이 작품 경력 수상 (DBI-1253293 번호 부여);를 통해 국립 과학 재단에 의해 지원 되었다 국립 보건원 (NIH) (보조금 번호 HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); 그리고 방위 고급 연구 프로젝트 기관 생활 파운드리 프로그램 (계약 번호 HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol><li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tumour+evolution+inferred+by+single-cell+sequencing%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li>
<li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li>
<li>Schmidt, H., Hensel, M. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/14726454">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li>
<li>Martínez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interactions+among+strategies+associated+with+bacterial+infection%3A+pathogenicity+epidemicity%2C+and+antibiotic+resistance%5BTitle%5D)+AND+%22Clinical+Microbiology+Reviews%22%5BJournal%5D)">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li>
<li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li>
<li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li>
<li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optical+tweezers+for+single+cells%5BTitle%5D)+AND+%22Journal+of+the+Royal+Society+Interface%22%5BJournal%5D)">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li>
<li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li>
<li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li>
<li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li>
<li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li>
<li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+single-cell+labeling+%28Hi-SCL%29+for+RNA-Seq+using+drop-based+microfluidics%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li>
<li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing%5BTitle%5D)+AND+%22Nature+Reviews+Genetics%22%5BJournal%5D)">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li>
<li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li>
<li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784(2016).</li>
<li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li>
<li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li>
<li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions%5BTitle%5D)+AND+%22Angewandte+Chemie+Internation+Edition%22%5BJournal%5D)">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li>
<li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li>
<li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects%5BTitle%5D)+AND+%22Genome+Research%22%5BJournal%5D)">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li>
<li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Beating+Poisson+encapsulation+statistics+using+close-packed+ordering%5BTitle%5D)+AND+%22Lab+on+a+Chip%22%5BJournal%5D)">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628(2009).</li>
<li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics%5BTitle%5D)+AND+%22Optic+Letters%22%5BJournal%5D)">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472(2012).</li>
<li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun%5BTitle%5D)+AND+%22Biomicrofluidics%22%5BJournal%5D)">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li>
<li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li>
<li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550(2013).</li>
<li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li>
<li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Classification+of+metagenomic+sequences%3A+methods+and+challenges%5BTitle%5D)+AND+%22Briefings+in+Bioinformatics%22%5BJournal%5D)">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li>
<li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microfluidic+droplet+enrichment+for+targeted+sequencing%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86(2015).</li>
<li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Finding+a+helix+in+a+haystack%3A+nucleic+acid+cytometry+with+droplet+microfluidics%5BTitle%5D)+AND+%22Lab+on+a+Chip%22%5BJournal%5D)">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li>
</ol>

이에 관련 된 특허 수 있습니다 주주 이다 임무 바이오는 아담 R. Abate의 허가.

SiC-seq 미세 워크플로 세균성 세포의 수천에서 단일 셀 게놈 시퀀싱 데이터를 생성합니다. Microgel-캡슐화 된 세포의 유전자에 접합 하는 디지털 바코드는 철에 deconvolution NGS 데이터의 바코드 읽기 같은 셀에서 발생의 그룹으로 허용 합니다. 알려진된 구성의 미생물 지역 사회와 함께 제어 실험은 바코드 그룹의 순도 평가 하는 데 필요 합니다. 저 순도 그룹의 큰 분수 셀 캡슐화 속도가 너무 높습니다 하거나 중요 한 물방울 교차 오염을 미세 처리 단계 동안 발생 하는 나타냅니다. 통계에 따르면 푸아송, 바코드와 셀 모든 비어 있지 않은 물방울의 5% 미만에 다중 캡슐화 이벤트의 속도 제한에 모든 10 드랍 스에 대 한 1 입자의 대상 비에 캡슐화 한다. Dropmaking 과정에서 캡슐화 비율의 확인은 매우 중요 하므로 이것 보다 더 높은 요금을 캡슐화 기 하 급수적으로, 남자의 속도 증가 시킵니다. 사용자가 읽기 같은 바코드 순서를 공유 하는 다른 세포에서 분리 된 bioinformatically 수 없습니다 하기 때문에 단일 microgel에 여러 셀의 캡슐화의 특히 신중 해야 합니다. 경우에는 1 셀 수신 2 다른 바코드, 바코드 그룹 순수성 비록 풍부한 통계는 비뚤어진 바코드 시퀀스에 의해 계산 하는 때 영향을 받지 않습니다.
드롭릿 교차 오염 또한 차선 합병 조건으로 인해 발생할 수 있습니다. 성공적인 작업 중 미세 합병 장치 (그림 5) 1 microgel와 1 바코드 물방울과 PCR 시 약의 볼륨 controllably 쌍 수 있습니다. 비-이상적인 흐름 속도 잘못 된 비율에서 쌍 방울 귀 착될 것 이다: 1 바코드 예 2 microgels와 결합 수 있습니다. 프로토콜에 나열 된 모든 흐름 율 추정 될 것입니다 그리고 장치 형상과 방울 크기에 약간의 변화에 따라 조정 해야 할 수 있습니다. 고속 녹화 기능으로 카메라에 액세스할 수 있는 사용자 (> 10000 프레임/s) 시작 및 미세 작업의 과정을 통해 올바른 드롭릿 합병을 확인 해야 합니다. 고속 카메라에 액세스 하지 않고 사용자가 병합 된 출력의 작은 볼륨을 수집 하 고 수동으로 측정 현미경으로 작은 물방울 크기 수 있습니다. 작은 물방울 크기 균일 해야: 병합 되지 않은 바코드 또는 microgel 상품의 초과 나타냅니다 reinjection 요금 따라 감소 되어야 한다.
몇 가지 일반적인 예방 조치 취해야 한다 microgels와 microdroplets를 처리 하는 때 그들의 무결성을 유지 하. Microgels, 비록 기계적으로 강력 하 고, 해야 될 충분히 냉각 침입 및 완전 한 겔 화 되도록 조치를 세척 하기 전에. 비 구형 microgels는 표시는 agarose을 강화 하기 위해 충분 한 시간을 주어진. Microgels 세척 할 경우 제품의 손실을 방지 하기 위해 필요한 속도에서 정지 아래로 회전 합니다. Agarose 히드로 밀접 하 게 일치는 물의 굴절률 있으며 사용자가 신중 하 게 포부 전에 젤-액체 경계를 식별 해야 하므로 튜브22볼 하기 어려울 수 있습니다. 물에 기름 방울 정적 세력23 실험실 장갑과 튜브에의 하 여 접착을 따르게 됩니다. 이러한 이유로, 맨 손으로 물방울 reinjection 주사기를 로드 하 고 모든 reinjection 라인 펌프 못쓰게 하기 전에 정전기 방지 총을 치료 하는 것이 좋습니다. 큰 병합된 방울 주사기에 유화 액을 천천히 회전 하 고 수동으로 그들의 더 큰 부 력 힘 때문에 위쪽에 축적 큰 방울을 발음 하 여 제거할 수 있습니다.
SiC-seq는의 단일 셀 게놈 시퀀싱을 보여 주기 위해 첫 번째 기술 > 50000 세균성 세포. 이 플랫폼 기존 접근에 비해 처리량에 상당한 이점을 제공 하 고 이기종 미생물 커뮤니티의 깊은 샘플링을 수 있습니다. 날짜 하려면, 단일 셀 게놈 시퀀싱에 대 한 미세 기술 microchambers9 와 microwells24 셀 절연 및 증폭, 하지만 처리량만 수십 수백 개의 셀의 범위에서 고용 했다. Wellplates5,6 으로 단일 셀의 흐름 정렬 없음 특수 미세 계측을 필요 하지만 마찬가지로 낮은 처리량을 소유한 다. 토양 및 물 샘플 환경에서 일반적으로 있다의 알파 다양성을 감안할 때 > 종에 1, 000 레벨25,26, SiC seq 생물의 훨씬 더 큰 수를 샘플링 하는 기능 덕택으로 매우 유리 하다. SiC-seq 워크플로 실험실 문화, 자연 환경 또는 생활 호스트에서 셀 입력을 적응할 수 있습니다. 셀 샘플 필요만 수성 현 탁 액 및 큰 입자의 무료 (> 10 µ m) 미세 캡슐화에 대 한 적합 하다. 예를 들어 메서드는 세척의 시리즈를 사용 하 여 및 캡슐화17이전 셀을 전처리 하는 단계를 필터링 해 수의 샘플에 이전 적용 되었다.
SiC-seq 프로토콜 각 단일 셀에서 시퀀싱 데이터의 상대적으로 부족 한 금액을 생성 하 고 모든 응용 프로그램에 적합 하지 않을 수 있습니다. 전화 드 노 보 게놈 어셈블리 또는 단일 뉴클레오티드 변종 (SNV) 같은 생물 정보학 알고리즘 일부 높은 범위 깊이 효과적으로 작동 하려면 필요 합니다. 대신, 바코드 그룹은 클러스터 된 철에 의해 분류학 범주화 방법27 알고리즘 읽기의 큰 세트에 적용 될 수 있도록 수 있습니다. SiC-seq 워크플로의 상대적으로 낮은 전반적인 barcoding 효율성 또한 입력된 샘플의 가용성 낮은 경우에서 과제를 선물 수 있습니다. SiC-seq 포아송 분포 바코드 캡슐화 단계에 의존, 따라서 세포의 약 10% 분자 바코드를 받을 마지막 라이브러리 준비 단계 중에 증폭 됩니다. 이것은 다른 microdroplet 기반 바코드 제도10, 소중한 셀 샘플을 사용 하는 사용자가 시퀀싱에 대 한 적절 한 라이브러리 수익률을 달성 하는 어려움이 있을 수 있습니다. 고 마지막에 PCR 사이클의 수를 늘려야 할 수 있습니다. 증폭 단계입니다. 미세 전문 기술 사용자를 위한 또 다른 잠재적인 솔루션 디지털 PCR 단계, 따라서 전체 바코드 효율 가져온 후 긍정적인 바코드 방울을 정렬 하는 > 8528.
SiC-seq 기술에 대 한 잠재적인 미래 방향을 새로운 임상 연구는 단일 셀에 대 한 방법을 포장 하는 포유류 세포와 함께 사용 하기 위해 워크플로 적응 이다. 예를 들어, 단일 암 중 복사 번호 유사의 분석 5 월 세포 암 병 리2에서 성분의 역할에 대 한 우리의 이해를 더. 또는 관심29 의 DNA 시퀀스를 풍부 하 게 조사 하는 기존의 방법 SiC-seq를 통합 모집단의 대상으로 단일 셀 시퀀싱 또는 셀의 희귀 한 변종 사용할 것. 환경 샘플, 알려진된 신진 대사 통로 내에서 유전자는 대상 고 소설 게놈 제도 식별 하는 유전자를 이웃과 함께 콘텐츠 분석 될 수 있습니다. 인간의 호스트 환경 내에서 낮은 titer 병원 성 박테리아 샘플 격리 될 수 있습니다 및 더 많은 검사를 단일 세포 수준에서 밀접 하 게 시퀀싱 독성의 genotypic 그들의 기원.

게놈은 세포 id 및 기능, 전체 유기 체를 포함 하는 청사진의 잠재력을 코딩 있습니다. 게놈 수준에서 세포 생물학의 이해는 다른 유형의 세포 인구에서 관찰 된 phenotypic 다양성을 설명할 수 있다. 이 이종 생물 학적 시스템에서 이며 인류 건강 및 질병에 대 한 광범위 한 의미를 갖는다. 예를 들어 종양 세포 중 유전자 복사 번호 유사 진화 및 암1,2의 확산에 연결 됩니다. 세균 감염, pathogenicity 제도 게놈의 작은 분수에 수평으로 옮겨질 수 있다 하 고 항생제 내성 박테리아3,4의 확산으로 이어질. 단일 셀 수준에서 유전자를 공부 하 고 있는 주요 과제의 DNA, 세포의 수천을 분석할 필요가 genotypes의 전체 다양성을 낮은 수량입니다. 이러한 이유로 실험 처리량에서 제한 단일 셀 연구, 가장 풍부한 셀 쪽으로 결과 바이어 싱의 효과 방해 했습니다. 단일 셀 격리 기법5,6, 광학 핀셋7, 대량 젤8, 및9 마이크로 임베디드 정렬 흐름 등은 시퀀싱;에 대 한 셀의 수백 처리할 수 그러나, 이것은 대부분 샘플의 극히를 일부에 나타냅니다. 실질적으로 더 높은 처리량을 가진 단일 셀 게놈 시퀀싱 하는 방법을 더 깊이 그리고 더 완전 한 세포 인구, 따라서 elucidating genotypic 다양성이 지역이 사회 내에서 역할의 프로 파일링 수 있습니다.
드롭릿 마이크로 셀과 picoliter 스케일 원자로의 수백만에서 생물학 시 약의 높은 처리량 조작 수 있습니다. 날짜 하려면, microdroplet 기술 이질적인 조직10,,1112, 셀 중 차동 식 패턴을 공부 하는 데 사용 되었습니다 깊이 긴 분자13,14 시퀀스 ,15및 단일 셀16행위 chromatin immunoprecipitation 시퀀싱 (칩 seq) 분석. 실제로, microdroplets 높은 처리량, compartmentalized 작업, 그들을 단일 셀 유전체학에 의무가 응용 프로그램 만들기 수 있다. 그러나이 기술 개발 과제가 그것의 자신의 독특한 기술, 있습니다. 셀 lysed 해야 합니다 정화, 고 균일 하 게 샘플 세포 인구를 최소한의 바이어스 증폭. 또한, polyadenylated 포유류 세포에 있는 mRNA 사본는 달리 아무 유사한 분자 모티브 대상 핵 산의 캡처를 촉진 하기 위하여 게놈에서. 이러한 이유로, 단일 셀 게놈 시퀀싱 microdroplet 플랫폼에서 구현 하기 어려운 되었습니다.
이 작품에서는, 우리는 단일 실험17셀의 수천 수만의 게놈을 시퀀싱 할 수 이전에 보고 된 단일 셀 미세 접근의 상세한 프로토콜을 제공 합니다. 이 기술로, SiC-seq 라는 세균 세포 미크론 규모 hydrogels에 개별적으로 lysed, tagmented, 그리고 독특한 oligonucleotide 바코드를 통해 세포의 게놈 DNA에 접합 되는 포함 하는 microdroplet와 합병 한 단일 중복 확장 중 합 효소 연쇄 반응 (PCR). hydrogels는 높은 분자 무게 genomic DNA sterically 쌌 다, 세제 및 액세스 하 여 DNA barcoding18전에 정화 용균성 효소와 같은 작은 분자를 허용 하는 절연된 컨테이너 역할을 합니다. 이 프로토콜 처리 > 결과 바코드 라이브러리 시퀀싱에 대 한 준비에 시간의 문제에 50000 단일 셀. 시퀀싱, 따라 읽기는 셀룰러 인덱스와 각 데이터 집합의 읽기, 수백만의 구성의 결과로 그들의 단일 셀 바코드 순서 대로 역다중화.

<table><tbody><tr><td>3&quot; silicon wafers, P type, virgin test grade</td><td>University Wafers</td><td>447</td><td></td></tr><tr><td>SU-8 3025 photoresist</td><td>Microchem</td><td>17030192</td><td></td></tr><tr><td>Spin coater</td><td>Specialty Coating Systems</td><td>G3P-8</td><td></td></tr><tr><td>Photomasks</td><td>CadArt Servcies</td><td>(custom)</td><td>See Supplemental Files for mask designs</td></tr><tr><td>PGMEA developer</td><td>Sigma-Aldrich</td><td>484431</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>109827</td><td></td></tr><tr><td>Sylgard 184 silicone elastomer kit</td><td>Krayden</td><td>4019862</td><td></td></tr><tr><td>Degassing chamber</td><td>Bel-Art</td><td>42025</td><td></td></tr><tr><td>0.75 mm biopsy punch</td><td>World Precision Instruments</td><td>504529</td><td></td></tr><tr><td>Glass microscope slides (75 mm x 50 mm)</td><td>Corning</td><td>294775X50</td><td></td></tr><tr><td>Aquapel (hydrophobic glass treatment)</td><td>Pittsburgh Glass Works</td><td>47100</td><td></td></tr><tr><td>PE-2 polyethylene tubing</td><td>Scientific Commodities</td><td>B31695-PE/2</td><td></td></tr><tr><td>1 mL syringes</td><td>BD</td><td>309628</td><td></td></tr><tr><td>27 gauge needles</td><td>BD</td><td>305109</td><td></td></tr><tr><td>Syringe pump</td><td>New Era Pump Systems</td><td>NE-501</td><td></td></tr><tr><td>Novec HFE-7500 fluorinated oil (HFE)</td><td>3M</td><td>98-0212-2928-5</td><td></td></tr><tr><td>FC-40 fluorinated oil</td><td>Sigma-Aldrich</td><td>F9755</td><td></td></tr><tr><td>PEG-PFPE surfactant</td><td>Ran Biotechnologies</td><td>008-FluoroSurfactant</td><td></td></tr><tr><td>Space heater</td><td>Lasko&amp;nbsp;</td><td>CD09250&amp;nbsp;</td><td></td></tr><tr><td>Agarose, low gelling temperature</td><td>Sigma-Aldrich</td><td>a9414</td><td></td></tr><tr><td>TE (10X)</td><td>Rockland</td><td>mb-007</td><td></td></tr><tr><td>PBS 1X, pH 7.4</td><td>E&amp;amp;K Scientific Products</td><td>EK-65083</td><td></td></tr><tr><td>OptiPrep (density gradient medium)</td><td>Sigma-Aldrich</td><td>d1556</td><td></td></tr><tr><td>1H,1H,2H-Perfluoro-1-Octanol (PFO)</td><td>Sigma-Aldrich</td><td>370533</td><td></td></tr><tr><td>Span 80 (sorbitane monooleate)</td><td>Sigma-Aldrich</td><td>s6760</td><td></td></tr><tr><td>Hexane</td><td>Sigma-Aldrich</td><td>139386</td><td></td></tr><tr><td>Tween 20 (polysorbate 20)</td><td>Sigma-Aldrich</td><td>p2287</td><td></td></tr><tr><td>Lysozyme Type IV</td><td>MP Biomedicals</td><td>195303</td><td></td></tr><tr><td>Mutanolysin</td><td>Sigma-Aldrich</td><td>M9901</td><td></td></tr><tr><td>Zymolyase (yeast lytic enzyme)</td><td>Zymo Research</td><td>e1004</td><td></td></tr><tr><td>Lysostaphin</td><td>Sigma-Aldrich</td><td>L7386</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E6758</td><td></td></tr><tr><td>Tris-HCl, pH 7.5, 1M</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Teknova</td><td>d9750</td><td></td></tr><tr><td>Lithium dodecyl sulfate</td><td>Sigma-Aldrich</td><td>L9781</td><td></td></tr><tr><td>Proteinase K</td><td>New England Biosciences</td><td>P8107S</td><td></td></tr><tr><td>Ethanol, 200 Proof (100%)</td><td>Koptec</td><td>V1001</td><td></td></tr><tr><td>SYBR Green I (nucleic acid stain)</td><td>Invitrogen</td><td>S7563</td><td></td></tr><tr><td>PEG 6k</td><td>Sigma-Aldrich</td><td>81260</td><td></td></tr><tr><td>Triton X-100 (octylphenol ethoxylate)</td><td>Sigma-Aldrich</td><td>t8787</td><td></td></tr><tr><td>Nextera DNA Library Prep Kit</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td><td>New England Biosciences</td><td>m05365</td><td></td></tr><tr><td>Platinum Multiplex PCR Master Mix (Taq Master Mix)</td><td>Applied Biosystems</td><td>4464263</td><td></td></tr><tr><td>Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td><td>New England Biosciences</td><td>m0538m</td><td></td></tr><tr><td>NT buffer from Nextera XT kit (neutralization buffer)</td><td>Illumina</td><td>FC-131-1024</td><td></td></tr><tr><td>Cold cathode fluorescent inverter</td><td>(custom)</td><td>(custom)</td><td></td></tr><tr><td>DC power supply</td><td>Mastech</td><td>HY1503D</td><td></td></tr><tr><td>Zerostat 3 anti-static gun</td><td>Milty</td><td>5036694022153</td><td></td></tr><tr><td>3D-printed centrifuge syringe holder</td><td>(custom)</td><td>(custom)</td><td>See Supplemental Files for 3D print file</td></tr><tr><td>Zymo DNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>D4003</td><td></td></tr></tbody></table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

시퀀싱 기술 생물 학적 시스템에서 세포질이 성분의 역할의 진화 이해에 대 한 응답에서 단일 셀 해상도로 대량에서 패러다임의 변화를 받은. 그러나, 큰 인구의 단일 셀 시퀀싱 게놈 시퀀싱에 대 한 처리에 제한에 의해 방해 되어 있다. 이 종이에 우리는 방법 분리, 증폭, 드롭릿 마이크로 사용 하 여 단일 셀 게놈 시퀀싱 (SiC-seq) 및 바코드 단일 세포의 게놈 설명 합니다. 미세 합병 효율적으로 쌍 각 게놈 독특한 단일 셀 oligonucleotide 바코드와 함께 하는 동안 microgels에 셀 캡슐화 compartmentalized 정화와 DNA의 tagmentation 수 있도록 > 50000 단일 셀 시퀀싱 할 당 실행 합니다. 시퀀싱 데이터는 역다중화 바코드를 생성 하는 단 세포에서 발생 하는 읽기의 그룹에 의해. 단일 셀 시퀀싱의 높은 처리량과 낮은 바이어스 방법으로 SiC-seq는 광범위 한 게놈 연구를 대상으로 다양 한 세포 인구 수 있게 된다.

SiC seq 실험 워크플로 포함 3 PDMS 미세 장치는 소프트 리소 그래피 프로시저 (그림 1)를 사용 하 여 조작 합니다. 공동 흐름 dropmaker (그림 3A)는 독특한 단일 셀 식별자 genomic DNA를 라벨에 대 한 디지털 바코드 방울의 25 µ m를 생성 합니다. PCR 증폭 (표 2, 뇌관 바)에 대 한 핸들을가지고 있는 15 bp 타락 한 시퀀스 바코드 oligonucleotides에 의하여 이루어져 있다. 바코드 단일 분자 캡슐화를 달성 하기 위해 femtomolar 농도를 희석 하 고 모든 방울을 받을 0 또는 1 바코드 fragment(s). 더블-좌초 바코드 amplicons의 많은 복사본을 저조한 방울 바코드를 포함 하는 증폭 된다. 핵 산 얼룩 성공적인 증폭을 확인 하 고 바코드 조각 (그림 4B)의 캡슐화 속도 측정 하는 데 사용 됩니다. microgels 공동 세균성 세포 현 탁 액 및 동일한 유량 (그림 2A)에서 녹은 agarose 젤을 흐르는 의해 생성 됩니다. agarose는 공동 흐름 dropmaking 프로세스는 효과적으로 2의 요인에 의해 수성 솔루션을 dilutes으로 두 번 원하는 최종 농도에서 준비 된다. 로 agarose 냉각, 그것은 25 µ m 직경 microgel는 작은 물방울의 구형 볼륨 점령으로 굳은 것 이다.
일련의 세척 및 세포 단계 정화 microgels (그림 2B)에 높은 분자 무게 genomic DNA. 속보는 유화 액, 후 수성 세척 추적 밖으로 다운스트림 효소 치료를 억제할 수 있는 유기 용 제 희석 큰 볼륨에서 수행 됩니다. 씻어 microgels 셀 캡슐화 속도 (그림 4A) 확인을 현미경으로 관찰 된다. 광범위 한 용균성 활동 효소 칵테일 박테리아와19진 핵 미생물 세포 벽을 소화 microgel 서 스 펜 션에 추가 됩니다. 세제 성분을 K와 두 번째 치료 단백질을 저하 하 고 세포 파편을 solubilizes.
순화 된 DNA의 Tagmentation microgels18사이 작은 tagmented DNA 파편의 확산에서 발생 하는 잠재적인 상호 오염을 피하기 위해 방울에서 수행 됩니다. 드롭릿 캡슐화 장치 (그림 3B) 동시에 또한 "태그" 그것은 사전 로드 된 oligonucleotide20동안 이중 가닥 DNA를 조각 버퍼 및 tagmentation 효소와 함께 각 microgel compartmentalizes. microgels 가까운 포장 입자, 캡슐화 요금 1 microgel 모든 드롭 몇 남자21 (그림 4C)에 대 한 접근 달성으로 작은 물방울에 로드 됩니다.
미세 워크플로 (그림 2C)의 마지막 단계에서 장치 바코드 1 방울, 1 microgel-포함 된 드롭 및 제어 2 단계 과정에서 증폭 혼합 결합 하는 이중 합병 작업을 수행 합니다. 첫째, PCR 시 약을 포함 하는 작은 물방울 쌍 이며 노란색 (그림 5)에 표시 된 지역에서 바코드 드롭과 병합 합니다. 미세 채널에서 바닷물 전극 높은 전기 분야 그라데이션 방울 합병 트리거를 생성 합니다. 비슷한 방식으로, 첫 번째 병합 된 물방울 microgel 물방울와 결합 이며 빨간색으로 표시 된 지역에서 두 번째 시간을 병합. 방울 수집 되 고 열 순환 단일 중첩 확장 (SOE) PCR 칩. 바코드와 tagmented genomic DNA의 겹치는 보완 끝 퓨전만 제대로 바코드 구문 지 수 증폭을 허용합니다.
시퀀싱 데이터는 먼저 읽기 품질에 의해 필터링 하 고 그들의 15-bp 단일 셀 바코드 순서 대로 읽기를 그룹화 하 여 구문 분석. 유효 바코드 그룹, 그것은 읽기;의 최소 수 있어야 이 임계 처리 분석 시퀀싱 데이터의 유용한 금액에 포함 된 셀을 제한 하 고 데이터 집합에서 PCR 돌연변이 바코드 "고아"를 제거 합니다. 이 샘플을 실행, 최소 그룹 당 7.5 kbps 설정 됩니다 (150의 50 읽기 혈압 각). 그룹 크기를 비교 하는 바코드의 히스토그램 유효한 바코드 그룹의 중요 한 부분 (그림 6A) 임계값 크기 보다 큰 표시 합니다.
제어 실험 미생물 커뮤니티 구성 알려져 있다, 순도 관계 되는 풍부 통계 SiC seq 실행의 품질을 평가 하 데 사용 됩니다. 여기, 3 그람 음성 박테리아, 5 그람 양성 박테리아 및 효 모 2의 구성 된 합성 10 셀 커뮤니티 분석 이다. 주어진된 바코드 그룹의 순도 읽기 읽기 그룹에서의 총 수로 나눈 그룹에 가장 일반적인 게놈에 수로 정의 됩니다. 바코드 그룹의 대부분 순도 0.95 (그림 6B) 보다 더 큰 있다. 세포 유형의 관계 되는 풍부는 원시 읽기를 계산 하 여 고 어디 그룹에 해당 하는 셀 형식을에 할당의 회원 읽기 (그림 6 c)의 합의 바코드 그룹을 계산 하 여 계산 됩니다. 읽기 및 바코드 그룹의 풍부는 대략 동등한 비율, 특정 종 어울리지 않게 작거나 큰 바코드 그룹에 포함 되지 않은 그런 세포 인구를 샘플링 되는 나타내는에 추적 합니다. 플로팅 단일 종에서 모든 바코드 그룹의 집계 범위 전체 게놈 몇몇 또는 강하 영역 (그림 7)에 걸쳐 높은 범위를 나타냅니다. 범위의 균일 정규화 된 범위 값, 평균을 중심으로 대부분의 값의 주파수 분배로 확인할 수 있습니다 (그림 7, 삽입).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg"> 그림 1 : 사진 평판에 의해 미세 소자의 제조. (A) 마스터 금형 단일 기능 높이 스핀 코팅의 실리콘 웨이퍼에 감광 제 수-8 층에 의해 조작. 포토 레지스트는 다음 photolithographic 마스크와 UV 빛, 가교 노출된 수-8 꽃무늬. 마지막으로, uncrosslinked SU-8 개발자 욕조에 녹입니다. 결과 형 완전 한 미세 장치를 생산 하는 유리 슬라이드에 접착 되는 PDMS를 캐스팅 하는 데 사용 됩니다. (B) 더블 레이어 장치 제조 마찬가지로 스핀 코팅 및 노출 단계 시작. 이러한 단계는 다음 2 층 장치를 만드는 반복 됩니다. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg"> 그림 2: 의 SiC seq 워크플로 개요. (A) A 미생물 현 탁 액은 microgels에 있는 단일 셀을 캡슐화 하는 dropmaker 장치에 녹은 agarose와 공동 흐른. (B)는 microgels 세균성 게놈 DNA를 정화 세척의 시리즈를 받게 됩니다. 용균성 효소 그람 양성 박테리아와 효 모의 세포 벽을 소화 하 고 세제 solubilizes 세포질 파편. microgels 경우 다시 상호 오염을 줄이기 위해 tagmentation에 대 한 작은 물방울으로 캡슐화 됩니다. (C) 미세 합병, 결합 한 디지털 PCR 바코드 tagmented microgel 게놈 그리고 비율로 증폭 믹스 > 1 kHz. 오프 칩 SOE-PCR tagmented 게놈에 독특한 단일 셀 바코드를 결합 하 고 선택적으로 증폭 하 고 완전히 바코드 구문. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg"> 그림 3: Dropmaking 및 microgel 다시 캡슐화에 대 한 미세 장치. (A)이이 패널 공동 흐름 dropmaker (기능 높이의 25 µ m)를 보여줍니다. 셀 및 녹은 agarose 25 µ m x 25 µ m 접합점에서 25 µ m 방울을 생산 하기 위해 동일한 흐름 속도에서 장치에 소개 된다. 디지털 바코드 dropmaking 셀 입구 연결 및 PCR 혼합은 agarose 입구에 도입. (B)이이 패널 microgel 다시 캡슐화 장치 (기능 높이의 25 µ m)를 보여 줍니다. microgels 25 µ m x 30 µ m 교차점에서 다시 캡슐화 하기 전에 tagmentation 믹스의 볼륨을 유지 하는 그들의 가까운 포장 주문 깔때기 모양의 입구에 흐름. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg"> 그림 4 : 작은 물방울 및 microgels의 현미경 사진. (A)이이 패널 표시 효소 세포 전에 25 µ m microgels 세척 합니다. 박테리아는 붙일 캡슐화 속도의 정량화에 대 한 스테인드. 푸아송 로드 통계 지시 10에 1 방울의 속도로 캡슐화 또는 다중 캡슐화 이벤트의 빈도 최소화 하기 위해 적은 셀 이어야 합니다. (B)이이 패널은 25 µ m 디지털 바코드 작은 물방울 핵 산 얼룩으로 대우의 형광 현미경 이미지를 보여 줍니다. 방울 증폭된 바코드 파편을 포함 하는 강한 형광 신호를 생성 합니다. (C)이이 패널 microgels 다시 50 µ m에서에서 캡슐화를 보여줍니다. microgels의 가까운 패킹 캡슐화 요금 몇 남자와 드롭 당 1 젤을 접근 수 있습니다. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg"> 그림 5 : 단일 셀 게놈 바코드에 대 한 미세 이중 합병 장치. 2 단계 합병 작업 쌍 높은 처리량에서 tagmented 유전자와 바코드 방울. PCR 혼합의 물방울은 처음 생성 하 고 바닷물 전극을 사용 하 여 노란색으로 표시 된 지역에서 바코드 드롭릿와 합병. 다음으로 microgel를 포함 하는 작은 물방울 소개 이며 빨간색으로 표시 된 지역에서 두 번째 시간을 병합. 오일 후미 reinjected 방울 사이의 간격의 정확한 제어를 위한 수 있습니다. 바코드 reinjection 챔버와 스페이서 석유 파란색에서 음영 짧은 25 µ m 계층에 배치 됩니다. 다른 모든 장치 기능 전체 높이의 45 µ m로 두꺼운 층에 속한다. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg"> 그림 6 : 10 셀 합성 미생물 지역 사회에 대 한 바코드 그룹 메트릭. (A)이이 패널 그룹 크기는 바코드의 분포를 보여줍니다. 주어진된 크기의 그룹 수가 그룹 크기가 증가 함에 따라 기 하 급수적으로 감소합니다. 그룹 당 7.5 kbps의 최소 임계값 제한 충분 한 양의 정보를 가진 그룹을 분석 하 고 PCR 돌연변이 시퀀스 "고아"를 제거 합니다. (B)이이 패널에서 그룹 순도 바코드의 분포를 보여줍니다. 대부분 (> 90%)은 매우 높은 순도의 그룹의 (> 95%). (C)이이 패널 읽기 및 바코드 그룹 수준에서 계산 하는 10 종의 관계 되는 풍부를 보여준다. 계산 방법 2 바코드 그룹 크기 종에 걸쳐 일관성 있는 지를 나타내는 비슷한 결과 생산. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg"> 그림 7 : 집계의 게놈 범위 새 균의 subtilis 바코드 그룹. B. subtilis 박테리아를 모든 바코드 그룹에서 읽기 (N = 9,398)는 풀링된 및 집계에서 분석. 원형 범위 지도 SiC seq 읽기 없이 관찰 강하 지역의 범위 균일성을 보여 줍니다. 파선 둘레는 평균 범위를 나타냅니다 (5.55 x). 상대 범위 주파수의 인세트 히스토그램 표시 기초의 대량 게놈 넓은 평균 근처 깊이에서 커버는 점선으로 표시. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>장치</td>
			<td>1 층 높이 (µ m)</td>
			<td>1 레이어 회전 속도 (rpm)</td>
			<td>2 층 높이 (µ m)</td>
			<td>2 레이어 회전 속도 (rpm)</td>
		</tr>
<tr>
<td>공동 흐름 dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>젤 재 encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>이중 합병</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
</tbody></table>표 1: 미세 장치 제조 매개 변수. 이 표에서 감광 스핀 코팅에 대 한 그들의 필요한 속도와 SiC seq 워크플로 (3025 SU-8에 대 한 제조업체의 사양에 따라)에 사용 되는 미세 장치 목록을 보여줍니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>레이블</td>
			<td colspan="5">시퀀스 (5' > 3')</td>
		</tr>
<tr>
<td>바</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
<tr>
<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
<tr>
<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
<tr>
<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
<tr>
<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
</tbody></table>표 2: 뇌관 시퀀스.
보충 파일 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>
보조 파일 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

단일 셀 게놈 시퀀싱 초고 처리량 미세 플랫폼

단일 셀 시퀀싱 생물 학적 시스템, genotypic이 보여 하지만 현재 기술 커뮤니티 구성 및 기능의 깊은 프로 파일링에 필요한 처리량 부족. 여기, 우리는 미세 워크플로 시퀀싱에 대 한 설명 > 다양 한에서 50000 단일 셀 게놈 세포 인구.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Nanyang Technological University

Research

JoVE Journal

Bioengineering

17.6K 조회수.  University of California, San Francisco. 단일 셀 시퀀싱 생물 학적 시스템, genotypic이 보여 하지만 현재 기술 커뮤니티 구성 및 기능의 깊은 프로 파일링에 필요한 처리량 부족. 여기, 우리는 미세 워크플로 시퀀싱에 대 한 설명 > 다양 한에서 50000 단일 셀 게놈 세포 인구.

비디오: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

높은 처리량 MicroRNA의 프로파일 : 최적 멀티 플렉스 플루 동적 ArrayTM의 IFCs에 Nanoliter의 규모 qRT - PCR

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

연구

생체공학

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

마이크로 유체 플랫폼을 사용하여 높은 처리량 단백질 표현 생성기

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

High Throughput Single-cell and Multiple-cell Micro-encapsulation

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 &mu;m polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency Pk=1 of 83.7% and a double-particle encapsulation efficiency Pk=2 of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. 
Introduction 
Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify signals from bioreactor products. Drops also provide the ability to re-merge drops into larger aqueous samples or with other drops for intercellular signaling studies.1,2 The reduction in dilution implies stronger detection signals for higher accuracy measurements as well as the ability to reduce potentially costly sample and reagent volumes.3 Encapsulation of cells in drops has been utilized to improve detection of protein expression,4 antibodies,5,6 enzymes,7 and metabolic activity8 for high throughput screening, and could be used to improve high throughput cytometry.9 Additional studies present applications in bio-electrospraying of cell containing drops for mass spectrometry10 and targeted surface cell coatings.11 Some applications, however, have been limited by the lack of ability to control the number of cells encapsulated in drops. Here we present a method of ordered encapsulation12 which increases the demonstrated encapsulation efficiencies for one and two cells and may be extrapolated for encapsulation of a larger number of cells.
To achieve monodisperse drop generation, microfluidic "flow focusing" enables the creation of controllable-size drops of one fluid (an aqueous cell mixture) within another (a continuous oil phase) by using a nozzle at which the streams converge.13 For a given nozzle geometry, the drop generation frequency f and drop size can be altered by adjusting oil and aqueous flow rates Qoil and Qaq. As the flow rates increase, the flows may transition from drop generation to unstable jetting of aqueous fluid from the nozzle.14 
When the aqueous solution contains suspended particles, particles become encapsulated and isolated from one another at the nozzle. For drop generation using a randomly distributed aqueous cell suspension, the average fraction of drops Dk containing k cells is dictated by Poisson statistics, where Dk = &lambda;k exp(-&lambda;)/(k!) and &lambda; is the average number of cells per drop. The fraction of cells which end up in the "correctly" encapsulated drops is calculated using Pk = (k x Dk)/&Sigma;(k' x Dk'). The subtle difference between the two metrics is that Dk relates to the utilization of aqueous fluid and the amount of drop sorting that must be completed following encapsulation, and Pk relates to the utilization of the cell sample. As an example, one could use a dilute cell suspension (low &lambda;) to encapsulate drops where most drops containing cells would contain just one cell. While the efficiency metric Pk would be high, the majority of drops would be empty (low Dk), thus requiring a sorting mechanism to remove empty drops, also reducing throughput.15
Combining drop generation with inertial ordering provides the ability to encapsulate drops with more predictable numbers of cells per drop and higher throughputs than random encapsulation. Inertial focusing was first discovered by Segre and Silberberg16 and refers to the tendency of finite-sized particles to migrate to lateral equilibrium positions in channel flow. Inertial ordering refers to the tendency of the particles and cells to passively organize into equally spaced, staggered, constant velocity trains. Both focusing and ordering require sufficiently high flow rates (high Reynolds number) and particle sizes (high Particle Reynolds number).17,18 Here, the Reynolds number Re =uDh/&nu; and particle Reynolds number Rep =Re(a/Dh)2, where u is a characteristic flow velocity, Dh [=2wh/(w+h)] is the hydraulic diameter, &nu; is the kinematic viscosity, a is the particle diameter, w is the channel width, and h is the channel height. Empirically, the length required to achieve fully ordered trains decreases as Re and Rep increase. Note that the high Re and Rep requirements (for this study on the order of 5 and 0.5, respectively) may conflict with the need to keep aqueous flow rates low to avoid jetting at the drop generation nozzle. Additionally, high flow rates lead to higher shear stresses on cells, which are not addressed in this protocol. The previous ordered encapsulation study demonstrated that over 90% of singly encapsulated HL60 cells under similar flow conditions to those in this study maintained cell membrane integrity.12 However, the effect of the magnitude and time scales of shear stresses will need to be carefully considered when extrapolating to different cell types and flow parameters. The overlapping of the cell ordering, drop generation, and cell viability aqueous flow rate constraints provides an ideal operational regime for controlled encapsulation of single and multiple cells.
Because very few studies address inter-particle train spacing,19,20 determining the spacing is most easily done empirically and will depend on channel geometry, flow rate, particle size, and particle concentration. Nonetheless, the equal lateral spacing between trains implies that cells arrive at predictable, consistent time intervals. When drop generation occurs at the same rate at which ordered cells arrive at the nozzle, the cells become encapsulated within the drop in a controlled manner. This technique has been utilized to encapsulate single cells with throughputs on the order of 15 kHz,12 a significant improvement over previous studies reporting encapsulation rates on the order of 60-160 Hz.4,15 In the controlled encapsulation work, over 80% of drops contained one and only one cell, a significant efficiency improvement over Poisson (random) statistics, which predicts less than 40% efficiency on average.12
In previous controlled encapsulation work,12 the average number of particles per drop &lambda; was tuned to provide single-cell encapsulation. We hypothesize that through tuning of flow rates, we can efficiently encapsulate any number of cells per drop when &lambda; is equal or close to the number of desired cells per drop. While single-cell encapsulation is valuable in determining individual cell responses from stimuli, multiple-cell encapsulation provides information relating to the interaction of controlled numbers and types of cells. Here we present a protocol, representative results using polystyrene microspheres, and discussion for controlled encapsulation of multiple cells using a passive inertial ordering channel and drop generation nozzle.

Combining monodisperse drop generation with inertial ordering of cells and particles, we describe a method to encapsulate a desired number of cells or particles in a single drop at kHz rates. We demonstrate efficiencies twice exceeding those of unordered encapsulation for single- and double-particle drops.

높은 처리량 마이크로 캡슐 단일 셀 및 다중 셀

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement ...

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

마이크로 스케일 세포 자극 실험을위한 다목적 자동화 플랫폼

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

단일 세포의 다목적 화학 분석을위한 미세 유체 칩

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

나노 포어 시퀀싱을 사용 하 여 전 혈에서 mRNA의 시퀀싱

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

유전학

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly sensitive. This protocol obtains precise measurements of gene expression from single worms or from bulk samples. The protocol presented here provides a novel adaptation of existing methods for complementary DNA (cDNA) preparation coupled to a nanofluidic RT-qPCR platform. The first part of this protocol, named &#8216;Worm-to-CT&#8217;, allows cDNA production directly from nematodes without the need for prior mRNA isolation. It increases experimental throughput by allowing the preparation of cDNA from 96 worms in 3.5 h. The second part of the protocol uses existing nanofluidic technology to run high-throughput RT-qPCR on the cDNA. This paper evaluates two different nanofluidic chips: the first runs 96 samples and 96 targets, resulting in 9,216 reactions in approximately 1.5 days of benchwork. The second chip type consists of six 12 x 12 arrays, resulting in 864 reactions. Here, the Worm-to-CT method is demonstrated by quantifying mRNA levels of genes encoding heat shock proteins from single worms and from bulk samples. Provided is an extensive list of primers designed to amplify processed RNA for the majority of coding genes within the C. elegans genome.

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

In this article a high-throughput protocol for fast and reliable determination of gene expression levels in single or bulk C. elegans samples is described. This protocol does not require RNA isolation and produces cDNA directly from samples. It can be used together with high-throughput multiplexed nanofluidic real-time qPCR platforms.

단일 및 벌크 C.의 고처리량 정량적 RT-PCR. 나노 유체 기술을 사용하여 샘플

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

높은 처리량 단일 세포의 분리 및 문화를위한 미세 유체 플랫폼

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

전체 게놈 DNA 분석을 위한 매우 긴 읽기 시퀀싱

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

장기간 무세포 유전자 발현의 전도를 위한 다층 미세유체 플랫폼

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...