JHN는 스위스 국립 재단 (SNSF 310030_146290)에 의해 지원 됩니다.

마우스 사육 되었고 조건 하에서 특정 병원 체 무료 (SPF) 동물 시설에서 의학의 부, 바젤의 대학 (바젤, 스위스)의 유지. 모든 마우스 실험은 스위스 연방 및 Cantonal 규정 (동물 프로토콜 번호 2816 [구획의 바젤-스타트]) 수행 했다.
1입니다. LPS 솔루션의 준비
<ol><li>대장균 살 균 조건 하에서 0111:B4에서 순화 LPS의 주식 열고 5 mg/mL의 농도에 물에 그것을 다시 구성 합니다.</li>
	<li>0.2 µ g / µ L의 작업 집중에 버퍼링 하는 멸 균 인산 염 분 (PBS)와 LPS 재고 희석.</li>
</ol>2. 복 사출 마우스에 LPS의
<ol><li>0.5 mL 주사기에 층 류 기류에 30 G 바늘 솔루션 작업 LPS 발음</li>
	<li>여성 C57Bl/6 마우스의 나이 10 주 (6) 무게와 주입 됩니다 LPS의 양을 계산: 10 µ L (2 µ g) /g 몸 무게. 참고: 예를 들어 마우스 무게 20 g, 다음 20 g x 10 µ L = 200 µ L LPS를 주입 해야 솔루션을 작업.</li>
	<li>부드럽게 하지만 단단히 마우스를 처리 하 고 한 손으로에서 동물을 제 지. 동물 수 일반적으로 호흡을 하지만 하지 트위스트 감 중 설정 인지 확인 합니다.</li>
	<li>마우스 코를 주입에 대 한 복 부를 노출 바닥 쪽으로 약간 기울기. 왼쪽 또는 오른쪽 중간 선에서 낮은 복 부에 복 부와 주입 장소의 중간을 찾습니다. 컨트롤 마우스에 LPS 대신 i.p. PBS를 삽입할.</li>
	<li>자유 재량으로 적절 한 볼륨 (볼륨 단계 2.2에서에서 계산) 주입 작업 솔루션 LPS의. 바늘 입력 했습니다 복 막 구멍으로 그렇지 않으면 복 부 근육 층에 잘못 주사 발생할 수 있는지 확인 합니다. 아직도, 이동 하지 마십시오 너무 깊이 바늘과 그 지역에 있는 내부 장기 부상 방지에 복 막 구멍으로.</li>
	<li>감 금 소 당 최대 5 마우스 케이지를 신중 하 게 동물을 반환 합니다.</li>
</ol>3입니다. 모니터는 쥐
<ol><li>발생과 endotoxemia의 심각도 대 한 8 h에 대 한 주입 후 주입 및 모든 2 h의 시간에 동물을 모니터링 합니다. 따라서, 이전에 게시 원고 24에서 적응 된 점수 시트 (표 1)를 사용 하 여.</li>
	<li>
표 1에 나열 된 다음 매개 변수에 대 한 LPS 주입 된 쥐를 점수
	<ol>
<li>일반적으로 부드러운 모피의 모양을 확인 합니다. 모피 뻗 치고, 칼 날 달린 푹신한 모피 불편 하거나 통증을 나타내는 경우, 1, 2, 또는 3 그들을 점수.</li>
		<li>마우스의 활동에 대 한 확인 합니다. 참고: 마우스 일반적으로 이동 자유롭게 먹고, 마시고, 등반, 전체 케이지 하지만 억제 또는 제한 된 활동 통증의 징조 수 있습니다.</li>
		<li>의식의 수준에 대 한 확인 하십시오. 참고: 마우스는 매우 호기심, 그리고 그들은 일반적으로 주변 조사 케이지 주위에 이동. 부족 또는 감소 운동 통증과 불편을 건의 할 수 있다.</li>
		<li>눈을 확인 하십시오. 참고: 건강 한 쥐에 완전히 열린 눈으로 예상 된다 하지만, 분 비, 가능 하 게 부분적으로 또는 완전 하 게 닫힌된 눈 통증의 표시 될 수 있습니다.</li>
		<li>호흡 속도를 확인 합니다. 참고: 건강 마우스 일반적으로 정상적이 고 급속 한 호흡 속도, 감소 된 호흡 속도 불편의 표시 될 수).</li>
		<li>호흡 품질에 대 한 확인 하십시오. 참고: 함께 또는 없이 헐 떡이 고 심한 흔적이 호흡 고통의 표시 이다.</li>
	</ol>
</li>
</ol>4. 조직 샘플링 Ribonucleic 산 (RNA) 추출 및 균질 화
<ol><li>컬렉션/균질 튜브 준비: 추가 1 mL 단일 단계 RNA 격리 시 약 2 mL 튜브에 prefilled 1.4 m m 세라믹 분야와 함께.</li>
	<li>적절 한 시간에 ((0 h) 전에 2 h, 4 h와 LPS 주입 후 8 h) exsanguination 뒤 마 취 과다 복용 (isoflurane)와 마우스를 안락사와 해 부와 함께 진행.</li>
	<li>피부와 내부 장기와 복 부 구멍이 함께 노출 근육 레이어 컷.</li>
	<li>조심 스럽게 비장, 간, 그리고 결 장 해 부, 지방에서 장기를 청소 하 고 얼음에 PBS에서 그들을 유지.</li>
	<li>가 위 또는 메스를 사용 하 여 각 기관에서 작은 조각 (약 0.5 cm 긴) 그만. 참고: 그것은 항상 각 마우스 (간, 근 위 또는 원심 부분의 결 같은 엽)에 오르간의 대략 동일한 부분에서 조각을 하는 것이 중요.</li>
	<li>곧 건조 한 종이 티슈의 조각에 조직 및 RNA 격리 시에 완전히 몰입 확인 하 고 컬렉션/균질 튜브에.</li>
	<li>고속 벤치탑 균질 화기에 조직 균질 비장, 간, 그리고 콜론 균질의 1 개 주기에서 사용 속도 6.00 30 같은 부드러운 조직에 대 한 s.</li>
	<li>실 온에서 5 분에 대 한 샘플을 품 어.</li>
	<li>신중 하 게 장소를 액체 질소에 튜브 동결 조직 lysate. RNA 분리까지 lysate-80 ° C에서 냉동 스냅을 저장 합니다.</li>
</ol>5. 조직에서 RNA 추출
참고: RNA 격리 시 약, 클로 프롬, 및 알콜 유해 물질로 간주 됩니다. RNA 추출 화학 후드 수행 합니다. RNase 없는 환경을 유지 하기 위해 인증 RNase 무료 시 약 및 장비를 사용 합니다.
<ol><li>
상 분리
	<ol>
<li>냉동된 조직 lysate 얼음에 녹여</li>
		<li>1000 x g 남아 있을 수 있습니다 남아 있는 조직 입자를 펠 렛을 4 ° C에서 5 분에 샘플 원심</li>
		<li>새로운 nuclease 무료 1.5 mL 튜브에는 상쾌한을 전송.</li>
		<li>200 µ L 얼음 클로 프롬 / 1 mL RNA 격리 시 약을 추가 하 고 10-15 s 손으로 적극적으로 악수.</li>
		<li>실 온에서 2-3 분 동안 품 어.</li>
		<li>12에서 원심 분리기, 4 ° c.에 15 분 동안 000 x g 참고: 샘플 이제 3 단계 포함 됩니다: 빨간색 페 놀-클로 프롬 위상과 interphase, 상단 무색 수성 단계 낮은. RNA는 위 수성 단계에 존재.</li>
		<li>위 수성 단계 (총 볼륨의 50%)와 전송 새로운 nuclease 무료 1.5 mL 튜브에 수집 합니다.</li>
	</ol>
</li>
	<li>
RNA 강 수
	<ol>
<li>1 mL RNA 격리 시 당 0.5 mL 얼음 처럼 차가운 소 프로 파 놀을 추가 하 고 반전 튜브 5-6 번으로 부드럽게 혼합.</li>
		<li>실 온에서 10-15 분 동안 품 어.</li>
		<li>4 ° c.에서 10 분 동안 12000 x g에서 원심 분리기 참고: RNA 펠 릿이이 단계에 표시 됩니다.</li>
	</ol>
</li>
	<li>
RNA 펠 릿의 세척
	<ol>
<li>완전히 제거는 펠 렛을 방해 하지 않고는 소 프로 파 놀을 포함 하는 상쾌한.</li>
		<li>1 mL RNA 격리 시 약 사용 초기 세포 당 1 mL 차가운 75% 에탄올과 펠 릿을 세척.</li>
		<li>짧게 샘플 소용돌이입니다.</li>
		<li>4 ° c.에서 5 분 동안 원심 분리기 7500 (12000) x g에서 샘플</li>
	</ol>
</li>
	<li>
RNA를 용 해
	<ol>
<li>완전히는 펠 렛을 방해 하지 않고는 상쾌한에 에탄올을 제거 합니다.</li>
		<li>3-5 분 실 온에서 RNA 펠 릿 건조 화학 후드 아래 열린된 관 두고 (-건조 하지 마십시오 경우 그것은 RNA를 분해 하기 어려운 것으로).</li>
		<li>신중 하 게 여기저기 pipetting으로 20-50 µ L nuclease 무료 물에 RNA 펠 릿을 디졸브.</li>
		<li>더는 RNA의 솔루션을 개선 하기 위해 10-15 분 55 ° C에서 샘플을 품 어. 참고:이 단계에서 RNA는 추가 분석까지-80 ° C에 저장할 수 있습니다.</li>
	</ol>
</li>
</ol>6입니다. 나머지 DNA의 소화
<ol><li>분 광 광도 계는 분 광 광도 계에는 약 수 (2 µ l)를 pipetting으로 RNA 농도 측정 하 고 권장된 농도를 조정 합니다.</li>
	<li>Max DNA 오염의 소화를 시작 합니다. 50 µ L nuclease 무료 물에는 10 µ g RNA</li>
	<li>DNase I 버퍼와 1 µ L rDNase 샘플 및 혼합 pipetting으로 부드럽게 나 고 아래로 x 10의 0.1 볼륨을 추가 합니다.</li>
	<li>20-30 분 동안 37 ° C에서 품 어.</li>
	<li>소용돌이 DNase 비활성화 시 약 0.1 볼륨 피펫으로와 잘 혼합 하는 샘플을 추가 하 고.</li>
	<li>가끔 손으로 혼합 실 온에서 5 분 동안 품 어.</li>
	<li>1.5 분 동안 10000 x g에서 원심.</li>
	<li>상쾌한 새 nuclease 무료 튜브에 RNA DNA 무료 포함 된 전송 합니다.</li>
	<li>분 광 광도 계에 의해 RNA 농도 품질을 측정 합니다.</li>
</ol>7. 반전 녹음 방송
<ol><li>반전 녹음 방송에 대 한 상용 Deoxyribonucleic acid cDNA 반전 녹음 방송 (RT) 키트를 사용 합니다. 참고: 여기, RNA의 2 µ g까지 되돌릴 수 있습니다 베낀.</li>
	<li>2 µ g RNA를 포함 하는 볼륨을 계산 합니다. 새로운 PCR 튜브에 2 µ g RNA 플라스틱</li>
	<li>10 µ L의 최종 볼륨을 PCR 튜브에 샘플 nuclease 무료 물을 추가 합니다.</li>
	<li>표 2 에 나열 된 다음과 같은 구성 요소를 혼합 하 여 마스터 믹스 2 x 준비
</li>
	<li>20 µ L의 총 볼륨 믹스 마스터 x 1를 10 µ l RNA 마스터 믹스 x 10 µ L 2를 추가 합니다.</li>
	<li>중 합 효소 연쇄 반응 (PCR) 튜브 및 샘플 다운 스핀을 잠시 닫습니다.</li>
	<li>PCR Thermocycler에서 샘플을 놓고 표 3에 나열 된 설정을 설정 합니다.</li>
	<li>추가 분석을 위해-20 ° C에서 생성 된 cDNA를 저장 합니다.</li>
</ol>8. 정량적 PCR (정량)
<ol><li>상용 키트 정량 Pcr 반응을 수행 합니다.</li>
	<li>자체 디자인과 intron 스패닝 뇌관의 템플릿 cDNA의 다른 농도와 사용 하기 전에 테스트. 표준 곡선을 작성 하 여 뇌관의 효능을 분석 하 고 뇌관을 사용 하 여 높은 효능과 올바른 녹는 곡선. 참고:이 실험에 사용 된 뇌관의 시퀀스는 표 2에 나열 됩니다.</li>
	<li>표 4에 설명 된 반응 설치 정량적 중 합 효소 연쇄 반응 (정량) 반응 384-잘 접시에서를 준비 합니다.</li>
	<li>모든 솔루션 및 알루미늄 호 일을 사용 하 여 반응 혼합물이 준비 될 때 젖 지 접시를 방지 하기 위해 얼음에 플레이트를 유지.</li>
	<li>Triplicates 모든 반응을 수행 합니다.</li>
	<li>표 5에 나열 된 설정을 사용 하 여 thermocycler에 PCR 반응을 수행 합니다.</li>
	<li>triplicates에서 모든 반응에 대 한 평균 Ct 값을 계산 합니다. Glycerinealdehyde-3-인산 염-효소 식 수준에 모든 대상 유전자를 정상화 (Gapdh) 2^(-ΔCt)를 계산 하 여 내부 관리 유전자. 참고: 모든 대상 유전자 평균 Ct와 > 35 검출 한계에서 것으로 간주 되었다.</li>
</ol>

<ol>
	<li>Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-bacterial+mutualism+in+the+human+intestine.">Host-bacterial mutualism in the human intestine.</a> Science. 307, 1915-1920 (2005).</li><li>Abreu, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+NOD2+are+associated+with+fibrostenosing+disease+in+patients+with+Crohn's+disease.">Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease.</a> Gastroenterology. 123, 679-688 (2002).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunocytochemical+evidence+of+Listeria,+Escherichia+coli,+and+Streptococcus+antigens+in+Crohn's+disease.">Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease.</a> Gastroenterology. 108, 1396-1404 (1995).</li><li>Schaffer, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-Saccharomyces+cerevisiae+mannan+antibodies+(ASCA)+of+Crohn's+patients+crossreact+with+mannan+from+other+yeast+strains,+and+murine+ASCA+IgM+can+be+experimentally+induced+with+Candida+albicans.">Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans.</a> Inflamm Bowel Dis. 13, 1339-1346 (2007).</li><li>Sellon, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resident+enteric+bacteria+are+necessary+for+development+of+spontaneous+colitis+and+immune+system+activation+in+interleukin-10-deficient+mice.">Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice.</a> Infect Immun. 66, 5224-5231 (1998).</li><li>Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+microbiota+in+mouse+models+of+inflammatory+bowel+disease.">The gut microbiota in mouse models of inflammatory bowel disease.</a> Front Cell Infect Microbiol. 4, 28 (2014).</li><li>Schaubeck, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dysbiotic+gut+microbiota+causes+transmissible+Crohn's+disease-like+ileitis+independent+of+failure+in+antimicrobial+defence.">Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence.</a> Gut. 65, 225-237 (2016).</li><li>Steinert, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Stimulation+of+Macrophages+with+TLR+Ligands+Supports+Increased+IL-19+Expression+in+Inflammatory+Bowel+Disease+Patients+and+in+Colitis+Models.">The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models.</a> J Immunol. 199, 2570-2584 (2017).</li><li>Gabele, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DSS+induced+colitis+increases+portal+LPS+levels+and+enhances+hepatic+inflammation+and+fibrogenesis+in+experimental+NASH.">DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH.</a> J Hepatol. 55, 1391-1399 (2011).</li><li>Saunders, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-type+lectin+SIGN-R1+has+a+role+in+experimental+colitis+and+responsiveness+to+lipopolysaccharide.">C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide.</a> J Immunol. 184, 2627-2637 (2010).</li><li>Spadoni, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gut-vascular+barrier+controls+the+systemic+dissemination+of+bacteria.">A gut-vascular barrier controls the systemic dissemination of bacteria.</a> Science. 350, 830-834 (2015).</li><li>Balmer, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+liver+may+act+as+a+firewall+mediating+mutualism+between+the+host+and+its+gut+commensal+microbiota.">The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota.</a> Sci Transl Med. 6, 237ra266 (2014).</li><li>Maier, R. V., Mathison, J. C., Ulevitch, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+bacterial+lipopolysaccharides+with+tissue+macrophages+and+plasma+lipoproteins.">Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins.</a> Prog Clin Biol Res. 62, 133-155 (1981).</li><li>Lu, Y. C., Yeh, W. C., Ohashi, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LPS/TLR4+signal+transduction+pathway.">LPS/TLR4 signal transduction pathway.</a> Cytokine. 42, 145-151 (2008).</li><li>Deng, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipopolysaccharide+clearance,+bacterial+clearance,+and+systemic+inflammatory+responses+are+regulated+by+cell+type-specific+functions+of+TLR4+during+sepsis.">Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis.</a> J Immunol. 190, 5152-5160 (2013).</li><li>Kagan, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAM+couples+endocytosis+of+Toll-like+receptor+4+to+the+induction+of+interferon-beta.">TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta.</a> Nat Immunol. 9, 361-368 (2008).</li><li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+immunopathogenesis+of+sepsis.">The immunopathogenesis of sepsis.</a> Nature. 420, 885-891 (2002).</li><li>Suffredini, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+recombinant+dimeric+TNF+receptor+on+human+inflammatory+responses+following+intravenous+endotoxin+administration.">Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration.</a> J Immunol. 155, 5038-5045 (1995).</li><li>Fink, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+sepsis.">Animal models of sepsis.</a> Virulence. 5, 143-153 (2014).</li><li>Poltorak, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defective+LPS+signaling+in+C3H/HeJ+and+C57BL/10ScCr+mice:+mutations+in+Tlr4+gene.">Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene.</a> Science. 282, 2085-2088 (1998).</li><li>Hoshino, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+Toll-like+receptor+4+(TLR4)-deficient+mice+are+hyporesponsive+to+lipopolysaccharide:+evidence+for+TLR4+as+the+Lps+gene+product.">Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product.</a> J Immunol. 162, 3749-3752 (1999).</li><li>Corral, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+lipopolysaccharide+and+cecal+ligation+and+puncture+on+blood+coagulation+and+inflammation+in+sensitive+and+resistant+mice+models.">Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models.</a> Am J Pathol. 166, 1089-1098 (2005).</li><li>Shrum, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+scoring+system+to+evaluate+sepsis+severity+in+an+animal+model.">A robust scoring system to evaluate sepsis severity in an animal model.</a> BMC Res Notes. 7, 233 (2014).</li><li>Brandwein, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneously+colitic+C3H/HeJBir+mice+demonstrate+selective+antibody+reactivity+to+antigens+of+the+enteric+bacterial+flora.">Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora.</a> J Immunol. 159, 44-52 (1997).</li><li>Macpherson, A. J., McCoy, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standardised+animal+models+of+host+microbial+mutualism.">Standardised animal models of host microbial mutualism.</a> Mucosal Immunol. 8, 476-486 (2015).</li><li>Masopust, D., Sivula, C. P., Jameson, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+Mice,+Dirty+Mice,+and+Men:+Using+Mice+To+Understand+Human+Immunology.">Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology.</a> J Immunol. 199, 383-388 (2017).</li><li>Wirtz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+from+lethal+septic+peritonitis+by+neutralizing+the+biological+function+of+interleukin+27.">Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27.</a> J Exp Med. 203, 1875-1881 (2006).</li></ol>

저자는 공개 없다.

이 프로토콜 미생물-파생 제품에 의해 침공 후 발생 하는 면역 프로세스를 모방 합니다. 프로토콜 내에서 중요 한 단계는 마우스 선, 쥐의 위생 상태, LPS, endotoxemia, 발생과 실험 종료의 시간 포인트에 대 한 동물의 모니터링의 복용량의 선택. 가장 중요 한 것은, 마우스 스트레인의 유전 배경 고려 될 수 있다. 다른 마우스 긴장 다른 민감성 LPS에 있다. 예를 들어 C3H/HeJ 및 C57BL/10ScCr 마우스 LPS에 강한 endotoxemia21,25유도. 또한, 동물의 위생 상태는 LPS에서 endotoxemia의 과정을 좌우할 지도 모른다. 특정 병원 체 자유롭게 (SPF) 동물 가장 일반적으로 사용 됩니다. 이 마우스는 병원 체의 정의 된 목록에서 무료 하지만이 동물의 완전 한 microbiota 구성26,27알 수 없습니다. 살 균 세균 무료 또는 axenic (그는 microbiota을 항구 하지 않는) 동물은 SPF 마우스26다릅니다. 아마, axenic 동물 한 미생물 또는 미생물 (gnotobiotic 동물)의 컨소시엄의 식민 SPF 동물8에 비해 LPS 주입 후 IL-19, 같은 유전자의 표정을 좌우할 지도 모른다. 또한, 점수 시트는 복 막 구멍24지저분한 솔루션 주입에 의해 유도 된 패 혈 증 모델에 대 한 점수 시트 사용 된 제안 되었습니다. 이 sheetcan 지역 동물 복지 위원회 논의 지역의 요구에 맞게 수 있습니다. 특히, 종료에 대 한 기준을 로컬 동물 복지 위원회와 논의 될 필요가 있다. 이 실험 점수 > 12 이루어집니다 또는 하나의 개별 매개 변수에 대 한 최대 점수에 도달 하면 중지 했다. 이 실험에서 어떤 동물도 8 동물에서 LPS (2 µ g/g 몸 무게)의 주입 후 12의 질병 점수를 초과 했습니다. 이 연구 결과 간, cytokines Il6, Il1b, TNFa 및 Il10 의 식을 보여주는 비장 및 LPS의 주입 후 콜론 선물 된다. 반면, Il6 식 정점 비장에 콜론 LPS 주입 후 2 h 및 간에서 LPS 주사 후 4 h Il1b TNFa , Il10 의 식 비장, 간에 콜론, LPS 주사 후 4 h를 만족. 8 h 식 Il6, 내 Il1b TNFa , Il10 비장, 간, 결 장 초기 수준으로 반환. 질병의 심각도 정점으로 6 h 10 h 사이 LPS 주입 후 Il6, Il1b, TNFa 및 Il10 의 표현을 나타내는 기준선 수준에 이미 돌아왔다 때 그 Il6, 표현의 증가 Il1b TNFa , Il10 발생 합니다 빠르게 LPS 주입 후 하지만 그 다른 유전자의 활동 LPS 주입 후 다른 패턴을 표시할 수 있습니다. 이러한 cytokines의 식 수 또한 ELISA, 정량 이외에 고려 될 수 있는 의해 동물의 혈액에서 단백질 수준에서 분석할 수 있습니다.
수정 및 기술 문제 해결 질병 점수 > 12에 도달 하면 경우에 필요 하다. 따라서, LPS의 복용량 감소 하 여 더 나은 사용된 마우스 선 및 실험의 조기 종료를 방지 하려면 현지 조건에 조정 있다. 주어진된 게놈 영역을 삭제 하거나 유전자 overexpressing 유전자의 조작 쥐의 LPS에 민감성에 영향을 미칠 수 있습니다. 예비 실험에서 불필요 한 피해와이 실험 동물에 죽음을 피하기 위해 적절 한 복용량에 LPS의 복용량을 적정 수 있습니다. 메모의 다른 세균 파생 제품 및 잘못 주사와 LPS의 오염을 피할 수 있다. 또한, LPS 주입 후 관심의 유전자의 표정의 활동 결정 될 필요가 있다.
한계는이 기술은 장 장벽 위반 후 호스트에 미생물 제품의 보급의 결과에 정보를 제공 하지만 장 장벽 위반 하 고 원인에 리드 하는 이벤트 정보를 제공 하지 것 이다 그는 IBD를 트리거합니다. 물론,이 모델은 DSS colitis 모델로 colitis 모델 하지만 호스트에 미생물 제품의 입구의 결과 공부 colitis 모델 외에도 유용할 수 있습니다. 또한, LPS의 i.p. 주입 복 막 구멍, 있는 작고 큰 창 자 위치는 중단 됩니다. 이 호스트에 복 막 구멍에서 파생 된 장내 세균 제품의 전 좌를 용이 하 게 수 있습니다.
이 모델의 중요성은 정의 PAMP 사용 하는 사실 이다. 전체 박테리아, 지저분한 솔루션24 의 i.p. 주입 또는 복 막 염 cecal 결 찰 및 펑크28, 미생물의 광대 한 배열에 의해 유도 된다 정화 조 복 막 염 모델의 i.p. 주입을 포함 하 여 다른 모델에 또는 그들의 제품 질병을 유도 한다. 또한, 마우스에 LPS의 주입 단순한 접근 이며 cecal 결 찰 및 펑크에 의해 유도 된 정화 조 복 막 염에서 수술을 필요로 하지 않습니다.
이 모델의 추가 응용 프로그램은 endotoxemia 또는 LPS 유발 된 패 혈 증 컨텍스트에서 피부 장벽의 위반 같은 호스트에 박테리아에서 파생 된 제품의 전 좌에 의해 특징 또는의 위반을 조사 하는 것을 목표로 하는 연구는 비뇨 생식 기의 요 로입니다. 결론적으로, 모든 실험실 환경에서 사용할 수 있는 간단한 모델입니다. 지역 조건에 따라 적응 지역 요구 필요를 있을 수 있습니다. 특히, 점수 시트 실험을 수행 하기 전에 지방 자치 단체와 함께 논의 하고있다. 이 방법은 세균 이나 박테리아 파생 제품 입력 호스트 배리어 위반이 발생 한 후 호스트에 대 한 결과 모방 하기 위해 사용 되었다. 이것은 특히 IBD 장 장벽 위반의 발생은 질병의 병 리에서 일반적인 이벤트의 기초 조사 연구에 관련 있을 수 있습니다.

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/57610/injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial">Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach</a>
One of the authors&#39; names was corrected from:
Katarina Raduolovic
to:
Katarina Radulovic

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/57610/injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial">Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach</a>.&#160;An author name was updated.

Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

인간의 소장 진화 하는 동안 호스트와 상호 유익한 관계를 개발 했다 누가 microbiota을 형성 하는 미생물의 큰 컨소시엄 식민지 이다. 이 관계에서 호스트가 합니다 보안 틈새를 microbiota는 microbiota 비타민, 영양소 소화 및 병원 체에서 보호는 microbiota 있는1호스트를 제공 하는 반면. 호스트와는 microbiota 사이이 유익한 관계를 방해 하는 경우 질병을 개발할 수 있습니다, 선 동적인 장 질병 (IBD). IBD은 두 가지 주요 형태, Crohn의 질병 (CD) 및 궤 양성 대 장 염 (UC)에서 발생 하는 유전과 환경 요인에 의해 발생 하는 장의 multifactorial 만성 염증 성 질병 이다. 두 IBD 형태 사이의 유사성에도 불구 하 고 그들은 위치와 염증 성 수정의 성격에서 특정 차이 특징 이다. CD 동안 UC 비 과거 이며, 콜론으로 소화 관의 어느 부분에 잠재적으로 확장할 수 있는 재발 과거 염증 성 질환 이다. 또한, 돌연변이 뉴클레오티드 바인딩 oligomerization 도메인에 포함 된 단백질 2 (NOD2), 패턴 인식 수용 체 (PRR) muramyl dipeptide (민주당), 가장 그람 양성 및-부정적인 박테리아의 세포 벽의 구성 요소를 인식 하는 CD2와 관련 된. 또한, 대장균 (대장균), Listeria 및 Streptococci 와 그들의 제품 모두 찾아냈다 세포 내 장벽을 위반3후 호스트를 입력 CD 환자에. 박테리아 또는 그들의 제품 CD의 개발 하는 동안 호스트를 입력, 면역 시스템 항균 항 체4순환의 생산에 지도 하는 응답을 개발 한다. 어쩌면, IBD의 병 인에서 microbiota의 역할에 대 한 가장 설득력 있는 증거는 마우스 모델에서 유래한 다. 동물 항생제로 처리 됩니다 또는 마우스 세균 무료 (GF) 조건에서 보관 하는 경우, 질병의 심각도 IL-10-/-생쥐에서 GF 시설5,6대 장 염을 개발 하지 않는 그와 같은 대부분의 대 장 염 모델에서 감소 된다. 또한, 대 장 염도 불균형 구성 특징 이다 고 dysbiosis7라고 하는 부유를 감소 microbiota의 구성을 방해. IBD의 결과 미생물 및 미생물에서 파생 된 제품의 입구는 호스트에 될 수 있는 증가 창 자 침투성을 될 수 있습니다.
동물, 응용 Dextran 황산 나트륨 (DSS)의 상피 장벽은8의 증가 한 침투성을 선도 하는 장 상피 위반을 유도 합니다. 포털 LPS 농도 DSS colitis9동물에서 상승 된. 흥미롭게도, 동물 부족 C 유형 lectin 수용 체 특정 세포내 접착 분자-3 nonintegrin를 잡는 체 관련 1 (로그인-R1)는 보호 DSS colitis 및 LPS 유발 endotoxemia10에서. 호스트에 추가 보급, 세균 이나 박테리아 파생 제품 혈관 장벽11, 크고 작은 창 자 위치는 복 막 구멍, mesenteric 임 파선 또는 간12를 통과 해야 합니다. 이 시스템의 복잡성을 줄이기 위해, 정의 된 박테리아에서 파생 된 화합물이 사용 되었다. LPS, 복 (i.p.) 또는 정 맥 (i.v.) 후 endotoxemia를 주입13 interleukins Il6 표현 및 Ilb cytokine Tnfa LPS에 대 한 응답에서을 공부 하 고 쥐에 주입 했다.
LPS는 병원 체 관련 된 분자 패턴 (PAMP) 지질 A의 구성 된 그람 음성 세균의 세포 벽 구성 요소로 표현 (LPS의 구조에서 주요 PAMP), 코어 올리고 당 및 O를 사이드 체인14. 수용 체 통행세 같이 4 (TLR4) 수지상 세포, 대 식 세포, 상피 세포에 의해 표현 LPS15, 적절 한 바인딩을 위한 공동 수용 체 필요한 인식 합니다. 급성 위상 단백질 LPS-바인딩 단백질 (LBP) 전송 LPS 차별화 14의 클러스터 (CD14), glycosylphosphatidylinositol 고정 막 단백질 복잡 한 형태로 LPS 바인딩합니다. CD14 더 LPS 림프 구 항 원 96 또는 라고도 MD 2 셔틀 TLR4의 세포 외 도메인 관련 됩니다. MD-2 LPS의 바인딩 TLR4/MD-2의 세포내 어댑터 분자는 하류 신호 통로14, 골수성 차별화 기본 포함 활성화를 모집 하는 구조적 변화를 유도 이합체 화를 용이 하 게 응답 유전자 88 (MyD88)-종속 통로는 사격 포함 하는 도메인 어댑터 유도 인터페론-β (TRIF)-종속 통로16. LPS TLR4에 의해의 인식 다음 NF κB 통로 활성화 하 고 TNFα, 일리노이-6와 일 1β17proinflammatory cytokines의 표정을 유도 한다.
특히, LPS는 동물, 동물, 주어진 LPS의 농도에 주입 하는 경우는 동물 및 다이어트의 유전 배경 간주 있다. 부패 시키는 충격, 저 혈압 및 다 수 기관 실패, 특징 이끌어 낸다 LPS의 높은 농도 그리고 마지막으로 죽음18. 마우스는 덜 민감한 LPS 인간에 비해 2-4 ng/kg 체중 (BW) 사이 LPS 농도 cytokine 폭풍19유도 수 있습니다. 마우스, 치 사 량 (LD50) 쥐 에서부터 사용 마우스 스트레인에 따라 10-25 mg/kg BW20 의 죽음을 유도 일반적으로 사용 되 마우스 긴장, C57Bl/6와 BALB/c에 대 한 치 사 량 50% (LD50)은 10 mg/kg BW. 반면, C3H/HeJ 및 C57BL/10ScCr 긴장 하 Tlr421돌연변이 유도 LPS endotoxemia에서 보호 됩니다. 따라서, Tlr4 불충분 한 쥐 hyporesponsive LPS22에 주사 하는. PARP1/마우스23 같은 다른 유전자 변형된 마우스 라인은 LPS 유발 독성 쇼크에 저항 한다.
마우스 모델 설명 여기 모방 신체의 표면의 장벽 위반 후 LPS 보급의 결과를 체계적으로 관리 하는 LPS의 sublethal 복용량을 사용 합니다. C56Bl/6 생쥐에서 사망 하지만 프로 염증 성 cytokines의 유도 방출을 선택한 LPS 농도 (2 mg/kg BW) 유도 하지 않았다.

<table><tbody><tr><td>DreamTaq Green PCR Master Mix (2x)</td><td>Thermo Fisher Scientific, Waltham, MA, USA</td><td>K1081</td><td></td></tr><tr><td>High Capacity cDNA Reverse Transcription Kit,</td><td>Applied Biosystems, Foster City, CA, USA</td><td>4368813</td><td></td></tr><tr><td>RNase-Free DNase Set,</td><td>Qiagen, Hilden, Germany</td><td>79254</td><td></td></tr><tr><td>LPS Escherichia coli O111:B4</td><td>Invivogen, San Diego, CA, USA.</td><td>tlrl-eblps</td><td></td></tr><tr><td>Omnican 50 Single-use insulin syringe</td><td>B. Braun Melsungen, Melsungen, Germany</td><td>9151125</td><td></td></tr><tr><td>Bioanalyzer 2100</td><td>Agilent Technologie, Santa Clara, USA</td><td>not applicable</td><td></td></tr><tr><td>Centrifuge 5430</td><td>Eppendorf, Hamburg, Germany</td><td>not applicable</td><td></td></tr><tr><td>Centrifuge Mikro 220R</td><td>Hettich, Kirchlengern, Germany</td><td>not applicable</td><td></td></tr><tr><td>Dissection tools</td><td>Aesculap, Tuttlingen, Germany</td><td>not applicable</td><td></td></tr><tr><td>Fast-Prep-24 5G Sample Preparation System</td><td>M.P. Biomedicals, Santa Ana, CA, USA</td><td>not applicable</td><td></td></tr><tr><td>NanoDrop ND-1000</td><td>NanoDrop Products, Wilmington, DE, USA</td><td>not applicable</td><td></td></tr><tr><td>TRI Reagent</td><td>Zymo Research, Irvine, CA, USA</td><td>R2050-1</td><td></td></tr></tbody></table>

injections of lipopolysaccharide into mice to mimic entrance of microbial-derived products after intestinal barrier breach

장 상피 방 벽에서 일반적으로 용납 되거나 무시 되는 microbiota 호스트를 구분 합니다. 이 방 벽의 위반 호스트, 호스트 순환 및 통제 염증으로 선 동적인 장 질병 (IBD), 환자에서 관찰 선도 하는 내부 장기로 세균 이나 박테리아 파생 제품의 입구에 발생 하는 증가 창 자 상피 침투성에 의해 특징.
호스트에 박테리아에서 파생 된 화합물의 입구를 모방 하는 endotoxemia 모델 어떤 lipopolysaccharide (LPS), 그램 음성 박테리아의 외부 세포 벽의 구성 요소에서에서 채택 되어, 쥐로 주입 했다. 이 연구에서 LPS의 sublethal 복용량 intraperitoneally 주사 하 고 쥐 8 h 질병의 점수를 사용 하 여 연속적으로 감시 되었다. 또한, 염증 성 cytokines Il6, Il1b, 및 Tnfa 의 수준을 다른 시간 지점에서 정량 하 여 비장, 간 및 콜론에 분석 되었다 식 LPS 주입 게시. 이 모델은 미생물 또는 신체 표면의 장벽 위반으로 인 한 세균성 파생 제품의 침공 후 면역 반응의 조사를 포함 하는 연구에 대 한 유용할 수 있었다.

장 장벽 위반 후 발생 하는 세균 이나 박테리아 파생 제품의 입구 후 호스트에 대 한 결과 모방, LPS는 C57Bl/6 마우스 sublethal 복용량 (2 µ g/g 몸 무게)에 주입 했다. 모든 단일 마우스 모니터링 되었고, 쥐의 모양, 동물, 눈의 상태와 호흡 속도 및 품질 (표 1)의 활동을 포함 하는 점수 시트에 나열 된 매개 변수를 endotoxemia의 발생에 대 한 득점 . 동물은 LPS의 주입 후 6 ~ 10 h를 만족 하 고 (그림 1) 24 시간 이내에 회수 하는 질병의 임상 표시를 보였다. 개별 마우스 LPS의 주입 후 희생된 2h, 4h, 및 8 h를 했다. 비장, 간, 그리고 콜론에서 조직 조각은 수집 했다. RNA이이 기관 으로부터 격리 되었고 역 cDNA를 복사할. cDNA는 정량에 사용 되는 뇌관으로 Il6 (그림 2A) Il1b (그림 2B), TNFa (그림 2C) 및 Il10 (그림 2D) 식 수준을 결정 하 정량에 대 한 템플릿으로 사용 되었다 표 6에 나와 있습니다. Il6 표현에에서 주입 후 비장 및 콜론, 4 h 주입 후 2 h를 만족. Il1b, TNFa, 및 Il10 의 식 비장, 간, 그리고 콜론에서 주사 후 4 h 만족. 주입 후 8 시간 이내 Il6, Il1b, TNFa, 및 Il10 의 식 초기 수준으로 반환.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57610/57610fig1.jpg"> 그림 1: LPS 주입 (2 µ g/g 몸 무게) 유도 C57Bl/6mice에서 endotoxemia의 임상 표시. LPS의 2 µ g/g 몸 무게의 주입, 후 개별 마우스 모양 및 동물의 활동을 포함 하는 표 1에 제시 질병 점수와 함께 감시 되었다 그들의 눈 및 호흡 속도 품질의 모든 2 h 12 h와 후미에 24 시간 개방 어 LPS 주입. 질병 점수 (y 축)은 각각 시간 (x 축)에 얼룩이. ± SD 각 시간 마다 4-5 마우스에 대 한 제시를 의미 한다. <a href="/files/ftp_upload/57610/57610fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57610/57610fig2.jpg"> 그림 2: LPS 주입 (2 µ g/g 몸 무게) C57Bl/6 마우스 프로 염증 성 cytokines의 표정을 유도 한다. LPS의 2 µ g/g 몸 무게와 Il6 (A), (B) Il1b 식 수준 마우스 주입 했다, Tnfa (C) 와 Il10 (D) 지정 된 시간에 정량 비장, 간, 그리고 콜론에 의해 분석 되었다 주입 후 포인트입니다. Cytokine 식 레벨 모두 Gapdh의 표현에 정상화 했다. ± SD 각 시간 마다 4-5 마우스 표시 됩니다 의미 합니다. <a href="/files/ftp_upload/57610/57610fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
표 1: 질병 점수 시트 LPS 주입 후 C57Bl/6 마우스 모니터. LPS 주입 후 모니터링 되는 매개 변수입니다. 동물 12 h 동안 주입 후 매 2 시간을 모니터링 했다 하 고 테이블에 나열 된 모든 개별 매개 변수에 대 한 점수 부여 했다. 각 동물에 대 한 최종 점수는 모든 개별 점수의 합계를 나타냅니다. 이것은 참조24에서 적응 이다. <a href="/files/ftp_upload/57610/table1_LPSscore.xlsx">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>금액</td>
			<td>시 약</td>
		</tr>
<tr>
<td>2 µ L/샘플</td>
			<td>RT 버퍼 x 10</td>
		</tr>
<tr>
<td>0.8 µ L/샘플</td>
			<td>25 x deoxynucleotide (dNTP) 믹스 (100 mM)</td>
		</tr>
<tr>
<td>1 µ L/샘플</td>
			<td>RT 무작위 뇌관</td>
		</tr>
<tr>
<td>4.2 µ L/샘플</td>
			<td>nuclease 무료 물</td>
		</tr>
</tbody></table>표 2: 시 약 반전 녹음 방송에 대 한 마스터 믹스를 준비 하는데.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
		</tr>
<tr>
<td>25 ° C</td>
			<td>10 분</td>
		</tr>
<tr>
<td>37 ° C</td>
			<td>120 분</td>
		</tr>
<tr>
<td>37 ° C</td>
			<td>5 분</td>
		</tr>
<tr>
<td>4 ° C</td>
			<td>보류</td>
		</tr>
</tbody></table>표 3: Thermocycler 설정 반전 녹음 방송에 대 한 사용.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>금액</td>
			<td>시 약</td>
		</tr>
<tr>
<td>5 µ L/잘</td>
			<td>믹스 마스터 x 2</td>
		</tr>
<tr>
<td>0.05 µ L/잘</td>
			<td>참조 염료</td>
		</tr>
<tr>
<td>500 nM 마지막/잘</td>
			<td>앞으로 뇌관</td>
		</tr>
<tr>
<td>500 nM 마지막/잘</td>
			<td>반전 뇌관</td>
		</tr>
<tr>
<td>10와 100 사이 ng/글쎄, 우리 사용 40 ng/잘</td>
			<td>서식 파일 cDNA 템플릿 희석 버퍼에 희석 (이 버퍼의 1/100 희석 nuclease 무료 물에서 되었고 템플릿 cDNA를 희석 하는 데 사용). 어디 서식 파일에 추가 됩니다 반응 색상 변경으로 블루에서 그린 웰 스의 시각화 수 희석이 버퍼에서 서식 파일</td>
		</tr>
<tr>
<td>10 µ L/잘의 최종 볼륨을 nuclease 무료 물</td>
			<td>nuclease 무료 물</td>
		</tr>
</tbody></table>표 4: PCR 반응의 설명입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td></td>
		</tr>
<tr>
<td>95 ° C</td>
			<td>2 분</td>
			<td></td>
		</tr>
<tr>
<td>95 ° C</td>
			<td>5 s</td>
			<td rowspan="2">40 주기</td>
		</tr>
<tr>
<td>60 ° C</td>
			<td>20 s</td>
		</tr>
<tr>
<td>95 ° C</td>
			<td>15 s</td>
			<td rowspan="3">녹는 곡선 analaysis</td>
		</tr>
<tr>
<td>60 ° C</td>
			<td>1 분</td>
		</tr>
<tr>
<td>95 ° C</td>
			<td>15 s</td>
		</tr>
</tbody></table>표 5: Thermocycler 설정 PCR에 사용입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관</td>
			<td>시퀀스</td>
			<td>용융 온도</td>
			<td>제품 길이</td>
		</tr>
<tr>
<td>Il6 F</td>
			<td>TCG 개 그 GCT TAA TTA CAC ATG TTC T</td>
			<td>60.3</td>
			<td>94 혈압</td>
		</tr>
<tr>
<td>Il6-R</td>
			<td>GCATCATCGTTGTTCATACAATCA</td>
			<td>58.2</td>
			<td></td>
		</tr>
<tr>
<td>Il1b F</td>
			<td>TGTGAAATGCCACCTTTTGA</td>
			<td>56.1</td>
			<td>94 혈압</td>
		</tr>
<tr>
<td>Il1b-R</td>
			<td>GTCAAAGGTTTGGAAGCAG</td>
			<td>57.2</td>
			<td></td>
		</tr>
<tr>
<td>Il10-F</td>
			<td>ATCGATTTCTCCCCTGTGAA</td>
			<td>56.2</td>
			<td>108 bp</td>
		</tr>
<tr>
<td>Il10-R</td>
			<td>TGTCAAATTCATTCATGGCCT</td>
			<td>56.1</td>
			<td></td>
		</tr>
<tr>
<td>Tnfa F</td>
			<td>CCACCACGCTCTTCTGTCTAC</td>
			<td>60.4</td>
			<td>103 혈압</td>
		</tr>
<tr>
<td>Tnfa-R</td>
			<td>AGGGTCTGGGCCATAGAACT</td>
			<td>60</td>
			<td></td>
		</tr>
<tr>
<td>Gapdh F</td>
			<td>CATCAAGAAGGTGGTGAAGC</td>
			<td>56.7</td>
			<td>199 혈압</td>
		</tr>
<tr>
<td>Gapdh-R</td>
			<td>CCTGTTGCTGTAGCCGTATT</td>
			<td>58</td>
			<td></td>
		</tr>
</tbody></table>표 6: 정량 Pcr 반응에 사용 되는 뇌관. 정량에 대 한 마우스 cytokines 및 내부 관리 유전자를 검출 하는 데 사용 하는 뇌관의 순서 Gapdh.

Watch this Scientific Journal Video about Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach at JoVE.com

Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

여기 장 장벽 위반 후 박테리아에서 파생 된 화합물의 입구를 모방 하는 프로토콜 제공 됩니다. Lipopolysaccharide sublethal 저용량 24 h 후 주입에 대 한 모니터링 했다 생쥐에 체계적으로 주입 했다. 프로 염증 성 cytokines의 표정은 비장, 간, 그리고 콜론에서 여러 시간 지점에서 결정 되었다.

장 방 벽 위반 후 미생물 파생 제품의 입구를 모방 하는 쥐로 Lipopolysaccharide의 주사

The intestinal epithelial barrier separates the host from the microbiota that is normally tolerated or ignored. The breach of this barrier results in the ...

injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Immunology and Infection

Human Biology

Immune System

SCIENTISTS IN ACTION

19.3K 조회수.  University of Basel. 여기 장 장벽 위반 후 박테리아에서 파생 된 화합물의 입구를 모방 하는 프로토콜 제공 됩니다. Lipopolysaccharide sublethal 저용량 24 h 후 주입에 대 한 모니터링 했다 생쥐에 체계적으로 주입 했다. 프로 염증 성 cytokines의 표정은 비장, 간, 그리고 콜론에서 여러 시간 지점에서 결정 되었다.

비디오: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

Intraductal Injection of LPS as a Mouse Model of Mastitis: Signaling Visualized via an NF-&kappa;B Reporter Transgenic

Animal models of human disease are necessary in order to rigorously study stages of disease progression and associated mechanisms, and ultimately, as pre-clinical models to test interventions. In these methods, we describe a technique in which lipopolysaccharide (LPS) is injected into the lactating mouse mammary gland via the nipple, effectively modeling mastitis, or inflammation, of the gland. This simulated infection results in increased nuclear factor kappa B (NF-&kappa;B) signaling, as visualized through bioluminescent imaging of an NF-&kappa;B luciferase reporter mouse1.
Our ultimate goal in developing these methods was to study the inflammation associated with mastitis in the lactating gland, which often includes redness, swelling, and immune cell infiltration2,3. Therefore, we were keenly aware that incision or any type of wounding of the skin, the nipple, or the gland in order to introduce the LPS could not be utilized in our methods since the approach would likely confound the read-out of inflammation. We also desired a straight-forward method that did not require specially made hand-drawn pipettes or the use of micromanipulators to hold these specialized tools in place. Thus, we determined to use a commercially available insulin syringe and to inject the agent into the mammary duct of an intact nipple. This method was successful and allowed us to study the inflammation associated with LPS injection without any additional effects overlaid by the process of injection. In addition, this method also utilized an NF-&kappa;B luciferase reporter transgenic mouse and bioluminescent imaging technology to visually and quantitatively show increased NF-&kappa;B signaling within the LPS-injected gland4.
These methods are of interest to researchers of many disciplines who wish to model disease within the lactating mammary gland, as ultimately, the technique described here could be utilized for injection of a number of substances, and is not limited to only LPS.

Described here is a technique in which lipopolysaccharide is injected into the lactating mouse mammary gland via the nipple to simulate mastitis, a condition commonly caused by bacterial infection. Lipopolysaccharide injection results in increased nuclear factor kappa B (NF-&kappa;B) signaling, visualized through bioluminescent imaging of an NF-&kappa;B luciferase reporter mouse.

유선염의 마우스 모델로 LPS의 Intraductal 주입 : 신호는 NF-κB 리포터 트렌스 제닉을 통해 시각화

Animal models of human disease are necessary in order to rigorously study stages of disease progression and associated mechanisms, and ultimately, as ...

연구

의학

Intralymphatic Immunotherapy and Vaccination in Mice

Vaccines are typically injected subcutaneously or intramuscularly for stimulation of immune responses. The success of this requires efficient drainage of vaccine to lymph nodes where antigen presenting cells can interact with lymphocytes for generation of the wanted immune responses. The strength and the type of immune responses induced also depend on the density or frequency of interactions as well as the microenvironment, especially the content of cytokines. As only a minute fraction of peripherally injected vaccines reaches the lymph nodes, vaccinations of mice and humans were performed by direct injection of vaccine into inguinal lymph nodes, i.e.&#160;intralymphatic injection. In man, the procedure is guided by ultrasound. In mice, a small (5-10 mm) incision is made in the inguinal region of anesthetized animals, the lymph node is localized and immobilized with forceps, and a volume of 10-20 &#956;l of the vaccine is injected under visual control. The incision is closed with a single stitch using surgical sutures. Mice were vaccinated with plasmid DNA, RNA, peptide, protein, particles, and bacteria as well as adjuvants, and strong improvement of immune responses against all type of vaccines was observed. The intralymphatic method of vaccination is especially appropriate in situations where conventional vaccination produces insufficient immunity or where the amount of available vaccine is limited.

Prophylactic and therapeutic vaccination often fails to stimulate strong immune responses due to week drainage of the vaccine to lymph nodes and consequently poor involvement of immune cells. By direct injection of vaccine to lymph nodes, so-called intralymphatic injection, vaccine efficacy can be strongly improved and vaccine doses can be reduced.

마우스의 Intralymphatic 면역 및 예방 접종

Vaccines are typically injected subcutaneously or intramuscularly for stimulation of immune responses. The success of this requires efficient drainage of ...

면역학 및 감염병학

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

Two-photon Intravital Imaging of Leukocytes During the Immune Response in Lipopolysaccharide-treated Mouse Liver

Sepsis is a type of severe infection that can cause organ failure and tissue damage. Although the mortality and morbidity rates associated with sepsis are extremely high, no direct treatment or organ-related mechanism has been examined in detail in real time. The liver is the key organ that manages toxins and infections in the human body. Herein, we aimed to perform intravital imaging of mouse liver after induction of endotoxemia in order to track the motility of immune cells, such as neutrophils and liver capsular macrophages (LCMs). Accordingly, we designed a novel surgical method for exposure of the liver with minimally invasive surgery. Mice were intraperitoneally injected with lipopolysaccharide (LPS), a common endotoxin. Using our novel surgical approach for exposure and intravital imaging of the mouse liver, we found that neutrophil recruitment in LPS-treated LysM-green fluorescent protein (GFP) mouse liver was increased compared with that in phosphate-buffered saline-treated liver. After LPS treatment, the number of neutrophils increased significantly with time. Additionally, using CX3Cr1-GFP mice, we successfully visualized liver resident macrophages called LCMs. Therefore, to investigate the efficacy of new reagents to control immune mobility in vivo, determining the motility and morphology of neutrophils and LCMs in the liver may allow us to identify therapeutic effect in organ failure and tissue damage caused by leukocytes activation in sepsis.

We established a novel surgical protocol for two-photon imaging of live mice liver with minimal invasion. With this technique, we identified the detailed structure of the liver during lipopolysaccharide-induced endotoxemia. We anticipate that this method may be utilized to determine the effectiveness of various reagents treatment to hepatic leukocyte migration.

Lipopolysaccharide 취급 마우스 간에 면역 반응 동안 백혈구의 2 광자 Intravital 이미징

Sepsis is a type of severe infection that can cause organ failure and tissue damage. Although the mortality and morbidity rates associated with sepsis are ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. Various approaches have been described, such as the inhalation of aerosolized LPS as well as nasal or intratracheal instillation. The presented protocol describes a detailed step-by-step procedure to induce ALI in mice by direct intratracheal LPS instillation and perform FACS analysis of blood samples, bronchoalveolar lavage (BAL) fluid, and lung tissue. After intraperitoneal sedation, the trachea is exposed and LPS is administered via a 22 G venous catheter. A robust and reproducible inflammatory reaction with leukocyte invasion, upregulation of proinflammatory cytokines, and disruption of the alveolo-capillary barrier is induced within hours to days, depending on the LPS dosage used. Collection of blood samples, BAL fluid, and lung harvesting, as well as the processing for FACS analysis, are described in detail in the protocol. Although the use of the sterile LPS is not suitable to study pharmacologic interventions in infectious diseases, the described approach offers minimal invasiveness, simple handling, and good reproducibility to answer mechanistic immunological questions. Furthermore, dose titration as well as the use of alternative LPS preparations or mouse strains allow modulation of the clinical effects, which can exhibit different degrees of ALI severity or early vs. late onset of disease symptoms.

Presented here is a step-by-step procedure to induce acute lung injury in mice by direct intratracheal lipopolysaccharide instillation and to perform FACS analysis of blood samples, bronchoalveolar lavage fluid, and lung tissue. Minimal invasiveness, simple handling, good reproducibility, and titration of disease severity are advantages of this approach.

직접 경포당증 주입에 의해 마우스에 있는 심각한 폐 상해를 유도하는

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

Isolation of Splenic Microvesicles in a Murine Model of Intraperitoneal Bacterial Infection

Microvesicles (MVs) are submicron fragments released from the plasma membrane of activated cells that act as proinflammatory and procoagulant cellular effectors. In rats, spleen MVs (SMVs) are surrogate markers of pathophysiological conditions. Previous in vitro studies demonstrated that Porphyromonas gingivalis (P. gingivalis), a major periodontal pathogen, enables&#160;the endothelial shedding and apoptosis while lipopolysaccharide (LPS) favors the shedding of splenocyte-derived microvesicles (SMVs). In vivo studies showed the feasibility of pharmacological control of SMV shedding. The present protocol establishes a standardized procedure for isolating splenic SMVs from the P. gingivalis acute murine infection model.&#160;P. gingivalis infection was induced in young C57BL/6 mice by intraperitoneal injection (three injections of 5 x 107 bacteria/week). After two weeks, the spleens were collected, weighed, and the splenocytes were counted. SMVs were isolated and quantified by protein, RNA, and prothrombinase assays. Cell viability was assessed by either propidium iodide or trypan blue exclusion dyes. Following splenocyte extraction, neutrophil counts were obtained by flow cytometry after 24 h of splenocyte culture. In P. gingivalis-injected mice, a 2.5-fold increase in spleen weight and a 2.3-fold rise in the splenocyte count were observed, while the neutrophils count was enhanced by 40-folds. The cell viability of splenocytes from P. gingivalis-injected mice ranged from 75%-96% and was decreased by 50% after 24 h of culture without any significant difference compared to unexposed controls. However, splenocytes from injected mice shed higher amounts of MVs by prothrombinase assay or protein measurements. The data demonstrate that the procoagulant SMVs are reliable tools to assess an early spleen response to intraperitoneal&#160;P. gingivalis infection.

Microvesicles shed from the plasma membrane act as cellular effectors. Spleen microvesicles (SMVs) are surrogate markers of pathophysiological conditions. In rats and mice, SMV content and properties characterize aging or inflammation and are altered by cytoprotective treatments, making them a valuable yet abundant monitoring tool for preclinical research.

Microvesicles (MVs) are submicron fragments released from the plasma membrane of activated cells that act as proinflammatory and procoagulant cellular ...

생물학

Noninvasive Intratracheal Lipopolysaccharide Instillation in Mice

The acute lung injury (ALI) mouse model induced by lipopolysaccharide (LPS) or endotoxin is still among the most commonly used models in animal studies of acute lung injury or acute inflammation. The current most commonly used methods in acute lung injury mouse models are an intraperitoneal injection of LPS and tracheostomy for the tracheal infusion of LPS. However, the former method lacks lung targeting and damages other organs, and the latter method induces operative trauma, infection risk, and a low survival rate. Here, we recommend a noninvasive oropharyngeal endotracheal intubation method for LPS instillation in mice. In this method, LPS is noninvasively introduced into the trachea through the oropharyngeal cavity to be instilled into the lung with the help of an apparatus for endotracheal intubation. This method not only assures lung targeting but also avoids damage and the risk of death in the animals. We expect that this approach will become widely used in the field of acute lung injury.

Here, we propose a protocol for intratracheal lipopolysaccharide (LPS) delivery via noninvasive oropharyngeal endotracheal intubation. This method minimizes the trauma of the surgical procedure for the animal and accurately delivers LPS to the trachea and then to the lungs.

The acute lung injury (ALI) mouse model induced by lipopolysaccharide (LPS) or endotoxin is still among the most commonly used models in animal studies of ...

Subcutaneous Injection of Bacterial Antigen to Induce Systemic Inflammation in a Murine Model

Source: John, S. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/62925">Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.</a>&#160;J. Vis. Exp. (2021)
This video demonstrates the induction of systemic inflammation in an anesthetized mouse. The injection of mycobacterial antigen-adjuvant depots triggers cytokine release and localized inflammation. Lymphatic vessels open, enabling immune cell entry into lymph nodes and activation of T cells, which release pro-inflammatory cytokines, leading to widespread inflammation.

쥐 모델에서 전신 염증을 유발하기 위한 박테리아 항원의 피하 주사

Source: John, S. et al., Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.&#160;J. Vis. Exp. (2021)
This video demonstrates the ...

JoVE Encyclopedia of Experiments

Immunology

Immunopathology

Host-Pathogen Interaction Models

Induction of Cerebral Microhemorrhages in a Rat Model Using Lipopolysaccharide

Source: Li, D., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/58423">Sub-acute Cerebral Microhemorrhages Induced by Lipopolysaccharide Injection in Rats.</a> J. Vis. Exp. (2018).
This video demonstrates the process of inducing blood-brain barrier (BBB) disruption and cerebral microhemorrhages in a rat model using lipopolysaccharide (LPS). It highlights the sequence of immune responses that lead to increased BBB permeability and subsequent brain tissue damage.

지방다당류를 이용한 쥐 모델에서 대뇌 미세출혈 유도

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

Neuroscience

Neuropathology

Cerebrovascular Diseases

An Air Pouch Mouse Model for Lipopolysaccharide-Induced Inflammatory Exudate Collection

Source: Lu, Q., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/60543">Detecting Migration and Infiltration of Neutrophils in Mice.</a> J. Vis. Exp.&#160; (2020).
This video describes the procedure for generating an air pouch in the subcutaneous tissue of mice and collecting inflammatory exudates in response to lipopolysaccharide administration in vivo. This video also covers the analysis of the neutrophil infiltration in the air pouch.

Lipopolysaccharide-Induced Inflammatory Exudate Collection을 위한 에어 파우치 마우스 모델

Source: Lu, Q., et al. Detecting Migration and Infiltration of Neutrophils in Mice. J. Vis. Exp.&#160; (2020).
This video describes the procedure for ...