Diese Arbeit wurde unterstützt von der National Science Foundation durch den CAREER Award (Grant-Nummer DBI-1253293); die National Institute of Health (NIH) (Zuschuss Zahlen HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); und das Defense Advanced Research Projekte Agentur Leben Gießereien Programm (Vertragsnummern HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Patente im Zusammenhang mit diesem Workflow wird vielleicht an Mission Bio, von welchen Adam R. Abate lizenziert ein Aktionär.

Die SiC-Seq mikrofluidischen Workflow produziert einzellige Genom-Sequenzierungsdaten von Tausenden von Bakterienzellen. Digitalen Barcodes gespleißt auf die Genome der Microgel-gekapselte Zellen ermöglichen die in Silico Dekonvolution NGS Daten in Gruppen von Barcodes liest aus derselben Zelle. Ein kontrollexperiment mit einer mikrobiellen Gemeinschaft von bekannter Zusammensetzung ist notwendig für die Beurteilung der Reinheit der Barcode-Gruppen. Ein großer Teil der Low-Reinheit Gruppen zeigt, dass die Zelle Kapselung Rate zu hoch ist oder gibt es erhebliche Tröpfchen Cross-Kontamination während der mikrofluidischen Verarbeitungsschritte auftreten. Poisson Statistiken zufolge sollte die Barcodes und Zellen in einem Ziel-Verhältnis von 1 Teilchen für jeden 10 Tropfen, die Rate der mehrere Kapselung Ereignisse auf weniger als 5 % von allen nicht-leere Tröpfchen zu begrenzen gekapselt werden. Eine Kapselung-Rate höher als dies steigt die Preise von Dubletten exponentiell, so ist die Überprüfung der Kapselung Verhältnis während des Dropmaking-Prozesses von entscheidender Bedeutung. Nutzer sollten die Kapselung von mehreren Zellen in eine einzelne Microgel besonders vorsichtig sein, da liest aus verschiedenen Zellen teilen die gleiche Barcode-Sequenz Bioinformatically getrennt werden können. Im Fall, dass 1 Zelle erhält 2 verschiedene Barcodes, die Barcode-Gruppe-Reinheit ist nicht betroffen, obwohl die Fülle Metriken verzerrt werden, wenn durch Barcode-Sequenz zählen.
Droplet Cross-Kontamination auch durch suboptimale Fusion Bedingungen entstehen können. Bei einer erfolgreichen Operation kann mikrofluidischen Fusion Gerät (Abbildung 5) kontrollierbar 1 Barcode-Tropfen mit 1 Microgel und einem Volumen von PCR-Reagenz koppeln. Non-Ideal Flussraten führt ein Tröpfchen Paarung bei falschen Verhältnisse: 1 Barcode könnte zum Beispiel mit 2 mikrogele gekoppelt werden. Alle Durchflussmengen im Protokoll aufgeführten sollen Schätzungen und können je nach geringfügige Abweichungen in der Geometrie und Tröpfchen Gerätegrößen angepasst werden müssen. Benutzer mit Zugriff auf Kameras mit High-Speed-Aufnahme-Funktionen (> 10.000 Bilder/s) sollten die richtigen Tropfen Fusion zu Beginn und im Laufe der Operation mikrofluidischen überprüfen. Benutzer ohne Zugriff auf eine High-Speed-Kamera ein kleines Volumen der zusammengeführten Ausgabe sammeln und manuell messen die tröpfchengrößen unter dem Mikroskop. Die Tröpfchengröße sollte einheitlich sein: ein Übermaß an individuellen Barcodes oder Microgel Tropfen zeigt an, dass die Reinjektion entsprechend gesenkt werden sollte.
Mehrere werden allgemeine Vorkehrungen beim Umgang mit mikrogele und Microdroplets, ihre Integrität zu bewahren. Mikrogele, muss obwohl mechanisch robust, ausreichend vor den Bruch und Waschschritte dafür vollständig Gelierung gekühlt werden. Non-sphärische mikrogele sind ein Indiz, das die Agarose nicht ausreichend Zeit gegeben, zu festigen. Beim Waschen mikrogele spin-down die Suspensionen mit der erforderlichen Geschwindigkeit um ein Produkt zu vermeiden. Agarose Hydrogel hat einen Brechungsindex genau passend, das Wasser und kann schwierig sein, in ein Rohr22, zu sehen, so dass Benutzer die Gel-Liquid-Grenze vor Aspiration sorgfältig identifizieren sollte. Wasser-in-Öl-Tropfen sind anfällig für Koaleszenz durch den Aufbau von statischen Kräfte23 Labor Handschuhe und Schläuche. Aus diesem Grund empfehlen wir laden die Tröpfchen Reinjektion Spritzen mit bloßen Händen und behandeln die Reinjektion Linien mit einem Anti-Statik-Pistole vor die Pumpe ansaugen. Zusammengeführte große Tröpfchen können entfernt werden, durch langsam rotierende die Emulsionen in einer Spritze und manuell Absaugen von großen Tropfen, die in der Nähe der Spitze aufgrund ihrer größeren Auftrieb zu sammeln.
SiC-Seq ist die erste Technologie nachzuweisen einzellige Genomsequenzierung von > 50.000 Bakterienzellen. Diese Plattform bietet erhebliche Vorteile im Durchsatz über bestehende Ansätze und ermöglicht eine tiefere Probenahme von heterogenen mikrobieller Gemeinschaften. Bisher haben mikrofluidischen Technologien für einzellige Genom-Sequenzierung Microchambers9 und Mikrovertiefungen24 für Zelle Isolation und Verstärkung, aber mit Durchsätzen im Bereich von nur Dutzende bis Hunderte von Zellen eingesetzt. Der Fluss sortieren einzelner Zellen in Wellplates5,6 erfordert keine spezielle mikrofluidischen Instrumentation aber besitzt einen ähnlich geringen Durchsatz. Da die Boden- und Wasserproben aus der Umgebung häufig alpha Unterschiede haben > 1.000 auf die Spezies Stufe25,26, SiC-Seq ist ein großer Vorteil aufgrund seiner Fähigkeit, eine weit größere Anzahl von Organismen zu probieren. Die SiC-Seq-Workflow ist anpassungsfähig auf Zelle Eingaben von Laborkultur, die natürliche Umwelt oder eine lebende Host. Eine Zellprobe muss nur in einer wässrigen Suspension und frei von großen Partikeln (> 10 µm) für mikrofluidischen Kapselung geeignet. Beispielsweise wurde die Methode bereits zu einer Probe von Meerwasser mit Hilfe einer Reihe von Waschanlagen und Filterung Schritte aus, um die Zellen vor der Kapselung17Vorverarbeiten angewendet.
Die SiC-Seq-Protokoll generiert eine relativ spärliche Sequenzierung Datenmenge aus jeder einzelnen Zelle und möglicherweise nicht für alle Anwendungen geeignet. Einige Bioinformatik-Algorithmen wie de Novo Genom Montage oder Einzel-Nukleotid-Variante (SNV) aufrufen erfordern höhere Abdeckung tiefen, effektiv zu arbeiten. Stattdessen können Barcode Gruppen gruppierten in Silico taxonomische binning Methoden27 sein, so dass Algorithmen auf größere Sätze liest angewendet werden können. Die relativ niedrige Barcoding Gesamteffizienz der SiC-Seq-Workflow kann auch in Fällen Herausforderungen denen die Verfügbarkeit der eingabesample niedrig ist. SiC-Seq basiert auf einer Poisson-verteilten Barcode Kapselung Schritt, daher etwa 10 % der Zellen erhalten einen molekularen Barcode und werden während der abschließenden Bibliothek Vorbereitungsschritt verstärkt. Zwar ist dies vergleichbar mit anderen Microdroplet-basierte Barcode Systeme10, Benutzer arbeiten mit kostbaren Zellproben haben Schwierigkeiten, die die entsprechende Bibliothek Ausbeute für die Sequenzierung zu erreichen und möglicherweise müssen Sie die Anzahl der PCR-Zyklen im Finale zu erhöhen Verstärkung Schritt. Eine andere mögliche Lösung für Benutzer mit mikrofluidischen Expertise ist es, positive Barcode Tröpfchen Sortieren nach dem digitalen PCR Schritt, womit sich den Gesamtwirkungsgrad Barcoding auf > 85 %28.
Eine mögliche zukünftige Richtung für SiC-Seq-Technologie wird den Workflow für die Verwendung mit Säugerzellen, ebnet den Weg für neue klinische Studien der einzelligen angepasst. Als Beispiel, eine Analyse der die Kopie Nummer Unterschiede zwischen den einzelnen Krebs Zellen Mai unser Verständnis der Rolle der Heterogenität in Krebs Pathologie2weiter. Alternativ würde die Integration von SiC-Seq mit vorhandenen Methoden zur Sonde und DNA-Sequenzen von Interesse29 bereichern die gezielte einzellige Sequenzierung von Subpopulationen oder seltene Sorten von Zellen ermöglichen. Mit Umweltproben könnten Gene innerhalb einer bekannten Stoffwechselweg gezielt und Kontextuell neben benachbarte Gene zur Identifizierung neuartiger genomischer Inseln analysiert werden. Von innerhalb einer menschlichen Host-Umgebung, niedrige Titer Pathogene Bakterien Proben isoliert werden konnte und sequenziert einzellige Ebene mehr untersuchen eng ihre genotypischen Ursprünge der Virulenz.

Das Genom dient als eine Blaupause der zelluläre Identität und Funktion, mit der Gesamtheit des Organismus Potenzial Codierung ist. Ein Verständnis der zellulären Biologie an der Genom-Ebene kann die beobachteten phänotypische Vielfalt innerhalb heterogener Zell-Populationen erklären. Diese Heterogenität ist offensichtlich in biologischen Systemen und hat breite Auswirkungen auf die menschliche Gesundheit und Krankheit. Zum Beispiel sind Genvarianten Kopie Zahl unter den Tumorzellen, die Entwicklung und Ausbreitung von Krebs1,2verbunden. Bei bakteriellen Infektionen Pathogenitätsinseln vorhanden in einem kleinen Bruchteil der Genome horizontal übertragen werden können und führen zu der Verbreitung von Antibiotika-resistente Bakterien3,4. Eine primäre Herausforderung bei der Untersuchung der Genome der Ebene der einzelligen ist die geringe Mengen an DNA zur Verfügung sowie die Notwendigkeit, Tausende von Zellen zu analysieren, die ganze Vielfalt der Genotypen zu probieren. Aus diesen Gründen haben Einschränkungen in experimentelle Durchsatz die Wirksamkeit der einzelligen Studien, Vorspannen Ergebnisse in Richtung der am häufigsten vorkommenden Zellen verhindert. Einzellige ISOLIERUNGSTECHNIKEN wie Flow sortieren,5,6, optische Pinzette7, Einbettung in loser Schüttung Gele8und Mikrofluidik9 sind in der Lage hunderte von Zellen für die Sequenzierung; Dies ist jedoch nur einen kleinen Bruchteil von den meisten Proben. Eine Methode für einzellige Genom-Sequenzierung mit wesentlich höheren Durchsatz würde erlauben, tiefer und umfassender Profilierung der Zell-Populationen, damit Aufklärung die Rolle der genotypischen Vielfalt innerhalb dieser Gemeinschaften.
Droplet Mikrofluidik ermöglicht die Hochdurchsatz-Manipulation von Zellen und biologische Reagenzien innerhalb von Millionen von Picoliter-Skala Reaktoren. Heute, Microdroplet, die Technologien verwendet wurden, um differentielle Expression-Muster zwischen den Zellen von heterogenen Gewebe10,11,12, studieren tief Sequenz lange Moleküle13,14 ,15und Verhalten Chromatin Immunopräzipitation Sequenzierung (ChiP-Seq) Analysen auf Einzelzellen16. In der Tat sind Microdroplets hohem Durchsatz, unterteilte Operationen, so dass sie offen für Anwendungen in einzellige Genomics. Die Entwicklung dieser Technologie stellt jedoch seinen eigenen einzigartigen technologischen Herausforderungen. Zellen müssen lysiert, gereinigt und mit minimalen Bias, um einheitlich Probe Zellpopulationen verstärkt werden. Außerdem, im Gegensatz zu Polyadenylated mRNA Transkripte in Säugerzellen gibt es keine vergleichbare Molekulare Motiv im Genom, die Erfassung von der Ziel-Nukleinsäure zu erleichtern. Aus diesen Gründen wurde die Sequenzierung des Genoms einzellige in Microdroplet Plattformen schwer umzusetzen.
Dabei bieten wir ein detailliertes Protokoll unseres bereits berichtet einzellige mikrofluidischen Ansatzes in der Lage, der Sequenzierung der Genome von Zehntausenden von Zellen in einem einzigen Experiment17. Mit dieser Technologie, genannt SiC-Seq Bakterienzellen in Mikron-Skala Hydrogele gekapselt und individuell lysiert, Tagmented, und fusionierte mit einer Microdroplet, enthält einen einzigartige Oligonukleotid-Barcode, der auf die Zelle genomischer DNA über gespleißt wird eine einzigen Überschneidungen Erweiterung Polymerase-Kettenreaktion (PCR). Die Hydrogele dienen als isolierte Container in denen hohen Molekulargewicht genomischer DNA sterisch ummantelt ist, ermöglicht kleinere Moleküle wie Wasch- und lytischen Enzymen Zugang zu reinigen DNA vor Barcoding18. Dieses Protokoll verarbeitet > 50.000 Einzelzellen in einer Angelegenheit von Stunden, wodurch eine Barcode-Bibliothek für die Sequenzierung bereit. Nach der Sequenzierung sind die liest demultiplexed entsprechend ihrer einzellige Barcode Reihenfolge, was in einem Dataset besteht aus Millionen von liest, jeder mit einem zellulären Index.

<table border="0" cellpadding="0" cellspacing="0" width="1218">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3&#34; silicon wafers, P type, virgin test grade</td>
			<td style="width:245px;">University Wafers</td>
			<td style="width:163px;">447</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SU-8 3025 photoresist</td>
			<td style="width:245px;">Microchem</td>
			<td style="width:163px;">17030192</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Spin coater</td>
			<td style="width:245px;">Specialty Coating Systems</td>
			<td style="width:163px;">G3P-8</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Photomasks</td>
			<td style="width:245px;">CadArt Servcies</td>
			<td style="width:163px;">(custom)</td>
			<td>See Supplemental Files for mask designs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PGMEA developer</td>
			<td>Sigma-Aldrich</td>
			<td>484431</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropanol</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>109827</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sylgard 184 silicone elastomer kit</td>
			<td style="width:245px;">Krayden</td>
			<td style="width:163px;">4019862</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Degassing chamber</td>
			<td style="width:245px;">Bel-Art</td>
			<td style="width:163px;">42025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.75 mm biopsy punch</td>
			<td>World Precision Instruments</td>
			<td>504529</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass microscope slides (75 mm x 50 mm)</td>
			<td style="width:245px;">Corning</td>
			<td>294775X50</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Aquapel (hydrophobic glass treatment)</td>
			<td style="width:245px;">Pittsburgh Glass Works</td>
			<td>47100</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PE-2 polyethylene tubing</td>
			<td style="width:245px;">Scientific Commodities</td>
			<td>B31695-PE/2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1 mL syringes</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">309628</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">27 gauge needles</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">305109</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Syringe pump</td>
			<td style="width:245px;">New Era Pump Systems</td>
			<td>NE-501</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Novec HFE-7500 fluorinated oil (HFE)</td>
			<td style="width:245px;">3M</td>
			<td style="width:163px;">98-0212-2928-5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">FC-40 fluorinated oil</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">F9755</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PEG-PFPE surfactant</td>
			<td style="width:245px;">Ran Biotechnologies</td>
			<td style="width:163px;">008-FluoroSurfactant</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Space heater</td>
			<td style="width:245px;">Lasko&#160;</td>
			<td style="width:163px;">CD09250&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Agarose, low gelling temperature</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">a9414</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">TE (10X)</td>
			<td style="width:245px;">Rockland</td>
			<td style="width:163px;">mb-007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PBS 1X, pH 7.4</td>
			<td style="width:245px;">E&#38;K Scientific Products</td>
			<td>EK-65083</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">OptiPrep (density gradient medium)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">d1556</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1H,1H,2H-Perfluoro-1-Octanol (PFO)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">370533</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Span 80 (sorbitane monooleate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">s6760</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Hexane</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">139386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tween 20 (polysorbate 20)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">p2287</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysozyme Type IV</td>
			<td style="width:245px;">MP Biomedicals</td>
			<td style="width:163px;">195303</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Mutanolysin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>M9901</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zymolyase (yeast lytic enzyme)</td>
			<td style="width:245px;">Zymo Research</td>
			<td style="width:163px;">e1004</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysostaphin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>L7386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Sodium chloride</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">EDTA</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>E6758</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tris-HCl, pH 7.5, 1M</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">15567-027</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Dithiothreitol (DTT)</td>
			<td style="width:245px;">Teknova</td>
			<td style="width:163px;">d9750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lithium dodecyl sulfate</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">L9781</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Proteinase K</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">P8107S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol, 200 Proof (100%)</td>
			<td style="width:245px;">Koptec</td>
			<td>V1001</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">SYBR Green I (nucleic acid stain)</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">S7563</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PEG 6k</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>81260</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Triton X-100 (octylphenol ethoxylate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">t8787</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nextera DNA Library Prep Kit</td>
			<td style="width:245px;">Illumina</td>
			<td>FC-121-1030</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m05365</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Platinum Multiplex PCR Master Mix (Taq Master Mix)</td>
			<td style="width:245px;">Applied Biosystems</td>
			<td style="width:163px;">4464263</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m0538m</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">NT buffer from Nextera XT kit (neutralization buffer)</td>
			<td style="width:245px;">Illumina</td>
			<td style="width:163px;">FC-131-1024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Cold cathode fluorescent inverter</td>
			<td style="width:245px;">(custom)</td>
			<td style="width:163px;">(custom)</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">DC power supply</td>
			<td style="width:245px;">Mastech</td>
			<td>HY1503D</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zerostat 3 anti-static gun</td>
			<td style="width:245px;">Milty</td>
			<td>5036694022153</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3D-printed centrifuge syringe holder</td>
			<td style="width:245px;">(custom)</td>
			<td>(custom)</td>
			<td>See Supplemental Files for 3D print file</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo DNA Clean &#38; Concentrator-5</td>
			<td style="width:245px;">Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
	</tbody>
</table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sequenziertechnologien haben einen Paradigmenwechsel von Masse, einzellige Auflösung als Reaktion auf eine sich entwickelnde Verständnis der Rolle der zellulären Heterogenität in biologischen Systemen unterzogen. Jedoch wurde einzellige Sequenzierung von großen Populationen durch Einschränkungen bei der Verarbeitung von Genome für die Sequenzierung behindert. In diesem Beitrag beschreiben wir einer Methode für einzellige Genom-Sequenzierung (SiC-Seq) die Tröpfchen Mikrofluidik verwendet, um zu isolieren, zu verstärken und Barcode der Genome einzelner Zellen. Zelle die Kapselung in mikrogele ermöglicht es, die unterteilte Reinigung und Tagmentation der DNA, während eine mikrofluidischen Fusion effizient jedes Genom mit einem einzigartigen einzellige Oligonukleotid-Barcode Paare erlaubt > 50.000 Einzelzellen sequenziert werden pro Durchlauf. Die Sequenzierungsdaten ist per Barcode Generieren von Gruppen von liest aus Einzelzellen demultiplexed. Als eine Hochdurchsatz- und Low-Bias Methode der einzelligen Sequenzierung wird SiC-Seq ein breiteres Spektrum von genomischen Studium richtet sich an unterschiedliche Zellpopulationen ermöglichen.

Die SiC-Seq experimentelle Workflow enthält 3 PDMS mikrofluidischen Geräten hergestellt, mit einem weichen Lithographie-Verfahren (Abbildung 1). Eine Co-Flow-Dropmaker (Abbildung 3A) erzeugt 25 µm von digitalen Barcode Tröpfchen für die Kennzeichnung von genomischen DNS mit einer eindeutigen Kennung der einzelligen. Die Barcode-Oligonukleotide bestehen aus einer 15 bp Entartete Abfolge flankiert von PCR-Griffe für Verstärkung (Tabelle 2, BAR-Primer). Die Barcodes werden verdünnt, um eine femtomolare Konzentration der Einzelmolekül-Kapselung zu erreichen und alle Tröpfchen erhalten entweder 0 oder 1 Barcode FCP. Die Tröpfchen mit einem Barcode werden verstärkt, viele Kopien der Doppelstrang-Barcode Amplifikate nachgeben. Ein Nukleinsäure-Fleck wird verwendet, um die erfolgreiche Verstärkung zu überprüfen und zu quantifizieren die Kapselung Rate der Barcode-Fragmente (Abbildung 4 b). Die mikrogele entstehen durch Co fließt eine Bakterienzelle Federung und einem geschmolzenen Agarosegel bei gleicher Flussraten (Abbildung 2A). Die Agarose wird in zweimal die gewünschte Endkonzentration, vorbereitet, wie die Co-Flow Dropmaking Prozess effektiv die wässrigen Lösungen um den Faktor 2 verdünnt. Da die Agarose abkühlt, erstarrt es in eine 25 µm Durchmesser Microgel besetzen die kugelförmigen Volumen des tropfenabscheiders.
Eine Reihe von Wasch- und Lyse Schritten reinigt den hohe Molekulargewicht genomischen DNA in mikrogele (Abb. 2 b). Nach dem Bruch der Emulsionen, wässrige Waschungen erfolgt in großen Mengen, Spur organische Lösungsmittel verdünnen die nachgelagerten enzymatischen Behandlungen hemmen können. Die gewaschenen mikrogele werden unter dem Mikroskop zu überprüfen, die Zelle Kapselung Rate (Abb. 4A) beobachtet. Ein Cocktail von Enzymen mit breiten lytische Aktivität ergänzt die Microgel Aussetzung, die Zellwände der Bakterien und Eukaryoten Mikroben19zu verdauen. Eine zweite Behandlung mit Proteinase K und Reinigungsmittel die Proteine abbaut und zellenrückstand solubilisiert.
Tagmentation der gereinigte DNA erfolgt in Tropfen, um potenzielle infolge der Diffusion von kleinen Tagmented DNA-Fragmente zwischen mikrogele18Kreuzkontamination zu vermeiden. Ein Tröpfchen Kapselung Gerät (Abb. 3 b) teilt jedem mikrogel mit einem Puffer und Tagmentation Enzym, welches gleichzeitig doppelsträngige DNA Fragmente während auch "tagging" es mit einer vorinstallierten Oligonukleotid-20. Die mikrogele werden in die Tröpfchen als dicht an dicht Partikel erreichen Kapselung Preise nähert sich 1 Microgel für jeden Tropfen mit einigen Dubletten21 (Abbildung 4) geladen.
Im letzten Schritt des mikrofluidischen Workflows (Abbildung 2) führt ein Gerät einen doppelten Fusion Vorgang 1 Barcode-Tropfen, 1 Microgel-haltigen Tropfen und die Verstärkung Mischung in zwei kontrollierten Schritten kombinieren. Erstens ist ein Tröpfchen mit PCR Reagenz gepaart und mit einem Barcode-Tropfen in der Region erscheinen in gelb (Abbildung 5) zusammengeführt. Salzwassersee Elektroden in der Mikrofluidik-Kanal erzeugen einen hohen elektrischen Feld Farbverlauf, der Tröpfchen Fusion auslöst. In ähnlicher Weise ist das erste zusammengeführte Tröpfchen gepaart mit einem Microgel Tröpfchen und ein zweites Mal in der Region erscheinen in rot zusammengeführt. Die Tröpfchen werden gesammelt und thermischen Gefahren-Chip in einer Single-Überlappung Verlängerung (SOE) PCR. Die überlappenden komplementäre Enden des Barcodes und die Tagmented genomischer DNA ermöglichen Fusion und exponentielle Amplifikation nur richtig Barcode Konstrukte.
Die Sequenzierungsdaten zuerst gefiltert durch eine Lesen Sie Qualität und dann durch die Gruppierung der liest laut ihrer 15-bp einzellige Barcode-Sequenz analysiert. Für eine Barcode-Gruppe als gültig betrachtet werden sollte es eine Mindestanzahl von liest enthalten; Diese Schwellwerte schränkt die Analyse auf Zellen mit eine sinnvolle Menge an Sequenzierungsdaten und den PCR mutiert Barcode "Waisen" aus dem Dataset entfernt. In diesem Beispiel ausführen, befindet sich das Minimum auf 7,5 kbit/s pro Gruppe (50 mal gelesen von 150 bp jedes). Ein Histogramm der Barcode Grafen gegen die Größe der Gruppe zeigt, dass ein erheblicher Teil der gültigen Barcode Gruppen oberhalb der Schwellengröße (Abbildung 6A).
In einem kontrollexperiment, wo die mikrobiellen Gemeinschaft Zusammensetzung bekannt ist, werden die Reinheit und die relative Häufigkeit Metriken zur Bewertung der Qualität einer SiC-Seq laufen. Hier ist eine synthetische 10-Zelle-Gemeinschaft bestehend aus 3 gram-negativen Bakterien, 5 gram-positiven Bakterien und Hefen 2 analysiert. Die Reinheit einer bestimmten Barcode-Gruppe ist definiert als die Anzahl der Lesevorgänge, die Zuordnung zu den häufigsten Genom in der Gruppe geteilt durch die Gesamtzahl der Lesevorgänge in der Gruppe. Die überwiegende Mehrheit der Barcode-Gruppen haben Reinheiten größer 0,95 (Abb. 6 b). Relative Häufigkeit der Zelltypen wird berechnet durch zählen der rohen liest und zählen die Barcode-Gruppen, wo die Gruppen einen Zellentyp entspricht dem Konsens von seiner Mitglied liest (Abbildung 6) zugeordnet sind. Die Fülle der Lese- und Barcode-Gruppen verfolgen in etwa zu gleichen Teilen, darauf hinweist, dass die Zell-Populationen abgetastet wird werden, so dass bestimmte Arten nicht in Gruppen unverhältnismäßig klein oder groß Barcode enthalten sind. Plotten der aggregierten Abdeckung aller Barcode-Gruppen aus einer einzigen Spezies zeigt eine hohe Abdeckung über das gesamte Genom, mit wenigen oder keinen ausfallende Regionen (Abbildung 7). Die Einheitlichkeit der Abdeckung mit einer Häufigkeitsverteilung der normalisierten Flächendeckungswerte, mit die meisten Werte um den Mittelwert zentriert überprüft werden kann (Abbildung 7, inset).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg"> Abbildung 1 : Herstellung von mikrofluidischen Geräten durch Photolithographie. (A) Master Formen mit einer einzigen Funktion Höhe werden von Spin coating eine Schicht von SU-8 Photoresist auf einem Silizium-Wafer hergestellt. Der Fotolack ist dann eine Photolithographische Maske mit UV-Licht, Vernetzung der exponierten SU-8 gemustert. Schließlich ist in einem Entwickler-Bad Uncrosslinked SU-8 aufgelöst. Die resultierende Form wird verwendet, um PDMS zu werfen, das auf einen Objektträger zu produzieren das komplette mikrofluidischen Gerät verbunden ist. (B) für eine Doppelschicht-Gerät beginnt die Herstellung ähnlich mit Spin Coating und Belichtung Schritte. Diese Schritte werden dann wiederholt, ein zwei-Schicht-Gerät erstellen. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg"> Abbildung 2: Überblick über die SiC-Seq-Workflow. (A) A mikrobielle Federung ist Co floss mit geschmolzenen Agarose in einem Dropmaker Gerät Einzelzellen in mikrogele zu kapseln. (B) die mikrogele unterliegen einer Reihe von Waschungen, die bakterielle genomische DNA zu reinigen. Lytischen Enzyme verdauen die Zellwände von gram-positiven Bakterien und Hefen und Waschmittel solubilisiert der zelltrümmer. Die mikrogele sind neu gekapselt in Tröpfchen für die Tagmentation, Cross-Kontamination zu reduzieren. (C) der mikrofluidischen Fusion vereint digitale PCR Barcode, ein Tagmented Microgel Genom und eine Verstärkung-Mischung mit einer Rate > 1 kHz. Off-Chip SOE-PCR Spleiße einen einzigartigen einzellige Barcode auf das Tagmented Genom und selektiv verstärkt voll Barcode Konstrukte. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg"> Abbildung 3: Mikrofluidische Geräte für Dropmaking und Microgel Re Kapselung. (A) dieses Panel zeigt eine Co-Flow-Dropmaker (25 µm Funktion Höhe). Zellen und flüssige Agarose werden in das Gerät bei gleicher Flussraten bis 25 µm Tröpfchen an einer 25 µm X 25 µm Kreuzung produzieren vorgestellt. Für die digitalen Barcode-Dropmaking der zelleneinströmungsöffnung angeschlossen ist, und eine PCR-Mischung wird in der Agarose-Einlass eingeführt. (B) dieses Panel zeigt ein Microgel Re Kapselung Gerät (25 µm Funktion Höhe). Die mikrogele fließen in einen trichterförmigen Einlass zu erhalten, ihre dicht an dicht bestellen und erhalten ein Volumen von Tagmentation Mischung vor die erneute Einkapselung an einer 25 µm X 30-µm-Kreuzung. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg"> Abbildung 4 : Mikrographen Tröpfchen und mikrogele. (A) dieses Panel zeigt 25 µm mikrogele vor enzymatische Lyse gewaschen. Die Bakterien sind für die Quantifizierung der Kapselung Rate fluoreszent gefärbt. Poisson laden Statistiken zu diktieren, dass die Zellen gekapselte mit einer Rate von 1 in 10 Tropfen oder weniger um die Häufigkeit der Multiple-Kapselung Ereignisse zu minimieren. (B) zeigt dieses Panel eine Fluoreszenz Mikroskopie 25 µm digitalen Barcode Tröpfchen mit einer Nukleinsäure-beize behandelt. Die Tröpfchen mit verstärkten Barcode Fragmente erzeugen eine starke Fluoreszenz-Signal. (C) zeigt dieses Panel mikrogele wieder in 50 µm Tropfen gekapselt. Die schließen-Verpackung von der mikrogele ermöglicht eine Kapselung Preise nähert sich 1 Gel pro Tropfen mit einigen Dubletten. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg"> Abbildung 5 : Mikrofluidischen double Fusion Gerät für einzellige Genom Barcoding. Eine zweistufige Fusion Operation Paare Barcode Tröpfchen mit Tagmented Genome bei hohem Durchsatz. Ein Tropfen des PCR-Mixes zuerst erzeugt und mit einem Barcode-Tröpfchen in der Region erscheinen in gelb mit Salzwasser Elektroden zusammengeführt. Als nächstes ist ein Tröpfchen mit einem Microgel eingeführt und ein zweites Mal in der Region erscheinen in rot zusammengeführt. Öleinführungen ermöglichen präzise Kontrolle über den Abstand zwischen den reinjected Tröpfchen. Der Barcode Reinjektion Kammer und seine Abstandhalter Öl befinden sich auf der kürzeren 25 µm Schicht blau schattiert. Alle anderen Gerätefunktionen gehören zu den dickeren Schicht mit 45 µm Gesamthöhe. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg"> Abbildung 6 : Barcode Gruppe Metriken für ein 10-Zelle synthetische mikrobiellen Gemeinschaft. (A) dieses Panel zeigt die Verteilung des Barcodes Gruppengrößen. Die Anzahl der Gruppen einer bestimmten Größe sinkt exponentiell steigender Größe Gruppe. Eine Mindestgrenze von 7,5 kbit/s pro Gruppe begrenzt die Analyse zu Gruppen mit einer ausreichenden Menge an Informationen und entfernt die PCR mutiert Sequenz "Waisen." (B) dieses Panel zeigt die Verteilung der Barcode Gruppe Reinheiten. Die überwiegende Mehrheit (> 90 %) der Gruppen sind von sehr hoher Reinheit (> 95 %). (C) dieser Bereich zeigt die relative Häufigkeit von 10 Arten berechnet auf Konzernebene Lese- und Barcode. Die 2 zählen Methoden produzieren ähnliche Ergebnisse, darauf hinweist, dass der Barcode Gruppengrößen über Artgrenzen konsistent sind. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg"> Abbildung 7 : Aggregieren genomischen Abdeckung der Bacillus subtilis Barcode Gruppen. Das liest der Barcode Gruppen zuordnen, das Bakterium B. Subtilis (N = 9.398) gebündelt werden und in ihrer Gesamtheit analysiert. Eine kreisförmige Versorgungskarte zeigt die Abdeckung Einheitlichkeit des SiC-Seq lautet, mit keine beobachtbaren Dropout-Regionen. Eine gestrichelte Linie um den Umfang zeigt die durchschnittliche Reichweite (5.55 X). Der Einschub-Histogramm der relative Abdeckung Frequenzen zeigt, dass ein Großteil der Basen fallen in eine Tiefe in der Nähe der Genom-weiten Durchschnitt durch die gestrichelte Linie dargestellt. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Gerät</td>
			<td>1. Layerhöhe (µm)</td>
			<td>1. Schicht Spin Drehzahl (u/min)</td>
			<td>2. Layerhöhe (µm)</td>
			<td>2. Schicht Spin Drehzahl (u/min)</td>
		</tr>
<tr>
<td>Co-Flow dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Re Gel encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Doppelte Fusion</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
</tbody></table>Tabelle 1: Herstellung Geräteparameter mikrofluidischen. Diese Tabelle zeigt eine Auflistung der mikrofluidischen Geräte in der SiC-Seq-Workflow mit ihren erforderlichen Geschwindigkeiten für Fotolack Spin coating (basierend auf den Angaben des Herstellers für SU-8 3025) verwendet.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Label</td>
			<td colspan="5">Sequenz (5' > 3')</td>
		</tr>
<tr>
<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
<tr>
<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
<tr>
<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
<tr>
<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
<tr>
<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
</tbody></table>Tabelle 2: Primer Sequenzen.
Ergänzende Datei 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Bitte klicken Sie hier, um diese Datei herunterladen.</a>
Ergänzende Datei 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Bitte klicken Sie hier, um diese Datei herunterladen.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Eine höchste Durchsatz mikrofluidischen Plattform für einzellige Genom-Sequenzierung

Einzellige Sequenzierung zeigt genotypischen Heterogenität in biologischen Systemen, aber aktuelle Technologien fehlen des Durchsatzes für die Tiefe Profilierung der Zusammensetzung und Funktion notwendig. Hier beschreiben wir einen mikrofluidischen Workflow für die Sequenzierung > 50.000 einzellige Genome aus verschiedenen Zell-Populationen.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Nanyang Technological University

Research

JoVE Journal

Bioengineering

17.5K Aufrufe.  University of California, San Francisco. Einzellige Sequenzierung zeigt genotypischen Heterogenität in biologischen Systemen, aber aktuelle Technologien fehlen des Durchsatzes für die Tiefe Profilierung der Zusammensetzung und Funktion notwendig. Hier beschreiben wir einen mikrofluidischen Workflow für die Sequenzierung > 50.000 einzellige Genome aus verschiedenen Zell-Populationen.

Serie: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

High-throughput Protein Expression Generator mit einem mikrofluidischen Plattform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

Forschung

Biotechnik

Microfluidic Picoliter Bioreactor for Microbial Single-cell Analysis: Fabrication, System Setup, and Operation

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described in detail. The PLBR can be utilized for the analysis of single bacteria and microcolonies to investigate biotechnological and microbiological related questions concerning, e.g.&#160;cell growth, morphology, stress response, and metabolite or protein production on single-cell level. The device features continuous media flow enabling constant environmental conditions for perturbation studies, but in addition allows fast medium changes as well as oscillating conditions to mimic any desired environmental situation. To fabricate the single use devices, a silicon wafer containing sub micrometer sized SU-8 structures served as the replication mold for rapid polydimethylsiloxane casting. Chips were cut, assembled, connected, and set up onto a high resolution and fully automated microscope suited for time-lapse imaging, a powerful tool for spatio-temporal cell analysis. Here, the biotechnological platform organism Corynebacterium glutamicum&#160;was seeded into the PLBR and cell growth and intracellular fluorescence were followed over several hours unraveling time dependent population heterogeneity on single-cell level, not possible with conventional analysis methods such as flow cytometry. Besides insights into device fabrication, furthermore, the preparation of the preculture, loading, trapping of bacteria, and the PLBR cultivation of single cells and colonies is demonstrated. These devices will add a new dimension in microbiological research to analyze time dependent phenomena of single bacteria under tight environmental control. Due to the simple and relatively short fabrication process the technology can be easily adapted at any microfluidics lab and simply tailored towards specific needs.

In this protocol the fabrication, setup and basic operation of a microfluidic picoliter bioreactor (PLBR) for single-cell analysis of prokaryotic microorganisms is introduced. Industrially relevant microorganisms were analyzed as proof of principle allowing insights into growth rate, morphology, and phenotypic heterogeneity over certain time periods, hardly possible with conventional methods.

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described ...

Cell Squeezing as a Robust, Microfluidic Intracellular Delivery Platform

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This technology has shown potential in addressing previously challenging applications; including, delivery to primary immune cells, cell reprogramming, carbon nanotube, and quantum dot delivery. This vector-free microfluidic platform relies on mechanical disruption of the cell membrane to facilitate cytosolic delivery of the target material. Herein, we describe the detailed method of use for these microfluidic devices including, device assembly, cell preparation, and system operation. This delivery approach requires a brief optimization of device type and operating conditions for previously unreported applications. The provided instructions are generalizable to most cell types and delivery materials as this system does not require specialized buffers or chemical modification/conjugation steps. This work also provides recommendations on how to improve device performance and trouble-shoot potential issues related to clogging, low delivery efficiencies, and cell viability.

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This protocol provides detailed steps on how to use the system for a broad range of applications.

Zellzusammendrücken als Robust, Mikrofluidik Intrazelluläre Delivery Platform

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This ...

Microfluidic Platform for Measuring Neutrophil Chemotaxis from Unprocessed Whole Blood

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher neutrophil counts in the blood are usually an indicator of ongoing infections, while low neutrophil counts are a warning sign for higher risks for infections. To accomplish their functions, neutrophils also have to be able to move effectively from the blood where they spend most of their life, into tissues, where infections occur. Consequently, any defects in the ability of neutrophils to migrate can increase the risks for infections, even when neutrophils are present in appropriate numbers in the blood. However, measuring neutrophil migration ability in the clinic is a challenging task, which is time consuming, requires large volume of blood, and expert knowledge. To address these limitations, we designed a robust microfluidic assays for neutrophil migration, which requires a single droplet of unprocessed blood, circumvents the need for neutrophil separation, and is easy to quantify on a simple microscope. In this assay, neutrophils migrate directly from the blood droplet, through small channels, towards the source of chemoattractant. To prevent the granular flow of red blood cells through the same channels, we implemented mechanical filters with right angle turns that selectively block the advance of red blood cells. We validated the assay by comparing neutrophil migration from blood droplets collected from finger prick and venous blood. We also compared these whole blood (WB) sources with neutrophil migration from samples of purified neutrophils and found consistent speed and directionality between the three sources. This microfluidic platform will enable the study of human neutrophil migration in the clinic and the research setting to help advance our understanding of neutrophil functions in health and disease.

This protocol details an assay designed to measure human neutrophil chemotaxis from one droplet of whole blood with robust reproducibility. This approach circumvents the need for neutrophil separation and requires only a few minutes of assay preparation time. The microfluidic chip enables the repeated measure of neutrophil chemotaxis over time in infants or small mammals, where sample volume is limited.

Mikrofluidik-Plattform zur Messung der Neutrophilen-Chemotaxis von Rohboden Vollblut

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher ...

The Multi-organ Chip - A Microfluidic Platform for Long-term Multi-tissue Coculture

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need for new solutions for substance testing. Many drugs that have been removed from the market due to drug-induced liver injury released their toxic potential only after several doses of chronic testing in humans. However, a controlled microenvironment is pivotal for long-term multiple dosing experiments,&#160;as even minor alterations in extracellular conditions may greatly influence the cell physiology. We focused within our research program on the generation of a microengineered bioreactor, which can be dynamically perfused by an on-chip pump and combines at least two culture spaces for multi-organ applications. This circulatory system mimics the in vivo conditions of primary cell cultures better and assures a steadier,&#160;more quantifiable extracellular relay of signals to the cells. 
For demonstration purposes, human liver equivalents, generated by aggregating differentiated HepaRG cells with human hepatic stellate cells in hanging drop plates, were cocultured with human skin punch biopsies for up to 28 days inside the microbioreactor. The use of cell culture inserts enables the skin to be cultured at an air-liquid interface, allowing topical substance exposure. The microbioreactor system is capable of supporting these cocultures at near physiologic fluid flow and volume-to-liquid ratios, ensuring stable and organotypic culture conditions. The possibility of long-term cultures enables the repeated exposure to substances. Furthermore, a vascularization of the microfluidic channel circuit using human dermal microvascular endothelial cells yields a physiologically more relevant vascular model.

Here, we present a protocol to coculture primary cells, tissue models and punch biopsies in a microfluidic multi-organ chip for up to 28 days. Human dermal microvascular endothelial cells, liver aggregates and skin biopsies were successfully combined in a common media circulation.

Die Multi-Organ Chip - Ein Mikrofluidik-Plattform für langfristige Multi-Gewebe Cokultur

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Ein Mikrofluidik-Plattform für Hochdurchsatz-Einzelzell-Isolierung und Kultur

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

Mikrofluidik-Plattform mit Multiplexed elektronische Sensoren für Raumverfolgung von Partikeln

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by their natural environment, root hair morphology and function are difficult to study and often excluded from plant research. In recent years, microfluidic platforms have offered a way to visualize root systems at high resolution without disturbing the roots during transfer to an imaging system. The microfluidic platform presented here builds on previous plant-on-a-chip research by incorporating a two-layer device to confine the Arabidopsis thaliana main root to the same optical plane as the root hairs. This design enables the quantification of root hairs on a cellular and organelle level and also prevents z-axis drifting during the addition of experimental treatments. We describe how to store the devices in a contained and hydrated environment, without the need for fluidic pumps, while maintaining a gnotobiotic environment for the seedling. After the optical imaging experiment, the device may be disassembled and used as a substrate for atomic force or scanning electron microscopy while keeping fine root structures intact.

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

This article demonstrates how to culture Arabidopsis thaliana seedlings in a two-layer microfluidic platform that confines the main root and root hairs to a single optical plane. This platform can be used for real-time optical imaging of fine root morphology as well as for high-resolution imaging by other means.

Bildgebung der Wurzelhaare Morphologie der Arabidopsis Sämlinge in einer zweischichtigen mikrofluidischen Plattform

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by ...

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved useful as a convenient live imaging platform providing capabilities for precise control of experimental conditions in real time. In this article, we demonstrate live imaging of individual worms employing WormSpa, a previously-published custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes. To illustrate the capability, we performed proof-of-principle experiments in which worms were infected in the device with pathogenic bacteria, and the dynamics of expression of immune response genes and egg laying were monitored continuously in individual animals. The simple design and operation of this device make it suitable for users with no previous experience with microfluidic-based experiments. We propose that this approach will be useful for many researchers interested in longitudinal observations of biological processes under well-defined conditions.

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In this article, we demonstrate live imaging of individual worms employing a custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes.

Mikrofluidische Plattform für längs-Imaging in Caenorhabditis elegans

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Ultra-lange lesen Sequenzierung für ganze genomische DNA-Analysen

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...