도를 최적화해야 할 수 있습니다. 동일한 원리가 streptavidin nanospheres를 사용한 배양에 적용됩니다. 스트렙타비딘-비오틴 복합체를 형성하지 못하면 분리 효율에 영향을 미칩니다. 연구원은 또한 각 세척 단계에 추가적인 주의를 기울여야 하며 자석에서 용출액을 수집하거나 버릴 때 매달려 있는 물방울을 지우려는 유혹에 저항해야 합니다. 블로팅(blotting)은 원치 않는 세포 집단으로 인한 교차 오염을 초래할 수 있습니다. 포지티브 셀렉션(positive selection)을 수행할 때 나노비드는 세포 분획에서 제거되지 않으며 현미경으로 검출할 수 있다는 점에 유의해야 합니다. 우리의 경험에 따르면, 이러한 비드의 존재는 다운스트림 기능 분석을 방해하지 않습니다. 연구자들은 이 마그네틱-비드 분리 전략에서 비-APC 분획이 이질적으로 유지된다는 점에 유의해야 합니다. 이 모집단에는 대부분 FIP(>75% LY6C+)가 포함됩니다. 그러나 다른 세포 유형(예: CD9+ 중피 세포)이 존재할 수 있습니다. 따라서 여기에 제시된 마그네틱 비드 분리 프로토콜은 단순히 APC를 분리하는 것이 목표이고 FACS 기계를 쉽게 구할 수 없거나 비용이 많이 드는 경우에 가장 유용할 수 있습니다.
또한 조사관은 여기에 설명된 전체 분류 전략에 대한 중요한 제한 사항에 유의해야 합니다. 무엇보다도, 여기에서 설명하는 프로토콜은 현재 마우스의 복강 내 WAT 저장소에만 적용됩니다. 마우스의 피하 iWAT 저장소에는 PDGFRβ+ 지방 전구 세포가 포함되어 있습니다. 그러나, LY6C 발현은 그 저장소(27) 내에서 기능적으로 구별되는 전구체 부분집단을 쉽게 구별하지 않는다. 독자들은 Merrick et al. 및 Church et al.의 연구를 참조하여 APC를 해당 창고16,25에서 격리하는 프로토콜을 참조합니다. 우리는 이 분류 전략이 기능적 APC를 쥐에서 분리할 수 있는지 여부를 아직 테스트하지 않았습니다. 더욱이, 인간에서 LY6C에 대한 명백한 ortholog가 없다는 것에 유의해야 한다28. 따라서 인간 APC는 이러한 마커를 기반으로 정렬할 수 없습니다. 인간 지방 기질 세포에 대한 최근의 단세포 염기서열 분석 연구는 인간 조직에서 뚜렷한 전구 세포 집단을 분리하는 새로운 전략으로 이어질 수 있다29. 둘째, 세포의 시험관 내 사용에는 한계가 있습니다. FIP는 증식성이 매우 높으며 여러 통로에 걸쳐 전파될 수 있으며 기능적 특성을 유지할 수 있습니다. 그러나 APC는 통과함에 따라 지방 생성 잠재력을 크게 잃습니다. 이는 높은 세포 수가 필요하거나 유전자 발현을 조작하는 생화학적 분석(예: CRISPR/Cas9 또는 RNA 간섭)을 수행하려는 사람들에게 기술적 과제를 제공합니다. 우리의 견해로는, 우리의 접근법은 동물 모델의 복강 내 WAT 저장소에서 직접 파생된 네이티브 APC 및/또는 FIP의 빈도와 특성을 비교하는 것이 목표인 경우에 적합합니다(예: 대조군 및 실험 동물에서의 APC 빈도, 남성과 여성 전구 세포 비교, 식이, 연령 등이 전구 빈도 및 특성에 미치는 영향). 이러한 뚜렷한 세포 집단을 단독으로 연구할 수 있는 능력은 생쥐의 지방 형성 및 지방 조직 리모델링을 조절하는 분자 메커니즘을 해부하려는 시도에 크게 도움이 될 것입니다.

백색 지방 조직(WAT)은 포유류의 에너지 저장을 위한 주요 위치를 나타냅니다. 이 조직 내에서 지방 세포 또는 "지방 세포"는 트리글리세라이드 형태로 과도한 칼로리를 저장하며, 이는 큰 단안 지질 방울로 포장됩니다. 또한, 지방세포는 에너지 항상성의 다양한 측면을 조절하는 다양한 인자를 분비합니다 1,2,3. 지방세포는 WAT 부피의 대부분을 구성합니다. 그러나 지방세포는 WAT 4,5에서 발견되는 전체 세포의 50% 미만만 차지합니다. WAT의 비지방세포 구획 또는 기질-혈관 분획(SVF)은 매우 이질적이며 혈관 내피 세포, 조직 거주 면역 세포, 섬유아세포 및 지방세포 전구세포(APC) 집단을 포함합니다.
WAT는 에너지 저장에 대한 수요가 증가함에 따라 규모를 확장할 수 있는 놀라운 능력이 탁월합니다. WAT에 지질을 적절하게 저장하면 비지방 조직으로의 유해한 이소성 지질 침착을 방지할 수 있으므로 이러한 조직 가소성을 유지하는 것이 필수적이다6. 개별 WAT 저장소가 과잉 칼로리에 대응하여 이러한 팽창을 겪는 방식은 비만 환경에서 인슐린 감수성을 결정하는 중요한 요인이다7. 대사 증후군이 있는 비만 개체에서 관찰되는 병리학적 WAT 확장은 대사적으로 유리한 피하 지방 조직을 희생하면서 내장 WAT 저장소의 우선적인 확장을 특징으로 합니다. 또한, 비만에서 인슐린 저항성은 WAT의 병리학적 리모델링과 관련이 있습니다. 이것은 기존 지방 세포의 비대 성장(크기 증가), 부적절한 혈관 신생, 만성 대사 염증, 세포 외 기질 구성 요소의 축적(섬유증) 및 조직 저산소증을 특징으로 합니다 8,9. 이러한 비만의 WAT 표현형은 지방이영양증(기능적 WAT의 부재) 상태에서 관찰되는 것과 유사하게 간 지방증 및 인슐린 저항성과 관련이 있습니다. 대조적으로, 건강한 WAT 확장은 대사적으로 건강한 비만 인구에서 관찰되며, 지방세포 증식을 통한 보호적인 피하 WAT의 우선적 확장 및 저장소 확장이 특징이다10. 새로운 지방세포의 모집은 지방세포 전구세포(APC)에서 새로운 지방세포 분화(de novo adipocyte differentiation)에 의해 매개됩니다("지방형성"이라고 함). 지방세포 증식은 WAT 섬유증 및 대사 염증의 정도가 상대적으로 낮은 것과 일치합니다 6,11. WAT 미세환경 내의 다양한 세포 유형은 비만에서 WAT의 건강과 확장성에 직접적인 영향을 미친다12. 따라서 WAT에 존재하는 다양한 세포 유형의 기능을 정의하는 것은 이 분야의 높은 우선 순위로 남아 있습니다.
지난 10년 동안 인간 및 마우스 WAT SVF13에서 네이티브 APC를 정의하고 격리하기 위해 몇 가지 전략이 채택되었습니다. 이러한 전략은 항체 기반 세포 분리 기술을 사용하여 일반적인 중간엽 줄기/전구 세포 마커의 세포 표면 발현을 기반으로 APC를 분리합니다. 이러한 접근법에는 형광 활성화 세포 분류(FACS), 형광단 표지 항체 사용 또는 면역자기 비드 분리(즉, 화학적으로 변형된 항체)가 포함됩니다. APC의 분리를 대상으로 하는 세포 표면 단백질에는 PDGFRα, PDGFRβ, CD34 및 SCA-1이 포함됩니다. 이러한 접근 방식은 APC를 강화하는 데 도움이 되었습니다. 그러나 이러한 마커를 기반으로 분리된 세포 집단은 매우 이질적입니다. 매우 최근의 단일 세포 RNA 염기서열분석(scRNA-seq) 연구는 murine WAT 14,15,16,17의 분리된 기질-혈관 분획(SVF) 내에서 기질 세포의 분자 및 기능적 이질성을 강조했습니다. 자체 scRNA-seq 및 기능 분석을 통해 성체 마우스의 복강 내 WAT의 기질 구획에서 기능적으로 구별되는 면역 조절 및 지방형성 PDGFRβ+ 혈관 주위 세포 하위 집단을 식별하고 특성화했습니다15. 섬유-염증 전구체(Fibro-inflammatory precursors, FIPs)는 PDGFRβ+ 세포의 두드러진 부분집단을 나타내며 LY6C 발현(LY6C+ PDGFRβ+ 세포)을 기반으로 분리할 수 있습니다15. FIP는 지방형성 능력이 부족하고, 다양한 자극에 대해 강력한 전염증 반응을 일으키며, 콜라겐을 생성하고, 항지방형성 인자를 분비한다15. 이러한 세포의 전염증성 및 섬유화 활성은 생쥐의 비만과 관련하여 증가하며, 이는 이러한 세포가 WAT 리모델링의 조절자로 연루됩니다. LY6C- CD9- PDGFRβ+ 부분집단은 지방세포 전구세포(APC)를 나타냅니다. 이러한 APC는 Pparg 및 기타 지방유발 유전자의 발현이 풍부하며, in vitro 및 in vivo15에서 성숙한 지방세포로 쉽게 분화할 수 있다. 여기에서는 FACS를 사용하여 성체 마우스의 복강 내 WAT 저장소에서 이러한 별개의 세포 집단을 분리하고 비오틴화 항체를 사용한 면역자성 비드 분리를 위한 자세한 프로토콜을 제공합니다. 이 프로토콜은 성체 남성 및 여성 마우스의 여러 복강 내 WAT 저장소에서 기능적으로 구별되는 지방 전구 세포 하위 집단을 분리하는 데 사용할 수 있습니다15. 이러한 기능적으로 구별되는 세포 집단을 고립된 상태에서 연구하는 것은 건강과 질병에서 지방 형성 및 복강 내 지방 조직 리모델링을 조절하는 분자 메커니즘에 대한 현재의 이해에 크게 기여할 수 있습니다.
아래 프로토콜은 쥐 부고환 WAT에서 지방 전구 세포의 분리에 대해 자세히 설명합니다. 그러나, 동일한 절차를 사용하여 수컷 및 암컷 마우스 모두의 장간막 및 후복막 WAT 저장소로부터 해당 세포를 분리할 수 있다15. 마우스에서 이러한 저장소를 식별하고 격리하는 방법에 대한 자세한 프로토콜은 Bagchi et al.18에서 찾을 수 있습니다. 이 프로토콜은 생후 6-8주 된 마우스의 사용에 최적화되었습니다. APC의 빈도 및 분화 능력은 노화와 관련하여 감소할 수 있습니다.

<table>
	<tbody>
		<tr>
			<td>Mechanical Tissue Preparation and SVF Isolation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>40 and 100 &#181;m cell strainers</td>
			<td>Fisher Scientific</td>
			<td>352340/352360</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Phosphate buffered saline (PBS)</td>
			<td>Fisher Scientific</td>
			<td>21040CV</td>
			<td></td>
		</tr>
		<tr>
			<td>5ml polypropylene tubes</td>
			<td>Fisher Scientific</td>
			<td>352053</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Digestion Buffer (for 10mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>10 ml HBSS</td>
			<td>Sigma</td>
			<td>H8264</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mg Collagenase D (1 mg/ml final cc.)</td>
			<td>Roche</td>
			<td>11088882001</td>
			<td></td>
		</tr>
		<tr>
			<td>0.15 g BSA (1.5 % final cc.)</td>
			<td>Fisher Scientific</td>
			<td>BP1605-100</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Immunomagnetic separation of APCs and non-APCs</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5X MojoSort Buffer (MS buffer)</td>
			<td>BioLegend</td>
			<td>480017</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml MojoSort Magnet (MS magnet)</td>
			<td>BioLegend</td>
			<td>480019</td>
			<td></td>
		</tr>
		<tr>
			<td>100 &#181;L MojoSort Streptavidin Nanobeads</td>
			<td>BioLegend</td>
			<td>480015</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Purity Check and FACS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>10X Red Blood Cell Lysis Buffer</td>
			<td>eBioscience</td>
			<td>00-4300-54</td>
			<td></td>
		</tr>
		<tr>
			<td>Fc block (Mouse CD16/CD32)</td>
			<td>eBioscience</td>
			<td>553141</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin CD45</td>
			<td>BioLegend</td>
			<td>103103</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: 30-F11</td>
		</tr>
		<tr>
			<td>Biotin CD31</td>
			<td>BioLegend</td>
			<td>102503</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: MEC13.3</td>
		</tr>
		<tr>
			<td>Biotin CD9</td>
			<td>BioLegend</td>
			<td>124803</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: MZ3</td>
		</tr>
		<tr>
			<td>Biotin LY6C</td>
			<td>BioLegend</td>
			<td>128003</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: HK1.4</td>
		</tr>
		<tr>
			<td>CD31-PerCP/Cy5.5</td>
			<td>BioLegend</td>
			<td>102419</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: 390</td>
		</tr>
		<tr>
			<td>CD45-PerCP/Cy5.5</td>
			<td>BioLegend</td>
			<td>103131</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: 30-F11</td>
		</tr>
		<tr>
			<td>CD140b PDGFR&#946;-PE</td>
			<td>BioLegend</td>
			<td>136006</td>
			<td>Concentration: Dilution 1:50 
			Species: Mouse 
			Clone: APB5</td>
		</tr>
		<tr>
			<td>LY6C-APC</td>
			<td>BioLegend</td>
			<td>128016</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: HK1.4</td>
		</tr>
		<tr>
			<td>CD9-FITC</td>
			<td>BioLegend</td>
			<td>124808</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: MZ3</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture and Differentiation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gonadal APC Culture media (for 500mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>288 mL DMEM with 1 g/L glucose</td>
			<td>Corning</td>
			<td>10-014-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>192 mL MCDB201</td>
			<td>Sigma</td>
			<td>M6770</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL Fetal bovine serum (FBS)** lot#14E024</td>
			<td>Sigma</td>
			<td>12303C</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL 100% ITS premix</td>
			<td>BD Bioscience</td>
			<td>354352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL 10 mM L-ascorbic acid-2-2phosphate</td>
			<td>Sigma</td>
			<td>A8960-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>50 &#181;L 100 g/ml FGF-basic</td>
			<td>R&#38;D systems</td>
			<td>3139-FB-025/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Pen/Strep</td>
			<td>Corning</td>
			<td>30-001-CI</td>
			<td></td>
		</tr>
		<tr>
			<td>500 &#181;L Gentamycin</td>
			<td>Gibco</td>
			<td>15750-060</td>
			<td></td>
		</tr>
		<tr>
			<td>**NOTE: The adipogenic capacity of primary APCs can vary from lot to lot of commercial FBS. Multiple lots/sources of FBS should be tested.</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of adipogenic and fibro-inflammatory stromal cell subpopulations from murine intra-abdominal adipose depots

백색 지방 조직(WAT)의 기질-혈관 분획(SVF)은 매우 이질적이며 성인기에 WAT의 확장 및 리모델링에 기능적으로 기여하는 수많은 세포 유형으로 구성됩니다. 이러한 세포 이질성의 의미를 연구하는 데 있어 엄청난 장벽은 in vitro 및 in vivo 분석을 위해 기능적으로 구별되는 cell subpopulation을 WAT SVF에서 즉시 분리할 수 없다는 것입니다. 단세포 염기서열 분석 기술은 최근 성체 마우스의 복강 내 WAT 저장소에서 기능적으로 뚜렷한 섬유-염증성 및 지방형성 PDGFRβ+ 혈관 주위 세포 하위 집단을 식별했습니다. 섬유-염증성 전구세포('FIP'라고 함)는 전염증성 표현형을 발휘할 수 있는 비지방성 콜라겐 생성 세포입니다. PDGFRβ+ 지방세포 전구세포(APC)는 세포 이식 시 in vitro 및 in vivo 모두에서 지방성이 높습니다. 여기에서는 쥐 복강 내 WAT 저장소에서 이러한 기질 세포 하위 집단을 분리하는 여러 방법을 설명합니다. FIP 및 APC는 FACS(Fluorescence-Activated Cell Sorting) 또는 비오틴화 항체 기반 면역자기 비드 기술을 활용하여 분리할 수 있습니다. 분리된 세포는 분자 및 기능 분석에 사용할 수 있습니다. 기질 세포 하위 집단의 기능적 특성을 개별적으로 연구하면 세포 수준의 생리학적 또는 병리학적 조건에서 지방 조직 리모델링에 대한 현재 지식이 확장될 것입니다.

이 프로토콜은 성체 마우스의 복강 내 WAT 저장소에서 뚜렷한 기질 세포 집단을 분리할 수 있는 두 가지 전략을 설명합니다. APC 및 FIP는 FACS(그림 1) 또는 비오틴화 항체를 사용한 면역자성 비드 분리(그림 2)로 분리할 수 있습니다. 두 접근법 모두 상업적으로 이용 가능한 시약과 항체를 사용합니다. 면역자성 비드 분리는 gWAT SVF에서 지방형성 세포와 비지방성 세포를 분리합니다. 유세포 분석 결과 지방 분획 내 세포의 75%가 LY6C-CD9-APC를 나타내는 것으로 나타났습니다. >지방생성되지 않은 분획의 75%는 FIP(LY6C+ 세포)를 나타냈습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61610/61610fig01.jpg"> 그림 1: FACS에 의한 생식선 WAT에서 PDGFR β + 기질 세포 부분집단의 분리. (A) 절차의 개략도: 기질 혈관 분획(비지방세포 세포)은 효소 조직 분해 및 원심분리에 의해 성숙한 지방세포에서 분리되었습니다. 그런 다음 형광 활성화 세포 분류(FACS)를 사용하여 내피(CD31+) 및 조혈(CD45+) 계통 세포를 제거하고 LY6C+ PDGFRβ+ 세포(FIP) 및 LY6C-CD9-PDGFRβ+ 세포(APC)를 분리했습니다. (B) 대표적인 FACS 수집 게이트. 패널 A는 허가를 받아 ref.11에서 복제되었습니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61610/61610fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61610/61610fig02.jpg"> 그림 2: 면역자성 비드 분리에 의한 지방형성 및 비지방성 기질 세포의 분리. (A) 절차의 개략도: 1단계: CD31+ 및 CD45+ 셀이 자석에 결합합니다. 이것은 내피 세포와 조혈 계통 세포를 모두 제거합니다. CD31- 및 CD45- 세포를 함유하는 용출액을 채취한 후 각각 LY6C 및 CD9를 인식하는 항체로 배양하였다. 2단계: 자석에 결합하는 CD9+ 및 LY6C+ 세포. 단계 3: CD9- 및 LY6C- 세포를 포함하는 상층액(결합되지 않은 분획)을 지방 분획(APC)을 나타내므로 수집했습니다. 나노구에 결합된 비지방성 CD9+ 및 LY6C+ 세포는 FIP를 포함하는 비-APC 분획으로 용출되었습니다. (B) 지방형성 및 비지방형성 분획 내에서 APC(LY6C-CD9-) 및 FIP(LY6C+)의 빈도를 각각 평가하기 위한 유세포 분석 분석. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61610/61610fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
광학 현미경 및 유전자 발현 분석은 FAC에 의해 또는 6-8주령 마우스의 gWAT에서 자성 비드 분리를 통해 분리한 APC가 Gonadal APC 배양 배지에서 세포의 초기 도금 후 7-10일 이내에 높은 수준으로 지질 함유 지방세포로 분화되었음을 보여줍니다(그림 3). 대조적으로, 비지방형성 전구체(예: 섬유-염증성 전구체 또는 FIP)는 섬유아세포와 유사하게 유지되었으며 동일한 배양 배지(Gonadal APC 배양 배지)에서 유지될 때 지방세포가되지 않았습니다(그림 3). non-APCs 배양에서 약간의 지질 축적을 보인 세포는 거의 없다는 점에 유의해야 합니다(그림 3D). 이는 세포 분리 중 APC 오염으로 인해 발생할 수 있습니다. 추가 세척은 이 분획의 순도를 향상시킬 수 있습니다.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61610/61610fig03.jpg"> 그림 3: 성체 마우스의 gWAT에서 분리한 PDGFR β + 기질 세포 집단의 시험관 내 분화. (서기-인도) 6-8주 된 마우스 gWAT SVF에서 면역자기 비드 분리(A-B) 또는 FACS(C-D)로 분리한 분화된 기질 세포 하위 집단의 대표적인 명시야 이미지. 이미지는 Gonadal APC 배양 배지에서 세포를 도운장한 후 7일 후에 촬영되었습니다. 도금 후 7-10일 이내에 APC는 자발적인 지방 세포 분화를 겪습니다. 배율 10X. 스케일 = 250 μM. (E-F) A-D에 표시된 분화된 배양에서 지방 세포 선택 유전자의 mRNA 수준. 막대 그래프는 평균 + SEM을 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61610/61610fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>FIP (영어)</td>
			<td>농축 유전자(vs. APC)</td>
			<td colspan="2">포워드 프라이머 5'-3'</td>
			<td colspan="2">리버스 프라이머 5'-3'</td>
		</tr><tr><td></td>
			<td>라이6c1</td>
			<td colspan="2">ACTGTGCCTGCAACCTTGTCT</td>
			<td colspan="2">GGCCACAAGAATGAGCAC</td>
		</tr><tr><td></td>
			<td>CD9 (CD9)</td>
			<td colspan="2">GCGGGAAACACTCAAAGCCAT</td>
			<td colspan="2">AAAGCTGTTTCTTGGGGCAGG</td>
		</tr><tr><td></td>
			<td>11월</td>
			<td colspan="2">GTTCCAAGAGCTGT그가앗그</td>
			<td colspan="2">CTCTTGTTCACAAGGCCGAAC (영어)</td>
		</tr><tr><td></td>
			<td>에프hd1</td>
			<td colspan="2">GGCCGCTCTAAGGTCTTCAAT</td>
			<td colspan="2">GTCAATAAAGCCGTCCCTTCC</td>
		</tr><tr><td></td>
			<td>STMN4</td>
			<td colspan="2">ACCTGAACTGGTGCGTCATCT</td>
			<td colspan="2">CTTGGAGGGAGG캇따악</td>
		</tr><tr><td></td>
			<td>닥트2</td>
			<td colspan="2">AGCCCCCT아아아가아악</td>
			<td colspan="2">GGTCCTTGGCCACAGT카타</td>
		</tr><tr><td></td>
			<td>IL33</td>
			<td colspan="2">아ttccccggcaaagttcag</td>
			<td colspan="2">아카그가gtct캣그카그타가</td>
		</tr><tr><td></td>
			<td>CCL2 (씨씨2)</td>
			<td colspan="2">CCACAACCACCTCAAGCACTTC</td>
			<td colspan="2">AAGGCATCACAGTCCGAGTCAC</td>
		</tr><tr><td></td>
			<td>Tgfb2</td>
			<td colspan="2">GGTGTTGTTCCACAGGGGTTA</td>
			<td colspan="2">CGGTCCTTCAGATCCTCCTTT</td>
		</tr><tr><td></td>
			<td>에프엔1</td>
			<td colspan="2">GAGAGCACACCCGTTTTCATC (영문)</td>
			<td colspan="2">GGGTCCACATGATGGTGACTT</td>
		</tr><tr><td></td>
			<td>DPP4</td>
			<td colspan="2">TGGTGGATGCTGGTGTGTGTGT</td>
			<td colspan="2">아아그그그cctctcttctctcttcct</td>
		</tr><tr><td></td>
			<td>티1</td>
			<td colspan="2">TCTTTTTTCCCTTGCCCCTCTG</td>
			<td colspan="2">AGGTTGCAAGACTCTCGCTGT</td>
		</tr><tr><td colspan="6"></td>
		</tr><tr><td>APC (APC)</td>
			<td>Enriched Genes (vs. FIPs)</td>
			<td colspan="2">포워드 프라이머 5'-3'</td>
			<td colspan="2">리버스 프라이머 5'-3'</td>
		</tr><tr><td></td>
			<td>아그트</td>
			<td colspan="2">GTTCTGGGCAAAACTCAGTGC</td>
			<td colspan="2">GAGGCTCTGCTGCTCATCATT</td>
		</tr><tr><td></td>
			<td>CXCL14</td>
			<td colspan="2">TGGACGGGTCCAAGTGTGT아</td>
			<td colspan="2">TCCTCGCAGTGTGGGTACTTT</td>
		</tr><tr><td></td>
			<td>엠디2</td>
			<td colspan="2">ATCTGGGAGCTGATGAAGGA</td>
			<td colspan="2">AGTGGGT아카그카아아트그</td>
		</tr><tr><td></td>
			<td>PDE11a</td>
			<td colspan="2">CGAGCTTGT카가아가아가가</td>
			<td colspan="2">TTCAGCCACCTGTCTGGAGAT</td>
		</tr><tr><td></td>
			<td>LRN1</td>
			<td colspan="2">CAACATGGGGAGCTGGTTTC 님</td>
			<td colspan="2">GCACACTACGGAAAGCCAAAC</td>
		</tr><tr><td></td>
			<td>프파르그</td>
			<td colspan="2">GCATGGTGCCTTCGCTGA</td>
			<td colspan="2">TGGCATCTGTGT카아캇그</td>
		</tr><tr><td></td>
			<td>팹프4</td>
			<td colspan="2">ACTGGGCGT가찡가랴</td>
			<td colspan="2">아카그크트그카카캣크gt</td>
		</tr><tr><td></td>
			<td>엘플</td>
			<td colspan="2">CATCGAGAGAGGATCCGAGTGAA</td>
			<td colspan="2">TGCTGAGTCCTTTCCCTTCTG</td>
		</tr><tr><td></td>
			<td>cd36</td>
			<td colspan="2">갸그트그크가아아gtg</td>
			<td colspan="2">GAGAATGCCTCCAAACACAGC</td>
		</tr></tbody></table>표 1: FIP 및 APC의 분리를 검증하는 데 사용되는 qPCR 프라이머 염기서열

Read this Scientific Article Protocol about Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots at JoVE.com

Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots

이 프로토콜은 형광 활성화 세포 분류 또는 면역자기 비드 분리를 통해 쥐 복강 내 백색 지방 조직(WAT) 저장소에서 지방 형성 및 섬유 염증성 기질 세포 하위 집단을 분리하는 기술적 접근 방식을 설명합니다.

The stromal-vascular fraction (SVF) of white adipose tissue (WAT) is remarkably heterogeneous and consists of numerous cell types that contribute ...

isolation-adipogenic-fibro-inflammatory-stromal-cell-subpopulations

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

2.5K 조회수.  Novo Nordisk A/S. 이 프로토콜은 형광 활성화 세포 분류 또는 면역자기 비드 분리를 통해 쥐 복강 내 백색 지방 조직(WAT) 저장소에서 지방 형성 및 섬유 염증성 기질 세포 하위 집단을 분리하는 기술적 접근 방식을 설명합니다.

비디오: Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for isolating precursor B-cells at four different stages of differentiation. Because genes are expressed and epigenetic modifications occur in a tissue specific manner, it is vital to discriminate between tissues and cell types in order to be able to identify alterations in the genome and the epigenome that may lead to the development of disease. This method can be adapted to any type of cell present in umbilical cord blood at any stage of differentiation.	
This method comprises 4 main steps. First, mononuclear cells are separated by density centrifugation. Second, B-cells are enriched using biotin conjugated antibodies that recognize and remove non B-cells from the mononuclear cells. Third the B-cells are fluorescently labeled with cell surface protein antibodies specific to individual stages of B-cell development. Finally, the fluorescently labeled cells are sorted and individual populations are recovered. The recovered cells are of sufficient quantity and quality to be utilized in downstream nucleic acid assays.

Here we describe a protocol for isolating subsets of precursor B-cells from umbilical cord blood. A sufficient quantity and quality of nucleic acids may be extracted from the cells and used in subsequent assays utilizing DNA or RNA.

탯줄 혈액에서 전구체 B-세포 하위 집합의 절연

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

연구

면역학 및 감염병학

Isolation of Adipose Tissue Immune Cells

The discovery of increased macrophage infiltration in the adipose tissue (AT) of obese rodents and humans has led to an intensification of interest in immune cell contribution to local and systemic insulin resistance. Isolation and quantification of different immune cell populations in lean and obese AT is now a commonly utilized technique in immunometabolism laboratories; yet extreme care must be taken both in stromal vascular cell isolation and in the flow cytometry analysis so that the data obtained is reliable and interpretable. In this video we demonstrate how to mince, digest, and isolate the immune cell-enriched stromal vascular fraction. Subsequently, we show how to antibody label macrophages and T lymphocytes and how to properly gate on them in flow cytometry experiments. Representative flow cytometry plots from low fat-fed lean and high fat-fed obese mice are provided. A critical element of this analysis is the use of antibodies that do not fluoresce in channels where AT macrophages are naturally autofluorescent, as well as the use of proper compensation controls.

Adipose tissue (AT) is a site of intense immune cell activation and interaction. Almost all cells of the immune system are present in AT and their ratios are altered by obesity. Proper isolation, quantification, and characterization of AT immune cell populations are critical for understanding their role in immunometabolic disease.

지방 조직 면역 세포의 분리

The discovery of increased macrophage infiltration in  the adipose tissue (AT) of obese rodents and humans has led to an  intensification of interest in ...

Isolation of Cortical Microglia with Preserved Immunophenotype and Functionality From Murine Neonates

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure for isolation of microglia from neonatal murine cortices by mechanical agitation with a rotary shaker. This microglia isolation method yields highly pure cortical microglia that exhibit morphological and functional characteristics indicative of quiescent microglia in normal, nonpathological conditions in vivo. This procedure also preserves the microglial immunophenotype and biochemical functionality as demonstrated by the induction of morphological changes, nuclear translocation of the p65 subunit of NF-&#954;B (p65), and secretion of the hallmark proinflammatory cytokine, tumor necrosis factor-&#945; (TNF-&#945;), upon lipopolysaccharide (LPS) and Pam3CSK4 (Pam) challenges. Therefore, the present isolation procedure preserves the immunophenotype of both quiescent and activated microglia, providing an experimental method of investigating microglia biology in ex vivo conditions.

One key to successful investigation of microglial biology is the preservation of microglial immunofunction ex vivo during isolation from CNS tissue. Isolating microglia via rotary shaking results in highly pure and immunofunctional cell cultures as assessed by fluorescent imaging, immunocytochemistry, and ELISA following microglia activation with the proinflammatory stimuli lipopolysaccharide (LPS) and Pam3CSK4 (Pam).

쥐과 신생아에서 보존 면역 표현형과 기능으로 두피 소교 세포의 분리

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure ...

Isolation of Murine Lymph Node Stromal Cells

Secondary lymphoid organs including lymph nodes are composed of stromal cells that provide a structural environment for homeostasis, activation and differentiation of lymphocytes. Various stromal cell subsets have been identified by the expression of the adhesion molecule CD31 and glycoprotein podoplanin (gp38), T zone reticular cells or fibroblastic reticular cells, lymphatic endothelial cells, blood endothelial cells and FRC-like pericytes within the double negative cell population. For all populations different functions are described including, separation and lining of different compartments, attraction of and interaction with different cell types, filtration of the draining fluidics and contraction of the lymphatic vessels. In the last years, different groups have described an additional role of stromal cells in orchestrating and regulating cytotoxic T cell responses potentially dangerous for the host. 
Lymph nodes are complex structures with many different cell types and therefore require a appropriate procedure for isolation of the desired cell populations. Currently, protocols for the isolation of lymph node stromal cells rely on enzymatic digestion with varying incubation times; however, stromal cells and their surface molecules are sensitive to these enzymes, which results in loss of surface marker expression and cell death. Here a short enzymatic digestion protocol combined with automated mechanical disruption to obtain viable single cells suspension of lymph node stromal cells maintaining their surface molecule expression is proposed.

Isolation of lymph node stromal cells is a multistep procedure including enzymatic digestion and mechanical disaggregation to obtain fibroblastic reticular cells, lymphatic and blood endothelial cells. In the described procedure, a short digestion is combined with automated mechanical disaggregation to minimize surface marker degradation of viable lymph node stromal cells.

쥐과 림프절 기질 세포의 분리

Secondary lymphoid organs including lymph nodes are composed of stromal cells that provide a structural environment for homeostasis, activation and ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

산모 - 태아 인터페이스에서 쥐의 조직에서 백혈구의 분리

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

절연, 확장, 및 Adipogenic CD34 + CD31 + 인간의 Omental 및 피하 지방 조직에서 내 피 세포의 유도

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...

Isolation of Extracellular Vesicles from Murine Bronchoalveolar Lavage Fluid Using an Ultrafiltration Centrifugation Technique

Extracellular vesicles (EVs) are newly discovered subcellular components that play important roles in many biological signaling functions during physiological and pathological states. The isolation of EVs continues to be a major challenge in this field, due to limitations intrinsic to each technique. The differential ultracentrifugation with density gradient centrifugation method is a commonly used approach and is considered to be the gold standard procedure for EV isolation. However, this procedure is time-consuming, labor-intensive, and generally results in low scalability, which may not be suitable for small-volume samples such as bronchoalveolar lavage fluid. We demonstrate that an ultrafiltration centrifugation isolation method is simple and time- and labor-efficient yet provides a high recovery yield and purity. We propose that this isolation method could be an alternative approach that is suitable for EV isolation, particularly for small-volume biological specimens.

Here, we describe two extracellular vesicle isolation protocols, ultrafiltration centrifugation and ultracentrifugation with density gradient centrifugation, to isolate extracellular vesicles from murine bronchoalveolar lavage fluid samples. The extracellular vesicles derived from murine bronchoalveolar lavage fluid by both methods are quantified and characterized.

Extracellular 소포 Murine Bronchoalveolar 게 유체는 한 원심 분리 기법을 사용 하 여에서 격리

Extracellular vesicles (EVs) are newly discovered subcellular components that play important roles in many biological signaling functions during ...

Simultaneous Study of the Recruitment of Monocyte Subpopulations Under Flow In Vitro

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development and autoimmune diseases. This is facilitated through a process of capture from free flow onto the luminal surface of activated endothelial cells, followed by their adhesion and transendothelial migration (transmigration) into the underlying affected tissue. However, the mechanisms that support the preferential and context-dependent recruitment of monocyte subpopulations are still not fully understood. Therefore, we have developed a method that allows the recruitment of different monocyte subpopulations to be simultaneously visualized and measured under flow. This method, based on time-lapse confocal imaging, allows for the unambiguous distinction between adherent and transmigrated monocytes. Here, we describe how this method can be used to simultaneously study the recruitment cascade of pro-angiogenic and non-angiogenic monocytes in vitro. Furthermore, this method can be extended to study the different steps of recruitment of up to three monocyte populations.

Here, we present an integrated protocol that measures monocyte subpopulation trafficking under flow in vitro by use of specific surface markers and confocal fluorescence microscopy. This protocol can be used to explore sequential recruitment steps as well as to profile other leukocyte subtypes using other specific surface markers.

생체 외에서 흐름 아래 Monocyte 모집단의 채용의 동시 연구

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development ...

Isolation of Single Intracellular Bacterial Communities Generated from a Murine Model of Urinary Tract Infection for Downstream Single-cell Analysis

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected in the urinary tract. The protocol can be broadly divided into three sections: the infection, bladder epithelial cell harvesting, and mouth micropipetting to isolate individual infected epithelial cells. The isolated epithelial cell contains viable bacterial cells and is nearly free of contaminating extracellular bacteria, making it ideal for downstream single-cell analysis. The time taken from the start of infection to obtaining a single intracellular bacterial community is about 8 h. This protocol is inexpensive to deploy and uses widely available materials, and we anticipate that it can also be utilized in other infection models to isolate single infected cells from cell mixtures even if those infected cells are rare. However, due to a potential risk in mouth micropipetting, this procedure is not recommended for highly infectious agents.

This protocol describes a simple method of isolating single, infected-bladder epithelial cells from a murine model of urinary tract infection.

다운스트림 단일 세포 분석에 대 한 요로 감염의 Murine 모델에서 생성 된 단일 세포내 세균성 지역 사회의 절연

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected ...

Isolation of Lamina Propria Mononuclear Cells from Murine Colon Using Collagenase E

The intestine is the home to the largest number of immune cells in the body. The small and large intestinal immune systems police exposure to exogenous antigens and modulate responses to potent microbially derived immune stimuli. For this reason, the intestine is a major target site of immune dysregulation and inflammation in many diseases including but, not limited to inflammatory bowel diseases such as Crohn&#8217;s disease and ulcerative colitis, graft-versus-host disease (GVHD) after bone marrow transplantation (BMT), and many allergic and infectious conditions. Murine models of gastrointestinal inflammation and colitis are heavily used to study GI complications and to pre-clinically optimize strategies for prevention and treatment. Data gleaned from these models via isolation and phenotypic analysis of immune cells from the intestine is critical to further immune understanding that can be applied to ameliorate gastrointestinal and systemic inflammatory disorders. This report describes a highly effective protocol for the isolation of mononuclear cells (MNC) from the colon using a mixed silica-based density gradient interface. This method reproducibly isolates a significant number of viable leukocytes while minimizing contaminating debris, allowing subsequent immune phenotyping by flow cytometry or other methods.

The goal of this protocol is to isolate mononuclear cells that reside in the lamina propria of the colon by enzymatic digestion of the tissue using collagenase. This protocol allows for the efficient isolation of mononuclear cells resulting in a single cell suspension which in turn can be used for robust immunophenotyping.

콜라게나아제 E를 사용하여 뮤린 결장에서 라미나 프로프리아 단핵 세포의 분리

The intestine is the home to the largest number of immune cells in the body. The small and large intestinal immune systems police exposure to exogenous ...