우리는 유용한 토론 및 의견을 위한 왕 실험실의 구성원 감사. 이 작품은 호우에는 국립 자연 과학 재단의 중국 (NSFC, 보조금 번호 31570001)와 및에 의해 자연 과학 재단의 광 동성 광저우 시 (no. 2016A030313401 및 201707010024 부여) 지원

1. 뇌관 디자인 전략 및 DNA 증폭
<ol><li>DNA 파편의 분자 클로닝을 위한 뇌관 디자인. 뇌관 20 bp 유전자 특정 바인딩 시퀀스 및 인접 한 DNA 분자의 상호 보완적인 겹치는 순서 (예를 들어 표 1 참조)는 20 ~ 25 bp 5'-끝 오버행 시퀀스 구성. 참고: 각 DNA의 후속 어셈블리 조각, 다른 단백질 식 카세트의 결합 그리고 인접 한 중첩 시퀀스의 인식에 따라 모든 최종 식 벡터와의 통합.</li>
	<li>DNA 파편, 발기인, 형광 기자, 대상 유전자와 터미네이터를 포함 하 여 그들의 해당 뇌관으로 표준 PCR 반응에 의해 반 독립적인 단백질 식 카세트의 건설에 필요한 고 높은 증폭 피델 리 티 중 합 효소입니다. 참고: DNA 증폭에 대 한이 연구에 사용 된 서식 파일은 이전 연구15,,2223에서 파생 됩니다. 어 닐 링 온도 확장 시간 PCR 반응의 뇌관과 유전자 종속 있습니다.</li>
</ol>2. DNA 조각 어셈블리 및 단백질 식 카세트의 건설
<ol><li>DNA 전기 이동 법에 의해 1 라운드 PCR 제품의 품질을 검토 하 고 분 광 광도 계에 의해 계량. 1 %agarose 젤 전기 이동 법에 의해 DNA 저하 및 오염 발생 한 여부를 확인 합니다. PCR 제품의 OD260/OD280 1.6과 1.8 사이 이어야 한다.</li>
	<li>다른 DNA 파편을 혼합 (0.05-0.1 pmol 각 단편에 대 한) 5 µ L의 최종 볼륨을 새로운 PCR 튜브에. 참고: 혼합 DNA 분자를 위한 동일한 단백질 식 카세트 함께 한 PCR 튜브에. 그것은 연결 하는 데 필요한 DNA 분자의 증가 수 때문에 DNA 어셈블리의 효율성을 줄일 수 있기 때문에, 함께, 다른 식 카세트에서 DNAs를 혼합 하지 마십시오. 참고: 프로토콜 수 수 일시 중지 여기.</li>
	<li>5 x ISO 재고 버퍼 준비: 500 mM Tris HCl, pH 7.5; 50 mM MgCl2; 1 m m deoxynucleotide (dNTP); 50mm dithiothreitol; 25% 폴 리 에틸렌 글리콜 (PEG) 8000; 그리고 5mm 니코틴아미드 아데닌 디뉴클레오티드 (NAD).</li>
	<li>ISO 재고 버퍼, T5 exonuclease, 고 충실도 DNA 중 합 효소의 62.5 단위, Taq 중 합 효소의 5000 단위 단위의 7.5 x 1 mL 마스터 혼합물 400 µ L 5에서에서 x 2를 만들기 ( 재료의 표참조), 및 소독된 이중 증 류 H2o. 참고: 이것은 이전 연구24,25,의26;에서 적응 이러한 볼륨은 최적화 되어야 합니다.</li>
	<li>튜브 및-20 ° c.에 게 마스터 혼합물 x 2의 aliquot 100 µ L 주의: 빈번한 중지 및 재개 2 x 마스터 혼합물의 낮은 DNA 어셈블리 효율을 발생할 수 있습니다.</li>
	<li>2 x 마스터 혼합물의 15 µ L 5 µ L DNA 혼합물에 추가 하 고 60 분 동안 50 ° C에서 품 어.</li>
</ol>3. 식물에 여러 공상 형광 성 융해 단백질의 공동 표현 위한 벡터의 건설
<ol><li>전체 반 독립적인 단백질 식 카세트는 제품을 사용 하 여 2 차 PCR에 의해 증폭 (0.5-1.0 µ L) 템플릿과 바깥쪽 뇌관 (예를 들어, 1 FP35S 및 식에 대 한 1-RNOS로 1 라운드 등온선 어셈블리 반응에서 카세트 1)입니다.<ol>
<li>50 µ L 반응 볼륨에서 고 충실도 중 합 효소의 사용 1 단위 다음 30 사이클 (94 ° C 30에 대 한 s, 55 ° C 30에 대 한 s, 및 2 분 동안 68 ° C), 뒤에 5 분 동안 68 ° C에서 최종 확장.</li>
	</ol>
</li>
	<li>최종 단백질 식 백본 벡터 pUC18 및 pCAMBIA1300, 4 단위 Sma 를 추가 하 여 단백질 과도 식 및 유전자 변환, 각각, 디자인 되는 선형화 최종 10 µ L 반응 볼륨으로 나 고 1-잠복기 25 ° c.에서 2 시간 20 분 동안 65 ° C에서 배양 하 여 제한 효소 비활성화.</li>
	<li>5 µ L의 최종 반응 볼륨에 단백질 식 카세트 및 선형화 마지막 벡터의 아데닌 DNA 분자를 혼합. 그런 다음 마스터 버퍼와 60 분 50 ° C에서 배양 x 15 µ L 2와 혼합 하 여 2 차 DNA 재결합을 수행 합니다.</li>
	<li>2 차 등온 재결합 반응의 최종 제품을 사용 하 여 유능한 대장균 을 변형 표준 절차27에 따르면 셀 (예: DH5α). 식민지 PCR와 DNA 시퀀싱에 의해 긍정적인 식민지를 다시 확인 합니다. 미니 플라스 미드 추출 키트를 사용 하 여 대장균 에서 긍정적인 플라스 미드를 추출 하 고-80 ° c.에 저장 주의: 장기 저장을 위한 테 버퍼에 녹아 있는 플라스 미드 또는 두 배 증류수 H2O 대장균 변종에서 그들을 유지 하는 것 보다 더 안정.</li>
</ol>4. Biolistic-사격 중재 식물에 여러 공상 형광 성 융해 단백질의 과도 공동 식
<ol><li>사격에 대 한 담배 BY-2 현 탁 액 셀과 애기 청소년 식물을 준비 합니다.<ol>
<li>두 번 주당 130 rpm에서 설정 하는 통에 25 ° C에서 subculturing에 의해 Skoog (MS)와 村 重 매체에서 문화 BY-2 셀. 70 밀리미터 압력가 필터 종이 통해 진공 펌프는의 조각에 경작 수집 30 mL 3 d BY-2 셀 40 mbar 진공 압력을 설정 하 여 필터링 합니다.</li>
		<li>다음 단계를 수행 하는 동안 밖으로 건조에서 세포를 방지 하기 위하여 여러 방울 추가 BY 2 셀 액체 문화 매체의 페 트리 접시에 필터 종이 배치 하기 전에 (다음 단계).</li>
		<li>그것에 새로운 배양 접시 (85 m m x 15 m m) BY-2 셀으로 필터 종이 전송.</li>
		<li>표면 70% (v/v) 에탄올 0.05% 포함 된 vortexing는 혼합물에 의해 애기 thaliana (열 0) 씨앗을 소독 10 분 트윈 20.</li>
		<li>벤치 가기 원심 분리기를 사용 하 여 2를 최대 속도로 씨앗 아래로 회전 s는 상쾌한을 제거 하 고 100% 에탄올과 씨앗 30 미 피 펫 멸 균 후드에 새로운 살 균 필터 종이에 씨앗 밖으로 한 번 세척. 그런 다음, 씨앗을 건조 하 고 ½ MS 한 접시에 그들을 확산.</li>
		<li>다음 설정 사용 하 여 식물 성장 챔버로 그들을 전송 하기 전에 48 시간 동안 4 ° C에서 접시를 저장: 16 h 120-150 µ m m-2 s-1 강도, 22 ° C. 8 h 어두운 빛
</li>
		<li>폭격의 효율성을 증가 하는 새로운 ½ MS 중간 접시의 중앙에 30mm 직경 원형으로 7-하루 오래 된 샘플 식물을 전송 합니다. 주의: 중복 식물 전송 하 고 새로운 ½ MS 접시에 그들을 배치 하지 마십시오.</li>
		<li>식물의 수 분을 유지 하 고 다음 단계를 수행 하는 동안 밖으로 식물 건조 방지를 조직 표면에 ½ MS 액체 매체의 몇 방울을 추가 합니다.</li>
	</ol>
</li>
	<li>플라스 미드 DNA와 금 입자 코트.<ol>
<li>와 동 골드 microcarrier 솔루션, 철저 하 게 3 분에 대 한 새로운 1.5 mL 튜브 준비.</li>
		<li>튜브와 소용돌이에 다음과 같은 솔루션을 순차적으로 추가: 25 µ L (1.5 m g) 골드 입자, 소용돌이 10 s; 25.46 mg/L spermidine, 소용돌이 10 s;의 10 µ L 5 1µg / µ L 플라스 미드 DNA의 µ L, 소용돌이 3 분; 25 277.5 mg/L CaCl2 솔루션의 µ L, 소용돌이 1 분. 주의:이 단계 동안 vortexing를 유지.</li>
		<li>펠 릿을 방해 하지 않고 5 s와 신중 하 게는 상쾌한 밖으로 피 펫에 대 한 최대 속도 벤치 가기 원심 분리기를 사용 하는 골드 microcarriers 아래로 회전 합니다. 절대 에타 놀의 200 µ L로 세척 하 고 다시 일시 중단 소용돌이 의해 펠 릿 5-10 s. 스핀 다운 5 s와 제거는 에탄올에 대 한 최대 속도.</li>
		<li>절대 에타 놀 및 aliquot 6 µ L 입자 현 탁 액 3 macrocarriers의 중간에 18 µ L에 다시 금 입자를 일시 중단 합니다. 그들이 건조 한 공기 보자.</li>
	</ol>
</li>
	<li>입자 사격을 통해 식물으로 DNA를 전송.<ol>
<li>다음으로 입자 배달 시스템 설정: 1100 psi, 28 mm Hg 진공, 1 cm 간격 거리 및 9 cm 입자 비행 거리.</li>
		<li>세 가지 다른 위치에서 세 번에 대 한 한 중간 접시에 셀/식물을도 배 하 고 사격 직후 어둠의 셀/식물을 유지. 주의: 시스템에 고압 가스 및 고속 입자의 협회 때문에 입자 배달 시스템을 작동할 때 안전 안경 착용.</li>
	</ol>
</li>
	<li>형광 신호 관찰 6 ~ 72 시간에 대 한 식물 성장 챔버에 어둠 속에서 포 격하 셀/식물을 유지. 24 h 어두운와 22 ° C에 식물 성장 챔버를 설정 주의: 식 효율과 형광 신호 강도 발기인, 유전자 및 식물/조직-의존 합니다.</li>
</ol>5. 공동 Agrobacterium에의해 여러 공상 형광 단백질을 표현 하는 안정적인 유전자 변형 애기의 생성-변화를 중재.
<ol><li>Thaw Agrobacterium 유능한 세포 (PMP90) 얼음에 30 분 동안 대기 후 2 µ L 이진 벡터 (100-200 ng) (준비 위) 유능한 세포에 추가. 10 분 동안 얼음에 혼합물을 앉아.</li>
	<li>미리 냉장된 0.1 cm electroporation 베트로 혼합물을 전송 합니다. 멧 electroporation 시스템에 삽입 하 고 다음 설정으로 electroporation 수행: 1.6 k v, 600 옴, 25 µ F.</li>
	<li>electroporation 직후는 베트에 SOC 액체 매체의 1 mL을 추가 하 고 새로운 1.5 mL 튜브에 세포를 플라스틱 120 분 200 rpm에서 수평 궤도 통에 28 ° C에서 품 어.</li>
	<li>5 분 동안 실 온에서 2,348 x g에서 세포를 원심, 삭제는 상쾌한의 대부분, 부드럽게 다시 피 펫 팁 일지도 셀을 일시 중단, 50 mg/L Hygromycin B를 포함 하는 파운드 접시에 그들을 확산 그리고 28 ° C에서 2-3 일 동안 품 어.</li>
	<li>애기 thaliana Col 0 식물에서 Agrobacterium, 이전에 설명한 대로 꽃 딥28 메서드에서 여러 단백질 식 카세트와 통합 이진 벡터 pCAMBIA1300 포함 된 변환 안정적인 유전자 변형 식물을 생성 합니다.</li>
	<li>0.05%를 포함 하는 70% (v/v) 에탄올과 혼합 하 여 유전자 변형 애기 씨앗의 표면 소독 트윈 20. 벤치 가기 원심 분리기를 사용 하 여 2를 최대 속도로 씨앗 아래로 10 분 회전을 위해 소용돌이 s, 상쾌한, 제거 하 고 씻어 30 한 번 100% 에탄올과 씨앗 s.</li>
	<li>살 균 후드에서 무 균 필터 종이에 씨앗 밖으로 플라스틱. 그 후, 건조 한 공기 하 고 긍정적인 progenies 심사 Hygromycin B를 포함 하는 ½ MS 한 접시에 그들을 확산.</li>
	<li>2 일 동안 4 ° C에서 번호판을 품 어. 그런 다음, 전송 그들 문화와 식물 성장 챔버에 7 일.</li>
	<li>형광 현미경 형광 신호를 확인 하 여 7 일 오래 된 생존 청소년 식물을 선택한 다음 추가 homozygous 식물의 심사에 대 한 토양에 식물을 전송 합니다.</li>
</ol>6. 제약 치료
<ol><li>약 제 치료에 대 한 세포 또는 식물 부 화 하기 전에 그것의 적절 한 작동 농도 액체 MS 매체에서 각 약물을 희석.<ol>
<li>Wortmannin 치료: DMSO에 wortmannin 분말을 용 해 하 여 1 m m wortmannin의 재고 솔루션을 준비 하 고-20 ° c.에 주식을 저장 16.5 µ M wortmammin를 포함 하는 액체 MS 매체로 청소년 식물 또는 식물 세포를 전송 및 이미징 하기 전에 30-45 분 동안 품 어.</li>
		<li>Brefeldin A (BFA) 치료: DMSO에 BFA 분말을 용 해 하 여 1mm BFA의 재고 솔루션을 준비 하 고-20 ° c.에 주식을 저장 식물 세포 또는 식물 청소년 10 µ g/mL BFA 이미징 하기 전에 30-45 분을 포함 하는 액체 MS 매체에 전송.</li>
	</ol>
</li>
</ol>7. confocal 현미경 이미징 및 단백질 Subcellular 공동 지역화 분석
<ol><li>젊은 식물 또는 기존의 유리 슬라이드에 현 탁 액 셀 전송 및 부드럽게 표준 confocal 레이저 스캐닝 현미경 검사 법에 의해 이미징에 대 한 상단 커버 슬라이드를 입었다. 다음 설정을 사용 하 여: 63 X 물 목표 (한다 1.4), 0 배경, 700 증가, 0.168 mm 픽셀 크기, 및 광 전 증폭 관 관 탐지기. 485에서 단백질 GFP 태그 자극 nm 525에서 형광을 검출 하 고 nm. 514에 자극 RFP 태그 단백질에 대 한 nm 575에 감지 nm.</li>
	<li>피어슨 Spearman 상관 (PSC) 공동 지역화는 앞에서 설명한8플러그인으로 이미지 J 소프트웨어 (https://imagej.nih.gov/ij/)를 사용 하 여 형광 신호의 공동 지역화 비율을 계산 합니다. 피어슨 상관 계수 또는 Spearman의 순위 상관 관계 계수 (그림 4) 결과에 표시 됩니다. 생산된 r 값 1-1에서 될 것입니다. 반면 + 1과-1 완전 긍정적이 고 부정적인 상관 관계, 각각, 2 개의 신호의 0, 2 개의 신호 감지 상관 관계가 보여줍니다.</li>
</ol>

<ol>
	<li>Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+green+fluorescent+protein.">The green fluorescent protein.</a> Annu Rev Biochem. 67, 509-544 (1998).</li><li>Tsien, R. Y., Miyawaki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+the+machinery+of+live+cells.">Seeing the machinery of live cells.</a> Science. 280 (5371), 1954-1955 (1998).</li><li>Wang, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+Plant+Cells+in+a+Brand+New+Way.">Visualizing Plant Cells in a Brand New Way.</a> Mol Plant. 9 (5), 633-635 (2016).</li><li>Zhang, J., Campbell, R. E., Ting, A. Y., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+new+fluorescent+probes+for+cell+biology.">Creating new fluorescent probes for cell biology.</a> Nat Rev Mol Cell Biol. 3 (12), 906-918 (2002).</li><li>Lippincott-Schwartz, J., Snapp, E., Kenworthy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+protein+dynamics+in+living+cells.">Studying protein dynamics in living cells.</a> Nat Rev Mol Cell Biol. 2 (6), 444-456 (2001).</li><li>Tse, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multivesicular+bodies+as+prevacuolar+compartments+in+Nicotiana+tabacum+BY-2+cells.">Identification of multivesicular bodies as prevacuolar compartments in Nicotiana tabacum BY-2 cells.</a> Plant Cell. 16 (3), 672-693 (2004).</li><li>Wang, H., Zhuang, X., Cai, Y., Cheung, A. Y., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Apical+F-actin-regulated+exocytic+targeting+of+NtPPME1+is+essential+for+construction+and+rigidity+of+the+pollen+tube+cell+wall.">Apical F-actin-regulated exocytic targeting of NtPPME1 is essential for construction and rigidity of the pollen tube cell wall.</a> Plant J. 76 (3), 367-379 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Distinct+Pathway+for+Polar+Exocytosis+in+Plant+Cell+Wall+Formation.">A Distinct Pathway for Polar Exocytosis in Plant Cell Wall Formation.</a> Plant Physiol. 172 (2), 1003-1018 (2016).</li><li>Canto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+Expression+Systems+in+Plants:+Potentialities+and+Constraints.">Transient Expression Systems in Plants: Potentialities and Constraints.</a> Adv Exp Med Biol. 896, 287-301 (2016).</li><li>Ishida, Y., Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+maize.">Agrobacterium-mediated transformation of maize.</a> Nat Protoc. 2 (7), 1614-1621 (2007).</li><li>Li, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+agrobacterium-mediated+transformation+in+soybean.">Optimization of agrobacterium-mediated transformation in soybean.</a> Front Plant Sci. 8, 246 (2017).</li><li>Manavella, P. A., Chan, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+transformation+of+sunflower+leaf+discs+via+an+Agrobacterium-mediated+method:+applications+for+gene+expression+and+silencing+studies.">Transient transformation of sunflower leaf discs via an Agrobacterium-mediated method: applications for gene expression and silencing studies.</a> Nat Protoc. 4 (11), 1699-1707 (2009).</li><li>Martin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+in+Nicotiana+benthamiana+fluorescent+marker+lines+provides+enhanced+definition+of+protein+localization,+movement+and+interactions+in+planta.">Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta.</a> Plant J. 59 (1), 150-162 (2009).</li><li>Miao, Y., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+of+fluorescent+fusion+proteins+in+protoplasts+of+suspension+cultured+cells.">Transient expression of fluorescent fusion proteins in protoplasts of suspension cultured cells.</a> Nat Protoc. 2 (10), 2348-2353 (2007).</li><li>Wang, H., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+and+analysis+of+fluorescent+reporter+proteins+in+plant+pollen+tubes.">Transient expression and analysis of fluorescent reporter proteins in plant pollen tubes.</a> Nat Protoc. 6 (4), 419-426 (2011).</li><li>Yoo, S. D., Cho, Y. H., Sheen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+mesophyll+protoplasts:+A+versatile+cell+system+for+transient+gene+expression+analysis.">Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis.</a> Nat Protoc. 2 (7), 1565-1572 (2007).</li><li>Candat, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+determination+of+organelle+targeting-peptide+cleavage+sites+using+transient+expression+of+green+fluorescent+protein+translational+fusions.">Experimental determination of organelle targeting-peptide cleavage sites using transient expression of green fluorescent protein translational fusions.</a> Anal Biochem. 434 (1), 44-51 (2013).</li><li>Giepmans, B. N., Adams, S. R., Ellisman, M. H., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fluorescent+toolbox+for+assessing+protein+location+and+function.">The fluorescent toolbox for assessing protein location and function.</a> Science. 312 (5771), 217-224 (2006).</li><li>Binder, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modular+plasmid+assembly+kit+for+multigene+expression,+gene+silencing+and+silencing+rescue+in+plants.">A modular plasmid assembly kit for multigene expression, gene silencing and silencing rescue in plants.</a> PLoS One. 9 (2), e88218 (2014).</li><li>Engler, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+golden+gate+modular+cloning+toolbox+for+plants.">A golden gate modular cloning toolbox for plants.</a> ACS Synth Biol. 3 (11), 839-843 (2014).</li><li>Forner, J., Binder, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+red+fluorescent+protein+eqFP611:+Application+in+subcellular+localization+studies+in+higher+plants.">The red fluorescent protein eqFP611: Application in subcellular localization studies in higher plants.</a> BMC Plant Biol. 7, 28 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vacuolar+sorting+receptors+(VSRs)+and+secretory+carrier+membrane+proteins+(SCAMPs)+are+essential+for+pollen+tube+growth.">Vacuolar sorting receptors (VSRs) and secretory carrier membrane proteins (SCAMPs) are essential for pollen tube growth.</a> Plant J. 61 (5), 826-838 (2010).</li><li>Wang, H., Zhuang, X. H., Hillmer, S., Robinson, D. G., Jiang, L. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vacuolar+sorting+receptor+(VSR)+proteins+reach+the+plasma+membrane+in+germinating+pollen+tubes.">Vacuolar sorting receptor (VSR) proteins reach the plasma membrane in germinating pollen tubes.</a> Mol Plant. 4 (5), 845-853 (2011).</li><li>Chen, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+in+vitro+splicing+of+coding+sequences+from+genomic+DNA+by+isothermal+recombination+reaction-based+PCR.">Rapid in vitro splicing of coding sequences from genomic DNA by isothermal recombination reaction-based PCR.</a> Biotechnology &amp; Biotechnological Equipment. 30 (5), 864-868 (2016).</li><li>Zhu, Q. L., Yang, Z. F., Zhang, Q. Y., Chen, L. T., Liu, Y. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+multi-type+plasmid+modifications+based+on+isothermal+in+vitro+recombination.">Robust multi-type plasmid modifications based on isothermal in vitro recombination.</a> Gene. 548 (1), 39-42 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+construction+of+insulated+genetic+circuits+via+synthetic+sequence-guided+isothermal+assembly.">Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly.</a> Nucleic Acids Res. 42 (1), 681-689 (2014).</li><li>Siguret, V., Ribba, A. S., Cherel, G., Meyer, D., Pietu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+plasmid+size+on+transformation+efficiency+by+electroporation+of+Escherichia+coli+DH5+alpha.">Effect of plasmid size on transformation efficiency by electroporation of Escherichia coli DH5 alpha.</a> Biotechniques. 16 (3), 422-426 (1994).</li><li>Zhang, X., Henriques, R., Lin, S. S., Niu, Q. W., Chua, N. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Arabidopsis+thaliana+using+the+floral+dip+method.">Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method.</a> Nat Protoc. 1 (2), 641-646 (2006).</li><li>Lam, S. K., Cai, Y., Hillmer, S., Robinson, D. G., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCAMPs+highlight+the+developing+cell+plate+during+cytokinesis+in+tobacco+BY-2+cells.">SCAMPs highlight the developing cell plate during cytokinesis in tobacco BY-2 cells.</a> Plant Physiol. 147 (4), 1637-1645 (2008).</li><li>Lam, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+SCAMP1+defines+clathrin-coated,+trans-golgi-located+tubular-vesicular+structures+as+an+early+endosome+in+tobacco+BY-2+cells.">Rice SCAMP1 defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells.</a> Plant Cell. 19 (1), 296-319 (2007).</li><li>Jiang, L., Rogers, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integral+membrane+protein+sorting+to+vacuoles+in+plant+cells:+evidence+for+two+pathways.">Integral membrane protein sorting to vacuoles in plant cells: evidence for two pathways.</a> J Cell Biol. 143 (5), 1183-1199 (1998).</li><li>Fernandez-Abalos, J. M., Fox, H., Pitt, C., Wells, B., Doonan, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant-adapted+green+fluorescent+protein+is+a+versatile+vital+reporter+for+gene+expression,+protein+localization+and+mitosis+in+the+filamentous+fungus,+Aspergillus+nidulans.">Plant-adapted green fluorescent protein is a versatile vital reporter for gene expression, protein localization and mitosis in the filamentous fungus, Aspergillus nidulans.</a> Mol Microbiol. 27 (1), 121-130 (1998).</li><li>Bruening, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+gene+silencing+regularized.">Plant gene silencing regularized.</a> Proc Natl Acad Sci U S A. 95 (23), 13349-13351 (1998).</li><li>Wassenegger, M., Pelissier, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+for+RNA-mediated+gene+silencing+in+higher+plants.">A model for RNA-mediated gene silencing in higher plants.</a> Plant Mol Biol. 37 (2), 349-362 (1998).</li><li>Dehio, C., Schell, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+plant+genetic+loci+involved+in+a+posttranscriptional+mechanism+for+meiotically+reversible+transgene+silencing.">Identification of plant genetic loci involved in a posttranscriptional mechanism for meiotically reversible transgene silencing.</a> Proc Natl Acad Sci U S A. 91 (12), 5538-5542 (1994).</li><li>Zhong, G., Zhu, Q., Li, Y., Liu, Y., Wang, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Once+for+all:+A+novel+robust+system+for+co-expression+of+multiple+chimeric+fluorescent+fusion+proteins+in+plants.">Once for all: A novel robust system for co-expression of multiple chimeric fluorescent fusion proteins in plants.</a> Front Plant Sci. 8, 1071 (2017).</li><li>Li, X. T., Xie, Y. Y., Zhu, Q. L., Liu, Y. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+in+genes+and+cis-regulatory+regions+improves+qualitative+and+quantitative+traits+in+crops.">Targeted genome editing in genes and cis-regulatory regions improves qualitative and quantitative traits in crops.</a> Molecular Plant. 10 (11), 1368-1370 (2017).</li><li>Zhu, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+&amp;#34;purple+endosperm+rice''+by+engineering+anthocyanin+biosynthesis+in+the+endosperm+with+a+high-efficiency+transgene+stacking+system.">Development of &amp;#34;purple endosperm rice'' by engineering anthocyanin biosynthesis in the endosperm with a high-efficiency transgene stacking system.</a> Molecular Plant. 10 (7), 918-929 (2017).</li><li>Tang, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-step+formation,+evolution,+and+functionalization+of+new+cytoplasmic+male+sterility+genes+in+the+plant+mitochondrial+genomes.">Multi-step formation, evolution, and functionalization of new cytoplasmic male sterility genes in the plant mitochondrial genomes.</a> Cell Research. 27 (1), 130-146 (2017).</li></ol>

저자는 공개 없다.

여기 우리 튼튼하게 공동 식물에 공상 형광 성 융해 단백질을 표현 하는 새로운 방법 설명 했다. 그것은 과도 식 및 유전자 변환 사용할 수 있으며 현재 형광 단백질 기반 바이오 이미징, 분자, 및 생 화 확 적인 응용 프로그램 및 기술9,10,13와 호환 . 또한, 그것은 단백질 공동 식에 대 한 몇 가지 개별 식 플라스 미드를 사용 하는 기존 방법의 어려움을 극복 한다. 대조적으로, 그것은 여러 단백질 식 카세트와 그들의 자신의 개인 발기인, 형광 태그, 대상 단백질, 종결자를 포함 하는 단일 식 벡터를 사용 합니다. 또한, 단백질 식 카세트 관리할 수 있습니다 하지 독립적으로 특정 발기인의 사용 대상 단백질으로 형광 단백질의 N-또는 C 터미널 공상 융합 등 다양 한 식 요구 사항에 맞게. 따라서, 단백질 식 카세트 기능 같은 플라스 미드에 반 독립적으로 작동 하는 기본적인 "레고" 요소. 또한, 그것은 또한 어떤 유전자를 편집, 보충, 높게 다재 다능 한 시스템 그리고 모든 어셈블리 효소 소화 및 결 찰의 추가 과정 없이 1 단계 등온 재결합 반응에 의해 쉽게 달성 될 수 있다. 우리는 T5 exonuclease, Phusion DNA 중 합 효소, 및 Taq 중 합 효소의 다양 한 농도 테스트 하 여 2.4, 단계에서 설명한 대로 이전 연구에서 등온선 재결합 반응의 효율성을 최적화 했습니다. 또한, 각 DNA의 농도 단계 등온 재결합 반응 최대 결 찰 효율 0.05 0.1 pmol 사이 수 제안에 대 한 파편.
그는 강한 생 발기인 및 연속 발기인, 유비퀴틴-10 모터 (UBQ10) 같은 대체 및 유전자의 추가 사본을 소개 transgene의-식 세포 기능 연구를 격렬 하 게 사용된 접근 이다 하 고 기본 작업 메커니즘 셀15,32에. 그러나, 때로는 유전자 발현의 예기치 않은 다운 레 귤 레이 션 및 강력한 억제 뿐만33,34를 찾아냈다. 이러한 상황33,35에서 100 %2에서 범위를 입을 예측할 수 없는 유전자의 백분율입니다. 또한, 동시에, 여러 가지 유전자의 표정에 일이 더 높은 기회가 있다 유전자 침묵의 DNA, 높은 사본 그리고 유전자 transcriptional 레벨9,33,24의 상당한 증가의 변화 ,35. 여러 퓨전 단백질 공동 식 시스템에는 강력한 침묵 하는 유전자의 발생을 최소화 하기 위해 다른 활성 발기인 공동 여러 퓨전 단백질을 표현 하는 때 다른 단백질 식 카세트를 선택 했습니다. 또한, 우리는 다른 식 카세트에 대 한 동일한 발기인을 사용 하 여 지속적으로 피 했다. 또한,이 프로토콜의 또 다른 잠재적인 한계 원스텝 DNA 등온선 재조합 단백질 식 카세트 공동 식의 증가 숫자에 의해 발생의 감소 효율성입니다. 또한, 최종 식 플라스 미드에서 주로 호스팅될 수 있는 식 카세트 수 백본 플라스 미드24,,2535replicon 의존 합니다.
함께 찍은, 우리는 공동 식물36에서 편리 하 게 여러 공상 형광 성 융해 단백질을 표현 하기 위한 강력한 시스템을 개발 했습니다. 그것은 고전적인 방법의 한계를 극복 하 고 영광 패션에서 DNA interlinkage 및 플라스 미드 건설에 대 한 최적화 된 단계 DNA 어셈블리 반응을 이용 한다. 이 기술 사전 AtVSR2에 의해 검증 된와 공장에서 AtSCAMP4 공동 식 통해 세포 모두 과도 식과 유전자 변환. 따라서, 그것은 식물에 공상 형광 성 융해 단백질의 공동 식으로 과학적 발견의 다양 한 측면에 대 한 설득력과 소설 메서드를 보여 줍니다. 또한, 개념 및 단일 식 벡터를 통해 여러 공상 형광 성 융해 단백질의 공동 식의 원리는 CRISPR-Cas9, RNAi, 단백질-식 기술 연구 기능을 완벽 하 게 호환 및 식물37,,3839에서 여러 유전자의 상호 작용

공상 형광 성 융해 단백질 세포 역학 및 subcellular 지 방화를 연구 하 고 그들의 생리 적 기능 및 작동 메커니즘1,2, 양지 유용한 도구로 간주 되고있다 3 , 4. 공동 익스프레스 spatiotemporal 근거, 분포, 그리고 셀4 endomembrane 시스템 내에서 복수 위해 문제의 단백질으로 잘 알려진 세포 기관이 기자 단백질에 특히 유리 하다 , 5 , 6 , 7 , 8.
공상 형광 성 융해 단백질은 과도 식 통해 식물 및 안정적인 유전자 변환, 그들의 각각 장점과 제한9,,1011에 표현할 수 있습니다. 단백질의 과도 식 biolistic 폭격-, 폴 리 에틸렌 글리콜 (PEG)를 포함 하는 편리한 접근 이다-, 또는 protoplasts 및 AgrobacteriumDNA 과도 식 electroporation 중재-중재 하는 잎에 침투 그대로 식물 세포, 그림 1A, B12,13,14,,1516와 같이. 그러나, 단일 식물 세포에서 여러 공상 형광 성 융해 단백질의 공동 식 여러 독립 식 플라스 미드의 혼합물을 요구 한다. 따라서, 여러 개의 플라스 미드 단백질 공동 식 식물에 대 한 고용의 단점은 동시에 동일한 셀 단일 플라스 미드에 비해 입력 몇 plasmids의 극적으로 감소 된 우연 저수준 공동 식 그리고 각 유형의 셀17,18에 전송 되는 플라스 미드의 미친 듯이 임의의 금액으로 인 한 단백질 식 레벨의 변형입니다. 또한, 그것은 기술적으로 단일 Agrobacterium 단백질 공동 식9,,1011에 대 한 여러 독립 식 플라스 미드를 도전. 따라서, Agrobacterium-담배의 침투에 의해 과도 식 나뭇잎 중재 단백질은 그림 1B와 같이 한 번에 한 플라스 미드를 표현. 반면, 형광 성 융해 단백질을 표현 하는 유전자 변형 식물의 세대 보통 Agrobacterium 이진 변환 벡터를 전달 함으로써 이루어집니다. 그러나, 유전자 이동 및 식물 게놈으로 삽입 중재 이진 벡터는 단일 형광 성 융해 단백질 (그림 1B)9,,1012표현만 합니다. 여러 공상 형광 단백질을 동시에 표현 하는 유전자 변형 식물 생성 여러 라운드를 유전 교차점 및 심사, 공동 표현 될 유전자의 숫자에 따라 년 개월에서 걸릴 수 있습니다 필요 합니다.
식물에 있는 여러 단백질의 공동 식에 대 한 단일 식 벡터 이전으로 보고 되었습니다 고용 연구19,,2021. 그러나, 효소 소화의 여러 라운드 및 DNA 분자 및 백본 벡터 DNA 결 찰 일반적으로에 단백질 공동 식 또는 오버 식에 대 한 최종 플라스 미드의 생성. 여기, 우리는 공동 식물에 여러 공상 형광 단백질을 표현 하는 새롭고 강력한 방법을 개발 했습니다. 모두 과도 식에 대 한 식물에 여러 단백질 공동 식와 영광 패션에 안정적인 변화는 매우 효율적이 고 편리한 방법 이다. 그것은 단백질 공동 식에 대 한 여러 기능적으로 독립적인 단백질 식 카세트를 포함 함으로써 기존 방법의 단점을 극복 하는 하나의 벡터를 사용 합니다. 또한, 그것은 매우 다양 한 시스템은 dna에서 조작 및 어셈블리 DNA 소화 및 결 찰의 추가 단계 없이 최적화 된 간단한 원스텝 반응에 의해 달성 된다. 작동 원리는 그림 2에 나와 있습니다. 또한, 그것은 공상 형광 성 융해 단백질을 기반으로 하는 현재 세포, 분자, 및 생 화 확 적인 접근을 완벽 하 게 호환입니다.

<table>
	<tbody>
		<tr>
			<td>KOD-FX Polymerase</td>
			<td>TOYOBO</td>
			<td>KFX-101</td>
			<td></td>
		</tr>
		<tr>
			<td>Sma I</td>
			<td>NEB</td>
			<td>R0141L/S/V</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>BBI</td>
			<td>A600194-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>BBI</td>
			<td>A601336-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>NEB</td>
			<td>#N0447V</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>BBI</td>
			<td>C4H10O2S2</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 8000</td>
			<td>BBI</td>
			<td>A100159-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NAD</td>
			<td>BBI</td>
			<td>A600641-0001</td>
			<td></td>
		</tr>
		<tr>
			<td>T5 exonuclease</td>
			<td>Epicentre</td>
			<td>T5E4111K</td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity DNA polymerase</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>NEB</td>
			<td>B9022S</td>
			<td></td>
		</tr>
		<tr>
			<td>Murashige and Skoog Basal Salt Mixture(MS)</td>
			<td>Sigma</td>
			<td>M5524</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>BBI</td>
			<td>A500737-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>BBI</td>
			<td>A600560-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>BBI</td>
			<td>A505255-0250</td>
			<td></td>
		</tr>
		<tr>
			<td>Spermidine</td>
			<td>BBI</td>
			<td>A614270-0001</td>
			<td></td>
		</tr>
		<tr>
			<td>Gold microcarrier particles</td>
			<td>Bio-Rad</td>
			<td>165-2263</td>
			<td>1.0 &#181;m</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>BBI</td>
			<td>CD0050-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Macrocarriers</td>
			<td>Bio-Rad</td>
			<td>165-2335</td>
			<td></td>
		</tr>
		<tr>
			<td>Rupture disk</td>
			<td>Bio-Rad</td>
			<td>165-2329</td>
			<td></td>
		</tr>
		<tr>
			<td>Stopping screen</td>
			<td>Bio-Rad</td>
			<td>165-2336</td>
			<td></td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>OXOID</td>
			<td>LP0042</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast Extract</td>
			<td>OXOID</td>
			<td>LP0021</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>BBI</td>
			<td>A610476-0001</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>BBI</td>
			<td>A610440-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>BBI</td>
			<td>A600219-0001</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin B</td>
			<td>Genview</td>
			<td>AH169-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>Wortmannin</td>
			<td>Sigma</td>
			<td>F9128</td>
			<td></td>
		</tr>
		<tr>
			<td>Brefeldin A</td>
			<td>Sigma</td>
			<td>SML0975-5MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Dimethylsulphoxide (DMSO)</td>
			<td>BBI</td>
			<td>A600163-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>T100 Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Growth chamber</td>
			<td>Panasonic</td>
			<td>MLR-352H-PC</td>
			<td></td>
		</tr>
		<tr>
			<td>PSD-1000/He particle delivery system</td>
			<td>Bio-Rad</td>
			<td>165-2257</td>
			<td></td>
		</tr>
		<tr>
			<td>Gene Pulser</td>
			<td>Bio-Rad</td>
			<td>1652660</td>
			<td></td>
		</tr>
		<tr>
			<td>Cuvette</td>
			<td>Bio-Rad</td>
			<td>1652083</td>
			<td></td>
		</tr>
		<tr>
			<td>Benchtop centrifuge</td>
			<td>Eppendorf</td>
			<td>5427000097</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal microscope</td>
			<td>Zeiss</td>
			<td></td>
			<td>LSM 7 DUO (780&#38;7Live)</td>
		</tr>
		<tr>
			<td>NanoDrop 2000/2000c Spectrophotometers</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>EPS-300 Power Supply</td>
			<td>Tanon</td>
			<td>EPS 300</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescent microscope</td>
			<td>Mshot</td>
			<td>MF30</td>
			<td></td>
		</tr>
		<tr>
			<td>Agrose</td>
			<td>BBI</td>
			<td>A600234</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>BBI</td>
			<td>A100339</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylene Diamine Tetraacetie Acid</td>
			<td>BBI</td>
			<td>B300599</td>
			<td></td>
		</tr>
	</tbody>
</table>

co-expression of multiple chimeric fluorescent fusion proteins in an efficient way in plants

단백질의 subcellular spatiotemporal localization(s)에 대 한 정보는 세포에서의 생리 기능을 이해 하는 중요 한. 형광 단백질 및 형광 성 융해 단백질의 생성 격렬 하 게 사용 되었습니다 효과적인 도구로 직접 단백질 지 방화 및 셀에서 역학을 시각화. 특히 관심의 단백질와 공동 식 후 잘 알려진 세포 기관이 마커를 비교 유용 합니다. 그럼에도 불구 하 고, 단백질 공동 식 식물에 대 한 고전적인 접근 일반적으로 여러 개의 독립 식 플라스 미드를 포함 하 고 따라서 낮은 공동 식 효율, 식 수준 변화, 그리고 높은 시간을 포함 하는 단점을가지고 유전자 교차 및 심사 비용입니다. 이 연구에서 우리는 식물에 여러 공상 형광 단백질의 공동 식에 대 한 강력 하 고 새로운 방법을 설명합니다. 그것은 여러 개의 반 독립적인 표현 카세트의 구성 된 단일 식 벡터를 사용 하 여 기존 방법의 한계를 극복 했다. 각 단백질 식 카세트 자체 기능 단백질 식 요소를 포함 하 고 따라서 그것은 유연 하 게 다양 한 식 수요에 맞게 조정할 수 있다. 또한, 그것은 간단 하 고 편리 하 게 수행 하는 어셈블리 및 조작 DNA의 추가 소화 및 결 찰 단계 없이 최적화 된 원스텝 반응을 사용 하 여 식 플라스 미드에 조각. 또한, 현재 파생 된 형광 단백질 바이오 이미징 기술 및 응용 프로그램, 무서 워, BiFC 등 완벽 하 게 호환 됩니다. 방법의 유효성 검사,으로 우리 붙일 융합 공동 급행 vacuolar 정렬 수용 체와 분 비 캐리어 막 단백질이 새로운 시스템을 채택. 결과 그들의 관점의 subcellular 지 방화는 과도 식과 유전자 변형 식물에 의해 이전 연구에서와 같이 보여.

식물에 여러 공상 형광 성 융해 단백질의 공동 식에 대 한 강력 하 고 매우 능률적인 방법을 개발 했습니다. 그것은 종래의의 장벽을 통해 휴식 같이 그림 1A, B를 통해 접근 단백질 공동 식에 여러 개의 분리 된 플라스 미드를 사용할 과도 식 또는 안정적인 유전자 변환. 이 새로운 방법에서는, 우리는 단백질 공동 식 한 번에 (그림 1 cD)를 달성 하기 위해 여러 단백질 식 카세트의 구성 된 단일 식 벡터를 생성 합니다. 고 단백질 식 카세트 기능 단백질 표정에 대 한 그것의 자신의 필수 DNA 요소와 반 independently. 따라서, 각 단백질 식 카세트 수 사용자 지정할 수 없는 독립적으로 단백질 표정에 대 한 다양 한 요구에 따라. 최종 단백질 공동 식 벡터에 관해서는 그것에 단백질 식 카세트 수정할 수 있는 기본 "레고" 요소 다시 생성 기능. 그리고 다시 편리 하 게 배치. 또한, 공상 형광 성 융해 단백질의 공동 식에 대 한 최종 목적지 벡터와 DNA 분자 어셈블리, 여러 단백질 식 카세트의 결합 및 DNA 파편의 통합에 대 한 대체 전략은 단순히 달성 통해 최적화 된 등온선 생체 외에서 재결합 반응을 추가 추가 단계 없이 DNA 소화와 interlinkage의. 등온선 생체 외에서 재결합 반응의 작동 원리는 그림 2에 나와 있습니다. 여러 개의 DNA 분자 (예를 들어, 세 가지 대표 DNA 파편 1-3에 표시 된 그림 2)와 최종 식 벡터와의 통합의 결합은 간단 하 고 효율적으로 1 단계 반응 (참조 그림 2 에 의해 달성 ). 그것은 DNA 분자 DNA 파편의 융합 및 플라스 미드25,26의 건설을 달성 하기 위해 겹치는 짧은 시퀀스와 중재의 겹치는 재결합에 의해 이전 연구에서 적응 이다.
메서드의 테스트로 서 우리는 선택 했다 vacuolar 정렬 수용 체 (VSR)와 분 비 캐리어 막 단백질 (림), 두 기자 단백질 분 비 단백질 endocytosis 경로, 각각6,22에 참여 ,23,,2930. VSRs는 유형-나를 공포 하 고 주로 분 비 통로에서 생 합성 단백질 트래픽을 중재 완전 한 막 단백질 식물6,,2223prevacuolar 구획 (Pvc)에서 localizes. 반면, 분 비 캐리어 막 단백질 (아니 죠)는 식물 endocytic 통로에 참여 하는 유형 IV 막 단백질. 그것은 원형질 막 (오후)와 트랜스localizes-초기 endosomes22,,2930으로 Golgi 네트워크 (TGNs). 우리 애기 VSR2의 공상 융해를 호스트 하는 두 단백질 식 카세트 건설 (AtVSR2) RFP와 애기 SCAMP4 (AtSCAMP4) GFP, 그림 3에서 같이와. RFP AtVSR2 ER로 번역 될 수 있도록 신호 펩 티 드 (SP)는 추가 RFP, 전에 이전으로 보고6,31. 두 개의 개별 단백질 식 카세트 더 류의 고 최종 단백질 표정 벡터 pUC18 또는 pCAMBIA1300 단백질 공동 식 중 하나 를 통해 단백질 과도 선 또는 같이 안정적인 변환, 공장 그림 3. AtVSR2 및 AtSCAMP4 성공적으로 공동 담배 BY-2 셀 통해 입자 사격에에서 표현 했다 올바른 지역화 (그림 4A)를 보였다. RFP AtVSR2 다른 일부 cytosolic punctate 점으로 AtSCAMP4 GFP의 플라즈마 멤브레인 지역화는 punctate 패턴을 보였다. 또한, 공동 AtSCAMP4 GFP RFP AtVSR2을 표현 하는 유전자 변형 식물 애기 Agrobacterium 통해생성-변화를 중재. RFP AtVSR2와 AtSCAMP4-GFP 루트 및 루트 머리 세포에 표현 공동의 subcellular 지 방화는 그림 4B 와 4E에표시 했다. RFP AtVSR2 및 AtSCAMP4-GFP 유전자 변형 애기 에서 얻은 공동 식 결과 BY 2 셀에서 동의 했다. 또한, 유전자 변형 애기 wortmannin로 치료 했다 BFA 30 분 Wortmmanin RFP AtVSR2 발생에 대 한 작은 고리 모양의 구조를 형성 하는 Pvc를 분류 하 고 BFA 유도 AtSCAMP GFP TGN 집계 라는 그림 4C와 같이 , D, F, G. 또한, 그림 4 (보충 그림 1)에 관해서는 이미지 컬렉션의 동일한 설정을 적용 하 여 담배 BY-2 셀과 애기 루트 및 루트 머리 셀에서 작은 autofluorescent 신호를 감지할 수 있습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57354/57354fig1.jpg"> 그림 1: 식물에 여러 공상 형광 성 융해 단백질의 공동 식에 대 한 강력한 시스템. (A) 식물에 여러 형광 기자 단백질의 과도 공동 식의 기존의 접근 달성 통해 electroporation, 입자 사격, 및 말뚝 중재 변환 여러 독립 식 혼합 하 여 벡터 스 (B) 단일 형광 성 융해 단백질 표정 벡터와 Agrobacterium 여 식물 유전자 변환 위한 전통적인 방법입니다. 공동 유전자 변형 식물에 여러 공상 형광 성 융해 단백질 표현, 추가 유전자 교차 상영의 여러 라운드가 됩니다 homozygous progenies 얻기 위해. (C) 와 (D) 다른 새로운 단백질 공동 식 방법. 그것은 여러 단백질 식 카세트의 수 공동 을 통해 식물에 여러 공상 형광 기자 단백질을 표현 하는 단일 식 벡터 활용 모두 과도 식과 유전자 변환. 이 그림의 내용은 종 외 에 처음 출판 되었다 201736 (; 허가로 증 쇄 식물 과학에 저작권 국경). <a href="/files/ftp_upload/57354/57354fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57354/57354fig2.jpg"> 그림 2: 등온선 재결합 반응에 의해 한 단계 DNA 어셈블리 방법의 작동 원리의 데모. DNA 파편 및 중복 시퀀스 (OSs)와 선형화 플라스 미드는 5'-오버행 겹치는 영역, DNA 중 합 효소에 의해 확장 하 고, 리가 연결 사이 기본 껍질 벗기기에 의해 붙어 있다. <a href="/files/ftp_upload/57354/57354fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57354/57354fig3.jpg"> 그림 3: 공동 여러 공상 형광 성 융해 단백질을 표현 하기 위한 단일 플라스 미드를 건설의 전략. 다이어그램 과도 식 또는 식물에서 안정적인 변환 여러 공상 형광 성 융해 단백질의 공동 식에 대 한 단일 식 플라스 미드를 건설 하기 위한 전략을 보여 줍니다. 표정 벡터는 각각의 단백질 표정, 및 반 independently의 개별 공상 형광 성 융해 단백질을 표현 기능에 대 한 그것의 자신의 필요한 요소를 포함 하는 두 단백질 식 카세트의 구성 됩니다. 어셈블리 및 모든 DNA 분자의 Interlinkage 메서드에서 최적화 된 등온선 생체 외에서 재결합 겹치는 DNA 조각을 함께 중재 편리 하 게 달성 된다. 이 그림의 내용은 종 외 에 처음 출판 되었다 201736 (; 허가로 증 쇄 식물 과학에 저작권 국경). <a href="/files/ftp_upload/57354/57354fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57354/57354fig4.jpg"> 그림 4: VSR과 식물 세포에서 림의 공상 형광 융합의 공동 식의 대표 이미지. (A) 공동 식의 RFP-AtVSR2와 AtSCAMP4-GFP 담배 BY-2 현 탁 액 셀에서 입자 사격을 통해. ((B)) 공동 표현 RFP AtVSR2 및 AtSCAMP4 GFP 유전자 변형 애기 루트 셀의 대표 이미지. (C) 와 (D) 유전자 변형 애기 뿌리 공동 RFP AtVSR2 및 AtSCAMP4 GFP를 표현 했다 치료 wortmannin와 BFA 30 분 각각. (E) 공동 표현 RFP AtVSR2 및 AtSCAMP4 GFP 유전자 변형 애기 루트 머리의 대표 이미지. (F) 및 (G) 유전자 변형 애기 루트 머리카락 공동 표현 RFP-AtVSR2와 AtSCAMP4-GFP 치료 wortmannin와 BFA 30 분 화살표 (D) 및 (G) 에 대 한 표시 BFA 유도 단백질 집계입니다. rp = 피어슨 상관 계수; rs = Spearman의 순위 상관 관계. (A)-(D) 에서 눈금 막대는 50 µ m, (E)-(G)는 30 µ m.이 그림의 내용 Zhong 그 외 에 처음 출판 되었다 201736 (; 허가로 증 쇄 식물 과학에 저작권 국경). <a href="/files/ftp_upload/57354/57354fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="3">식 카세트 1</td>
		</tr>
<tr>
<td>1-FP35S</td>
			<td colspan="2">
GAATTCGAGCTCGGTACCC ACATGGTGGAGCACGACACA</td>
		</tr>
<tr>
<td>1-RP35S</td>
			<td colspan="2">
AGGACGCGGGCGTGGGCCAT TATCACATCAATCCACTTGC</td>
		</tr>
<tr>
<td>1-FRFP</td>
			<td colspan="2">
GCAAGTGGATTGATGTGATA ATGGCCCACGCCCGCGTCCT</td>
		</tr>
<tr>
<td>1-RRFP</td>
			<td colspan="2">
ATTATCCATATCACTCCCCA GGCGCCGGTGGAGTGGCGGC</td>
		</tr>
<tr>
<td>1-FAtVSR2</td>
			<td colspan="2">
GCCGCCACTCCACCGGCGCC TGGGGAGTGATATGGATAAT</td>
		</tr>
<tr>
<td>1-RAtVSR2</td>
			<td colspan="2">
AAATGTTTGAACGATCGGGA TTACAACTCTAGTTGAGAAG</td>
		</tr>
<tr>
<td>1-FNOS</td>
			<td colspan="2">
CTTCTCAACTAGAGTTGTAA TCCCGATCGTTCAAACATTT</td>
		</tr>
<tr>
<td>1-RNOS</td>
			<td colspan="2">
GAGAATGGATGCGAGTAATG TCTAGTAACATAGATGACAC</td>
		</tr>
<tr>
<td colspan="3">식 카세트 2</td>
		</tr>
<tr>
<td>2-FP35S</td>
			<td colspan="2">
CATTACTCGCATCCATTCTC ACATGGTGGAGCACGACACA</td>
		</tr>
<tr>
<td>2-RP35S</td>
			<td colspan="2">
TTAGGATCGTGTCGTGCCAT TATCACATCAATCCACTTGC</td>
		</tr>
<tr>
<td>2-FAtSCAMP4</td>
			<td colspan="2">
GCAAGTGGATTGATGTGATA ATGGCACGACACGATCCTAA</td>
		</tr>
<tr>
<td>2-RAtSCAMP4</td>
			<td colspan="2">
TCCTCGCCCTTGCTCACCAT TAGTGCACGCATCAAGGTCG</td>
		</tr>
<tr>
<td>2-FGFP</td>
			<td colspan="2">
CGACCTTGATGCGTGCACTA ATGGTGAGCAAGGGCGAGGA</td>
		</tr>
<tr>
<td>2-RGFP</td>
			<td colspan="2">
TAAAACCAAAATCCAGTGAC TTACTTGTACAGCTCGTCCA</td>
		</tr>
<tr>
<td>2-FT35S</td>
			<td colspan="2">
TGGACGAGCTGTACAAGTAA GTCACTGGATTTTGGTTTTA</td>
		</tr>
<tr>
<td>2-RT35S</td>
			<td colspan="2">
GTCGACTCTAGAGGATCCCC GTCCGCAAAAATCACCAGTC</td>
		</tr>
</tbody></table>표 1: 뇌관 디자인 전략 및이 연구에 사용 된 시퀀스. 각 뇌관의 이름 왼쪽된 패널에 부여 됩니다. 뇌관의 보완 겹치는 시퀀스 밑줄이 그어집니다. 이 테이블의 내용은 종 외 에 처음 출판 되었다 201736 (; 허가로 증 쇄 식물 과학에 저작권 국경).
보충 그림 1: autofluorescence BY 2 세포와 애기 뿌리와 루트 머리카락의 대표 이미지. (A) 야생 타입 BY-2 셀의 autofluorescence 변환 된 셀과 같은 이미징 조건 하에서 발견 되었다. (B) 와 (C) 애기 루트 머리와 루트 셀 변환된 애기 셀과 같은 이미징 조건 하에서 발견 되었다. 눈금 막대 (A)-(C)은 입니다 20 µ m. DIC, 미분 간섭 명암. <a href="/files/ftp_upload/57354/11.Supplemental_Figure_1.tif">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants at JoVE.com

Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

공동 기존 방법의 어려움을 극복 하기 위해 공장에서 여러 공상 형광 성 융해 단백질을 표현 하기 위한 새로운 방법을 개발 했습니다. 그것은 단백질 공동 식 달성 하기 위해 카세트를 표현 하는 여러 기능적으로 독립적인 단백질을 포함 하는 단일 식 플라스 미드를 사용 하 여 활용 합니다.

식물에는 효율적인 방법으로 여러 공상 형광 성 융해 단백질의 공동 식

Information about the spatiotemporal subcellular localization(s) of a protein is critical to understand its physiological functions in cells. Fluorescent ...

co-expression-multiple-chimeric-fluorescent-fusion-proteins-an

Nanyang Technological University

Research

JoVE Journal

Chemistry

9.6K 조회수.  South China Agricultural University. 공동 기존 방법의 어려움을 극복 하기 위해 공장에서 여러 공상 형광 성 융해 단백질을 표현 하기 위한 새로운 방법을 개발 했습니다. 그것은 단백질 공동 식 달성 하기 위해 카세트를 표현 하는 여러 기능적으로 독립적인 단백질을 포함 하는 단일 식 플라스 미드를 사용 하 여 활용 합니다.

비디오: Co-expression of Multiple Chimeric Fluorescent Fusion Proteins in an Efficient Way in Plants

Untargeted Metabolomics from Biological Sources Using Ultraperformance Liquid Chromatography-High Resolution Mass Spectrometry (UPLC-HRMS)

Here we present a workflow to analyze the metabolic profiles for biological samples of interest including; cells, serum, or tissue. The sample is first separated into polar and non-polar fractions by a liquid-liquid phase extraction, and partially purified to facilitate downstream analysis. Both aqueous (polar metabolites) and organic (non-polar metabolites) phases of the initial extraction are processed to survey a broad range of metabolites. Metabolites are separated by different liquid chromatography methods based upon their partition properties. In this method, we present microflow ultra-performance (UP)LC methods, but the protocol is scalable to higher flows and lower pressures. Introduction into the mass spectrometer can be through either general or compound optimized source conditions. Detection of a broad range of ions is carried out in full scan mode in both positive and negative mode over a broad m/z range using high resolution on a recently calibrated instrument. Label-free differential analysis is carried out on bioinformatics platforms. Applications of this approach include metabolic pathway screening, biomarker discovery, and drug development.

Untargeted Metabolomics from Biological Sources Using Ultraperformance Liquid Chromatography-High Resolution Mass Spectrometry UPLC-HRMS

Untargeted metabolomics provides a hypothesis generating snapshot of a metabolic profile. This protocol will demonstrate the extraction and analysis of metabolites from cells, serum, or tissue. A range of metabolites are surveyed using liquid-liquid phase extraction, microflow ultraperformance liquid chromatography/high-resolution mass spectrometry (UPLC-HRMS) coupled to differential analysis software.

Ultraperformance 액체 크로마토 그래피 고해상도 질량 분석 (UPLC-HRMS)를 사용하여 생물 소스에서 타겟이 불분명 한 대사

Here we present a workflow to analyze the metabolic profiles for biological samples of interest including; cells, serum, or tissue. The sample is first ...

연구

화학

Polymalic Acid-based Nano Biopolymers for Targeting of Multiple Tumor Markers: An Opportunity for Personalized Medicine?

Tumors with similar grade and morphology often respond differently to the same treatment because of variations in molecular profiling. To account for this diversity, personalized medicine is developed for silencing malignancy associated genes. Nano drugs fit these needs by targeting tumor and delivering antisense oligonucleotides for silencing of genes. As drugs for the treatment are often administered repeatedly, absence of toxicity and negligible immune response are desirable. In the example presented here, a nano medicine is synthesized from the biodegradable, non-toxic and non-immunogenic platform polymalic acid by controlled chemical ligation of antisense oligonucleotides and tumor targeting molecules. The synthesis and treatment is exemplified for human Her2-positive breast cancer using an experimental mouse model. The case can be translated towards synthesis and treatment of other tumors.

An example of a nano drug based on polymalic acid is presented towards the rational design of personalized medicine that is applicable to cancer. It describes the synthesis of a nano drug to treat Her2-positive human breast cancer in a nude mouse.

여러 종양 마커의 대상으로하기위한 Polymalic 산 기반의 나노 생물 고분자 물질 : 개인화 된 약을위한 기회?

Tumors with similar grade and morphology often respond differently to the same treatment because of variations in molecular profiling. To account for this ...

Facile and Efficient Preparation of Tri-component Fluorescent Glycopolymers via RAFT-controlled Polymerization

Synthetic glycopolymers are instrumental and versatile tools used in various biochemical and biomedical research fields. An example of a facile and efficient synthesis of well-controlled fluorescent statistical glycopolymers using reversible addition-fragmentation chain-transfer (RAFT)-based polymerization is demonstrated. The synthesis starts with the preparation of &#946;-galactose-containing glycomonomer 2-lactobionamidoethyl methacrylamide obtained by reaction of lactobionolactone and N-(2-aminoethyl) methacrylamide (AEMA). 2-Gluconamidoethyl methacrylamide (GAEMA) is used as a structural analog lacking a terminal &#946;-galactoside. The following RAFT-mediated copolymerization reaction involves three different monomers: N-(2-hydroxyethyl) acrylamide as spacer, AEMA as target for further fluorescence labeling, and the glycomonomers. Tolerant of aqueous systems, the RAFT agent used in the reaction is (4-cyanopentanoic acid)-4-dithiobenzoate. Low dispersities (&#8804;1.32), predictable copolymer compositions, and high reproducibility of the polymerizations were observed among the products. Fluorescent polymers are obtained by modifying the glycopolymers with carboxyfluorescein succinimidyl ester targeting the primary amine functional groups on AEMA. Lectin-binding specificities of the resulting glycopolymers are verified by testing with corresponding agarose beads coated with specific glycoepitope recognizing lectins. Because of the ease of the synthesis, the tight control of the product compositions and the good reproducibility of the reaction, this protocol can be translated towards preparation of other RAFT-based glycopolymers with specific structures and compositions, as desired.

An efficient, three-step synthesis of RAFT-based fluorescent glycopolymers, consisting of glycomonomer preparation, copolymerization, and post-modification, is demonstrated. This protocol can be used to prepare RAFT-based statistical glycopolymers with desired structures.

RAFT 중합 제어를 통해 트라이 구성 요소 형광 Glycopolymers의 손쉬운 및 효율적인 준비

Synthetic glycopolymers are instrumental and versatile tools used in various biochemical and biomedical research fields. An example of a facile and ...

Radiolabeling and Quantification of Cellular Levels of Phosphoinositides by High Performance Liquid Chromatography-coupled Flow Scintillation

Phosphoinositides (PtdInsPs) are essential signaling lipids responsible for recruiting specific effectors and conferring organelles with molecular identity and function. Each of the seven PtdInsPs varies in their distribution and abundance, which are tightly regulated by specific kinases and phosphatases. The abundance of PtdInsPs can change abruptly in response to various signaling events or disturbance of the regulatory machinery. To understand how these events lead to changes in the amount of PtdInsPs and their resulting impact, it is important to quantify PtdInsP levels before and after a signaling event or between control and abnormal conditions. However, due to their low abundance and similarity, quantifying the relative amounts of each PtdInsP can be challenging. This article describes a method for quantifying PtdInsP levels by metabolically labeling cells with 3H-myo-inositol, which is incorporated into PtdInsPs. Phospholipids are then precipitated and deacylated. The resulting soluble 3H-glycero-inositides are further extracted, separated by high-performance liquid chromatography (HPLC), and detected by flow scintillation. The labeling and processing of yeast samples is described in detail, as well as the instrumental setup for the HPLC and flow scintillator. Despite losing structural information regarding acyl chain content, this method is sensitive and can be optimized to concurrently quantify all seven PtdInsPs in cells.

Phosphoinositides are signaling lipids whose relative abundance rapidly changes in response to various stimuli. This article describes a method to measure the abundance of phosphoinositides by metabolically labeling cells with 3H-myo-inositol, followed by extraction and deacylation. Extracted glycero-inositides are then separated by high-performance liquid chromatography and quantified by flow scintillation.

고성능 액체 크로마토 그래피 결합 흐름 섬광에 의한 방사성 표지 및 Phosphoinositides의 세포 수준의 정량화

Phosphoinositides (PtdInsPs) are essential signaling lipids responsible for recruiting specific effectors and conferring organelles with molecular ...

In Situ Characterization of Hydrated Proteins in Water by SALVI and ToF-SIMS

This work demonstrates in situ characterization of protein biomolecules in the aqueous solution using the System for Analysis at the Liquid Vacuum Interface (SALVI) and time-of-flight secondary ion mass spectrometry (ToF-SIMS). The fibronectin protein film was immobilized on the silicon nitride (SiN) membrane that forms the SALVI detection area. During ToF-SIMS analysis, three modes of analysis were conducted including high spatial resolution mass spectrometry, two-dimensional (2D) imaging, and depth profiling. Mass spectra were acquired in both positive and negative modes. Deionized water was also analyzed as a reference sample. Our results show that the fibronectin film in water has more distinct and stronger water cluster peaks compared to water alone. Characteristic peaks of amino acid fragments are also observable in the hydrated protein ToF-SIMS spectra. These results illustrate that protein molecule adsorption on a surface can be studied dynamically using SALVI and ToF-SIMS in the liquid environment for the first time.

In Situ Characterization of Hydrated Proteins in Water by SALVI and ToF-SIMS

This work presents a protocol for liquid handling and sample introduction to a microchannel for in situ time-of-flight secondary ion mass spectrometry analysis of protein biomolecules in an aqueous solution.

SALVI 및으로 ToF-SIMS에 의해 물에 수화 된 단백질의 제자리의 특성에

This work demonstrates in situ characterization of protein biomolecules in the aqueous solution using the System for Analysis at the Liquid Vacuum ...

Sequencing of Plant Wall Heteroxylans Using Enzymic, Chemical (Methylation) and Physical (Mass Spectrometry, Nuclear Magnetic Resonance) Techniques

This protocol describes the specific techniques used for the characterization of reducing end (RE) and internal region glycosyl sequence(s) of heteroxylans. De-starched wheat endosperm cell walls were isolated as an alcohol-insoluble residue (AIR)1 and sequentially extracted with water (W-sol Fr) and 1 M KOH containing 1% NaBH4 (KOH-sol Fr) as described by Ratnayake et al. (2014)2. Two different approaches (see summary in Figure 1) are adopted. In the first, intact W-sol AXs are treated with 2AB to tag the original RE backbone chain sugar residue and then treated with an endoxylanase to generate a mixture of 2AB-labelled RE and internal region reducing oligosaccharides, respectively. In a second approach, the KOH-sol Fr is hydrolyzed with endoxylanase to first generate a mixture of oligosaccharides which are subsequently labelled with 2AB. The enzymically released ((un)tagged) oligosaccharides from both W- and KOH-sol Frs are then methylated and the detailed structural analysis of both the native and methylated oligosaccharides is performed using a combination of MALDI-TOF-MS, RP-HPLC-ESI-QTOF-MS and ESI-MSn. Endoxylanase digested KOH-sol AXs are also characterized by nuclear magnetic resonance (NMR) that also provides information on the anomeric configuration. These techniques can be applied to other classes of polysaccharides using the appropriate endo-hydrolases.

Sequencing of Plant Wall Heteroxylans Using Enzymic, Chemical Methylation and Physical Mass Spectrometry, Nuclear Magnetic Resonance Techniques

This protocol describes the specific techniques used for the structural characterization of reducing end (RE) and internal region glycosyl sequence(s) of heteroxylans by tagging the RE with 2 aminobenzamide prior to enzymatic (endoxylanase) hydrolysis and then analysis of the resultant oligosaccharides using mass spectrometry (MS) and nuclear magnetic resonance (NMR).

This protocol describes the specific techniques used for the characterization of reducing end (RE) and internal region glycosyl sequence(s) of ...

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the development of antibody drug conjugates (ADCs) and nanomedicine, fluorescent microscopy and systems chemistry. For many of these applications, specificity of the bioconjugation method used is of prime concern. The Michael addition of maleimides with cysteine(s) on the target proteins is highly selective and proceeds rapidly under mild conditions, making it one of the most popular methods for protein bioconjugation.
We demonstrate here the modification of the only surface-accessible cysteine residue on yeast cytochrome c with a ruthenium(II) bisterpyridine maleimide. The protein bioconjugation is verified by gel electrophoresis and purified by aqueous-based fast protein liquid chromatography in 27% yield of isolated protein material. Structural characterization with MALDI-TOF MS and UV-Vis is then used to verify that the bioconjugation is successful. The protocol shown here is easily applicable to other cysteine - maleimide coupling of proteins to other proteins, dyes, drugs or polymers.

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

This protocol details the important steps required for the bioconjugation of a cysteine containing protein to a maleimide, including reagent purification, reaction conditions, bioconjugate purification and bioconjugate characterization.

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the ...

Visualizing Lignification Dynamics in Plants with Click Chemistry: Dual Labeling is BLISS!

Lignin is one of the most prevalent biopolymers on the planet and a major component of lignocellulosic biomass. This phenolic polymer plays a vital structural and protective role in the development and life of higher plants. Although the intricate mechanisms regulating lignification processes in vivo strongly impact the industrial valorization of many plant-derived products, the scientific community still has a long way to go to decipher them. In a simple three-step workflow, the dual labeling protocol presented herein enables bioimaging studies of actively lignifying zones of plant tissues. The first step consists in the metabolic incorporation of two independent chemical reporters, surrogates of the two native monolignols that give rise to lignin H- and G-units. After incorporation into growing lignin polymers, each reporter is then specifically labeled with its own fluorescent probe via a sequential combination of bioorthogonal SPAAC/CuAAC click reactions. Combined with lignin autofluorescence, this approach leads to the generation of three-color localization maps of lignin within plant cell walls by confocal fluorescence microscopy and provides precise spatial information on the presence or absence of active lignification machinery at the scale of plant tissues, cells and different cell wall layers.

BLISS, a dual labeling protocol for studying lignification dynamics, was developed. Using synthetic monolignol reporters and a sequential combination of SPAAC and CuAAC bioorthogonal click reactions, this methodology paves the way to in-depth analysis of the factors that regulate the biogenesis of lignins in planta.

Lignification 역학 클릭 화학 식물에서 시각화: 행복은 듀얼 라벨!

Lignin is one of the most prevalent biopolymers on the planet and a major component of lignocellulosic biomass. This phenolic polymer plays a vital ...

An Efficient Sample Preparation Method to Enhance Carbohydrate Ion Signals in Matrix-assisted Laser Desorption/Ionization Mass Spectrometry

Sample preparation is a critical process in mass spectrometry (MS) analysis of carbohydrates. Although matrix-assisted laser desorption/ionization (MALDI) MS is the method of choice in carbohydrate analysis, poor ion signal and data reproducibility of carbohydrate samples continue to be severe problems. For quantitative analysis of carbohydrates, an effective analytical protocol providing superior data quality is necessary. This video demonstrates sample preparation protocols to improve signal intensity and minimize data variation of carbohydrates in MALDI-MS. After drying and crystallization of sample droplets, the crystal morphology is reformed by methanol before mass spectrometric analysis. The enhancement in carbohydrate signal is examined with MALDI imaging mass spectrometry (IMS). Experimental results show that crystal reformation adjusts crystalline structures and redistributes carbohydrate analytes. In comparison with the dried droplet preparation method in conventional MALDI-MS, reforming carbohydrate crystal morphologies with methanol shows significantly better signal intensity, ion image distribution, and data stability. Since the protocols demonstrated herein do not involve changes in sample composition, they are generally applicable to various carbohydrates and matrixes.

A protocol for enhancing carbohydrate ion signals in MALDI mass spectrometry by reforming crystalline structures during sample preparation processes is demonstrated.

매트릭스 보조 레이저 탈 착/이온화 질량 분석에서 탄수화물 이온 신호를 강화 하는 효율적인 샘플 준비 방법

Sample preparation is a critical process in mass spectrometry (MS) analysis of carbohydrates. Although matrix-assisted laser desorption/ionization (MALDI) ...

Photoelectron Imaging of Anions Illustrated by 310 Nm Detachment of F&#8722;

Anion photoelectron imaging is a very efficient method for the study of energy states of bound negative ions, neutral species and interactions of unbound electrons with neutral molecules/atoms. State-of-the-art in vacuo anion generation techniques allow application to a broad range of atomic, molecular, and cluster anion systems. These are separated and selected using time-of-flight mass spectrometry. Electrons are removed by linearly polarized photons (photo detachment) using table-top laser sources which provide ready access to excitation energies from the infra-red to the near ultraviolet. Detecting the photoelectrons with a velocity mapped imaging lens and position sensitive detector means that, in principle, every photoelectron reaches the detector and the detection efficiency is uniform for all kinetic energies. Photoelectron spectra extracted from the images via mathematical reconstruction using an inverse Abel transformation reveal details of the anion internal energy state distribution and the resultant neutral energy states. At low electron kinetic energy, typical resolution is sufficient to reveal energy level differences on the order of a few millielectron-volts, i.e., different vibrational levels for molecular species or spin-orbit splitting in atoms. Photoelectron angular distributions extracted from the inverse Abel transformation represent the signatures of the bound electron orbital, allowing more detailed probing of electronic structure. The spectra and angular distributions also encode details of the interactions between the outgoing electron and the residual neutral species subsequent to excitation. The technique is illustrated by the application to an atomic anion (F&#8722;), but it can also be applied to the measurement of molecular anion spectroscopy, the study of low lying anion resonances (as an alternative to scattering experiments) and femtosecond (fs) time resolved studies of the dynamic evolution of anions.

Here, we present a protocol for photoelectron imaging of anionic species. Anions generated in vacuo and separated by mass spectrometry are probed using velocity mapped photoelectron imaging, providing details of anion and neutral energy levels, anion and neutral structure and the nature of the anion electronic state.

F− 의 310 Nm 분리에 의해 설명 하는 음이온의 광전자 이미징

Anion photoelectron imaging is a very efficient method for the study of energy states of bound negative ions, neutral species and interactions of unbound ...