우리 감사 Henriette Bertemes 실험실 내 CGN 재배 프로토콜을 설정 하는 데 도움. 이 방법은 종이 DFG 투자 CRC992 의료 Epigenetics tv 자금으로 지원 했다. 저자 인정 프라이부르크 갤럭시 팀의 지원: Pavankumar Videm, 비 Grüning와 교수 Rolf Backofen, 생물 정보학, Freiburg의 대학, 독일 공동 연구 센터 992 의료 Epigenetics (DFG 부여 SFB 992/1 2012)에 의해 투자 독일 연방 교육부의 교육 및 연구 (BMBF 그랜트 031 A538A 로얄 (드. NBI))입니다.

<ol>
	<li>Molyneaux, B. J., Arlotta, P., Menezes, J. R. L., Macklis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtype+specification+in+the+cerebral+cortex.">Neuronal subtype specification in the cerebral cortex.</a> Nat. Rev. Neurosci. 8, 427-437 (2007).</li><li>Kandel, E. R., Squire, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroscience:+breaking+down+scientific+barriers+to+the+study+of+brain+and+mind.">Neuroscience: breaking down scientific barriers to the study of brain and mind.</a> Science. 290, 1113-1120 (2000).</li><li>G&#246;tz, M., Sommer, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortical+development:+the+art+of+generating+cell+diversity.">Cortical development: the art of generating cell diversity.</a> Dev. Camb. Engl. 132, 3327 (2005).</li><li>Hirabayashi, Y., Gotoh, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+control+of+neural+precursor+cell+fate+during+development.">Epigenetic control of neural precursor cell fate during development.</a> Nat. Rev. Neurosci. 11, 377-388 (2010).</li><li>Davis, A. A., Temple, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+self-renewing+multipotential+stem+cell+in+embryonic+rat+cerebral+cortex.">A self-renewing multipotential stem cell in embryonic rat cerebral cortex.</a> Nature. 372, 263-266 (1994).</li><li>Sauvageot, C. M., Stiles, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+controlling+cortical+gliogenesis.">Molecular mechanisms controlling cortical gliogenesis.</a> Curr. Opin. Neurobiol. 12, 244-249 (2002).</li><li>McConnell, S. K., Kaznowski, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+dependence+of+laminar+determination+in+developing+neocortex.">Cell cycle dependence of laminar determination in developing neocortex.</a> Science. 254, 282-285 (1991).</li><li>Desai, A. R., McConnell, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progressive+restriction+in+fate+potential+by+neural+progenitors+during+cerebral+cortical+development.">Progressive restriction in fate potential by neural progenitors during cerebral cortical development.</a> Dev. Camb. Engl. 127, 2863-2872 (2000).</li><li>Glickstein, M., Strata, P., Voogd, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellum:+history.">Cerebellum: history.</a> Neuroscience. 162, 549-559 (2009).</li><li>Marzban, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+commitment+in+the+developing+cerebellum.">Cellular commitment in the developing cerebellum.</a> Front. Cell. Neurosci. 8, (2015).</li><li>Azevedo, F. A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equal+numbers+of+neuronal+and+nonneuronal+cells+make+the+human+brain+an+isometrically+scaled-up+primate+brain.">Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain.</a> J. Comp. Neurol. 513, 532-541 (2009).</li><li>Machold, R., Fishell, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Math1+is+expressed+in+temporally+discrete+pools+of+cerebellar+rhombic-lip+neural+progenitors.">Math1 is expressed in temporally discrete pools of cerebellar rhombic-lip neural progenitors.</a> Neuron. 48, 17-24 (2005).</li><li>Luger, K., M&#228;der, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389, 251-260 (1997).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128, 693-705 (2007).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modification+mapping+in+human+brain+reveals+aberrant+expression+of+histone+H3+lysine+79+dimethylation+in+neural+tube+defects.">Histone modification mapping in human brain reveals aberrant expression of histone H3 lysine 79 dimethylation in neural tube defects.</a> Neurobiol. Dis. 54, 404-413 (2013).</li><li>Zhang, Y., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+regulation+by+histone+methylation:+interplay+between+different+covalent+modifications+of+the+core+histone+tails.">Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails.</a> Genes Dev. 15, 2343-2360 (2001).</li><li>Sanders, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methylation+of+histone+H4+lysine+20+controls+recruitment+of+Crb2+to+sites+of+DNA+damage.">Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage.</a> Cell. 119, 603-614 (2004).</li><li>Martin, C., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diverse+functions+of+histone+lysine+methylation.">The diverse functions of histone lysine methylation.</a> Nat. Rev. Mol. Cell Biol. 6, 838-849 (2005).</li><li>Greer, E. L., Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+methylation:+a+dynamic+mark+in+health,+disease+and+inheritance.">Histone methylation: a dynamic mark in health, disease and inheritance.</a> Nat. Rev. Genet. 13, 343-357 (2012).</li><li>Ng, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+methylation+within+the+globular+domain+of+histone+H3+by+Dot1+is+important+for+telomeric+silencing+and+Sir+protein+association.">Lysine methylation within the globular domain of histone H3 by Dot1 is important for telomeric silencing and Sir protein association.</a> Genes Dev. 16, 1518-1527 (2002).</li><li>Kebede, A. F., Schneider, R., Daujat, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+types+and+sites+of+histone+modifications+emerge+as+players+in+the+transcriptional+regulation+contest.">Novel types and sites of histone modifications emerge as players in the transcriptional regulation contest.</a> FEBS J. 282, 1658-1674 (2015).</li><li>Roidl, D., Hacker, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+methylation+during+neural+development.">Histone methylation during neural development.</a> Cell Tissue Res. 356, 539-552 (2014).</li><li>Mersfelder, E. L., Parthun, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tale+beyond+the+tail:+histone+core+domain+modifications+and+the+regulation+of+chromatin+structure.">The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure.</a> Nucleic Acids Res. 34, 2653-2662 (2006).</li><li>van Leeuwen, F., Gafken, P. R., Gottschling, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dot1p+Modulates+Silencing+in+Yeast+by+Methylation+of+the+Nucleosome+Core.">Dot1p Modulates Silencing in Yeast by Methylation of the Nucleosome Core.</a> Cell. 109, 745-756 (2002).</li><li>Jones, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+H3K79+methyltransferase+Dot1L+is+essential+for+mammalian+development+and+heterochromatin+structure.">The histone H3K79 methyltransferase Dot1L is essential for mammalian development and heterochromatin structure.</a> PLoS Genet. 4, e1000190 (2008).</li><li>Woo Park, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RE-IIBP+Methylates+H3K79+and+Induces+MEIS1-mediated+Apoptosis+via+H2BK120+Ubiquitination+by+RNF20.">RE-IIBP Methylates H3K79 and Induces MEIS1-mediated Apoptosis via H2BK120 Ubiquitination by RNF20.</a> Sci. Rep. 5, 12485 (2015).</li><li>Vlaming, H., van Leeuwen, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+upstreams+and+downstreams+of+H3K79+methylation+by+DOT1L.">The upstreams and downstreams of H3K79 methylation by DOT1L.</a> Chromosoma. , (2016).</li><li>Jones, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+H3K79+methyltransferase+Dot1L+is+essential+for+mammalian+development+and+heterochromatin+structure.">The histone H3K79 methyltransferase Dot1L is essential for mammalian development and heterochromatin structure.</a> PLoS Genet. 4, e1000190 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+mammalian+erythropoiesis+requires+the+Dot1L+methyltransferase.">Early mammalian erythropoiesis requires the Dot1L methyltransferase.</a> Blood. 116, 4483-4491 (2010).</li><li>Cattaneo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DOT1L-mediated+H3K79me2+modification+critically+regulates+gene+expression+during+cardiomyocyte+differentiation.">DOT1L-mediated H3K79me2 modification critically regulates gene expression during cardiomyocyte differentiation.</a> Cell Death Differ. 23, 555-564 (2016).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modification+mapping+in+human+brain+reveals+aberrant+expression+of+histone+H3+lysine+79+dimethylation+in+neural+tube+defects.">Histone modification mapping in human brain reveals aberrant expression of histone H3 lysine 79 dimethylation in neural tube defects.</a> Neurobiol. Dis. 54, 404-413 (2013).</li><li>B&#252;ttner, N., Johnsen, S. A., K&#252;gler, S., Vogel, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Af9/Mllt3+interferes+with+Tbr1+expression+through+epigenetic+modification+of+histone+H3K79+during+development+of+the+cerebral+cortex.">Af9/Mllt3 interferes with Tbr1 expression through epigenetic modification of histone H3K79 during development of the cerebral cortex.</a> Proc. Natl. Acad. Sci. U. S. A. 107, 7042-7047 (2010).</li><li>Roidl, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DOT1L+Activity+Promotes+Proliferation+and+Protects+Cortical+Neural+Stem+Cells+from+Activation+of+ATF4-DDIT3-Mediated+ER+Stress+In+Vitro.">DOT1L Activity Promotes Proliferation and Protects Cortical Neural Stem Cells from Activation of ATF4-DDIT3-Mediated ER Stress In Vitro.</a> Stem Cells Dayt. Ohio. 34, 233-245 (2016).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat. Biotechnol. 29, 24-26 (2011).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat. Methods. 9, 357-359 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9, R137 (2008).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=deepTools2:+a+next+generation+web+server+for+deep-sequencing+data+analysis.">deepTools2: a next generation web server for deep-sequencing data analysis.</a> Nucleic Acids Res. 44, W160-W165 (2016).</li><li>Roidl, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Histone modifications during cerebral cortex development. , (2015).</li><li>Turner, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP+with+Native+Chromatin:+Advantages+and+Problems+Relative+to+Methods+Using+Cross-Linked+Material.">ChIP with Native Chromatin: Advantages and Problems Relative to Methods Using Cross-Linked Material.</a> Mapping Protein/DNA Interactions by Cross-Linking. , (2001).</li><li>Dincman, T. A., Beare, J. E., Ohri, S. S., Whittemore, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+cortical+mouse+oligodendrocyte+precursor+cells.">Isolation of cortical mouse oligodendrocyte precursor cells.</a> J. Neurosci. Methods. 209, 219-226 (2012).</li></ol>

저자 들은 아무 경쟁 금융 관심 선언

히스톤 수정, 녹음 방송 요인, 히스톤 코드 독자, 작가, 또는 지우개의 게놈 인 검출 하기 chromatin immunoprecipitation를 수행 하기 위해 두 가지 주요 방법이 있다. 하나는 nuclease 소화, immunoprecipitation에 대 한 네이티브 chromatin를 사용 하 여 네이티브 칩 방법 이며 다른 PFA 고정, 전단 chromatin, 있는 nucleosomes와 다른 DNA 연결 단백질 covalently에 바인딩된 DNA를 사용 하 여 제시 방법 39. 네이티브 칩의 높은 항 체 탐지 레이트와 히스톤 메 틸 화는 염색 질부터 적용 해야 및 히스톤 methylations는 칩에 걸쳐 상대적으로 안정적인. 하지만 시작 물자의 다량이 필요 하 고, 그것에 적용 되지 않습니다 대뇌 나 소 뇌 개발 공부 마우스 두뇌 세포의 수는 일반적으로 제한. 우리는 항 체는 특별히 감소 H3K79me2 신호 칩 정량 분석 및 immunoblots (그림 2A에 DOT1L 리드의 특정 금지 이후 H3K79me2를 감지 하는 것을 증명할 수 있는 항 체는 일반적으로 고정 되지 않은 자료에 대 한 발생, 하지만 및 그림 3A). 교차 연결 된 소재를 사용 하 여 칩, 수도 있지만 제시 프로토콜은 정량 Pcr 및 시퀀싱 분석에 대 한 충분히 구체적으로 풍부한 자료.
이후 SDS 단백질을 변성 하 고 그들이 항 체 바인딩을 위한 효과적인 칩에 대 한 세포의 용 해 버퍼의 SDS 농도, 중요 한 수 있습니다. 이 기능은 특히 중요 한 H3K79me2는 chromatin의 가장 작은 단위22nucleosome 코어 히스톤 3의 구형 도메인 내에 위치한 히스톤 수정. 따라서, H3K79me2에 대 한 분석 결과 중 높은 SDS 농도 (약 0.3 %w / v) 최적의 antigene 접근성을 보장 하기 위해 필요 합니다. IgG 컨트롤 (그림 3)과 입력 (그림 4) 이상이 SDS 농도 함께 우리는 매우 H3K79me2를 풍요롭게 수 있습니다. 따라서, 시퀀싱에 대 한 칩 자료의 품질은 적절 한 하 고 이상의 농축 입력 H3K4me3의 비교 (그림 4). 우리는 같은 SDS 농도 H3K79 모노 또는 trimethylation 마크의 칩에 대 한 필요한 것을 기대 합니다. 일반적으로, 더 엄격한 칩 버퍼, 덜 긍정 chromatin 조각 immunoprecipitated, 경우 항 체의 품질 세제 사용에 의해 영향을 받지 않습니다. 미래를 위해, 히스톤의 구형 도메인 내 다른 히스톤 수정 제시 프로토콜 적용 가능한 수 있습니다.
항 체 칩에 적합 하 고 높은 세제 농도에서 안정, 프로토콜은 주로 두 가지 중요 한 단계를 포함 합니다. 첫째, 세포의 고정 및는 chromatin의 후속 전단 각 세포 유형 및 각 ultrasonicator에 대 한 최적화 되어야 합니다. 장기간 cross-linking 고정 아티팩트를 리드 하 고 이후 항 마스크 수 있습니다 항 체 탐지 레이트를 줄일 수 있습니다. Chromatin 전단 200 및 500 bp (그림 1B) 사이의 DNA의 크기 분포를 지도 하기 위하여 필요 합니다. Nucleosomes 포함 147 bp DNA의. 너무 긴 chromatin 조각 qPCRs에서 거짓 긍정적인 결과 이어질 것입니다. 전체 게놈 시퀀싱 하는 동안 잘못 된 크기 분포 이어질 것입니다 틀린 부정적인 결과 때문에 종종 작은 조각 것으로 간주 됩니다. 두 번째 중요 한 단계는 게놈 넓은 시퀀싱에 대 한 라이브러리 준비 합니다. DNA 증폭 단계 6-9 PCR 주기를 사용 하 여 수행 될 필요가 있다. 이후 그들은 높은 GC 바이어스 및 많은 PCR 중복으로 이어질 수 있습니다 수많은 PCR 주기 방지 하는 것입니다 필수. 제시 프로토콜 필요한 PCR 주기 수를 낮게 유지 하는 충분 한 DNA는 검색할 수 있습니다.
뉴런, oligodendrocytes, 등 명과 셀4셀 종류의 매우 다양 한 양의 뇌 조직에 의하여 이루어져 있다. 개발 하는 동안이 세포는 신경 줄기 세포에서 파생 하 고3시간 및 위치에 따른 방식으로에서 뇌의 특정 영역을 구축. 대뇌 피 질의 성체 예를 들어, E11.5와 E18.5 사이에서 일어난 쥐. E11.5 및 E12.5와 같은 이전 단계에서 거의 모든 세포는 뿌리 정체성1, 하지만 나중에 세포 다양성 고려 되어야 합니다. 따라서, E14.5에서 대뇌 피 질의 조직 칩 H3K79me2 또는 다른 히스톤 수정 특정 시간 시점을 밝힐 수 있다 하지만 셀 형식이 특정 chromatin 기능을 표시할 수 없습니다. 형광 활성화 된 세포 (FACS)를 정렬 또는 정렬 (맥 정렬)40, 즉 뇌 균질 후 가능한 자기 활성화 셀 특정 셀의 농축에 의해이 문제를 해결할 수 있습니다. 맥 정렬 신경 조상 세포 특정 세포 표면 마커를 들고 자석 구슬 표시 될 수 있습니다 그리고40마그네틱 스탠드 사용 하 여 격리. 이후에 세포 배양 수 또는 직접 칩에 대 한 사용. 신경 조상 세포 뿐만 아니라 다른 동종 세포 인구 제시 프로토콜을 사용할 수 있습니다. FACS 또는 맥의 추가, 유기 체 내의 모든 isolatable 셀에 대 한 프로토콜을 적용할 수 있습니다.
함께 찍은, 제시 프로토콜 효율적이 고 재현 가능한 방식으로 대뇌와 소 뇌 개발의 다른 시간 지점에서 히스톤 수정 H3K79me2를 조사 수 있습니다. 그것은 히스톤 코어 내에 있는 다른 히스톤 수정에 적용 되 고 유기 체 내에서 다른 동종 셀 형식에 적용할 수 있습니다. H3K79me2 보존된 히스톤 수정23이기 때문에, 프로토콜은 마우스 뿐만 아니라 다른 종에서 H3K79me2를 분석에 적합 한 수도 있습니다.

두뇌의 감각, 모터, 및 인식 함수는 매우 복잡 하 고 물리적, 환경 변화에 취약 합니다. 깊이 연결 되는 3 개의 일반적인 부품은 뒷 다리-, 중간-및 개, 두뇌에 의하여 이루어져 있다. 개, 내는 telencephalon 등 telencephalon (DT)와 복 부 telencephalon (VT)으로 나눌 수 있습니다. 6 대뇌 피 질의 레이어 E11.5와 E18.5 사이 "내부-아웃" 방식으로1에서 형성 되는 쥐의 DT에 의하여 이루어져 있다. 버몬트 나중 형성 기초 중추2,3개발에 절 정령을 포함 합니다. 여러 종류 나눌 수 있다 신경, 이다, 또는 oligodendrocytes4같은 포유류 중추에서5영역 공간으로에서 발전 하는. 첫째, 신경 조상 세포 (Npc)에 게 상승 다른 종류의 뉴런, 버몬트, 및 프로젝션 뉴런 수 DT에서 그리고 glial 세포 (예를 들면, 이다6) 나중에. 대뇌 피 질의 개발, 가장 표면 층 (전 층), 먼저 형성 된다 Cajal Retzius 셀 포함. 다음, E12.5 및 E14.5, 사이 NPCs 더 깊은 신경 층 (VI, V) 동안 14.5, 16.5, 창시자 줄 상승 상위 레이어 (4-II) 신경7,8사이 생성합니다. 신경 정체성 다른 morphogen 유발 영역 공간 transcriptional 프로그램 및 또한 epigenetic 프로그램2에 의해 지정 됩니다.
모터 조정에 연루는, 소 뇌는 hindbrain에 있으며, 쥐9E10 사이 대략 P20 개발. 그것은 소 뇌 피 질과 소 뇌 핵10포함 되어 있습니다. 3 레이어, 가장 뒤쪽 분자 층, Purkinje 세포 층 그리고 포함 하는 세부적인 신경10안쪽 세분화 된 계층 성인 소 뇌 피 질에 의하여 이루어져 있다. 소 뇌과 립 세포 작은 신경 이며11척 추가 있는 두뇌 모든 뉴런의 약 80%를 나타냅니다. 그들은 선구자 외부 새싹 영역에서 개발 하 고 그들의 대상12Purkinje 세포 층을 통해 이동. 처럼 telencephalon에서 소 뇌의 개발은 몇 가지 중요 한 morphogens에 의해 규제 됩니다, 어떤 특정 시간 및 공간 종속 기능을가지고 시작 정의 transcriptional 프로그램10.
대뇌와 소 뇌 레이어의 개발 특정 morphogens의 transcriptional 식으로 하 고, 따라서, DNA의 염색 질 상태에 의해 제어 됩니다. 단순화 된 보기에서 chromatin 상태 transcriptionally 활성화로 euchromatin와 섬으로 transcriptionally 자동 영역으로 나눌 수 있습니다. Chromatin의 기본 단위로 nucleosome의 복사본 두 개가 각 코어 히스톤 H2A, H2B, H3, H4, 둘러싸인 147 기본적인 쌍 DNA13의 포함 되어 있습니다. 히스톤 메 틸 화, acetylation, 인 산화, ubiquitination, sumoylation, ADP ribosylation, 탈, 그리고 프롤린 isomerization14,15post-translationally 높은 수정 됩니다. 히스톤 lysine 메 틸 화 녹음 방송, 복제, 재결합16, DNA 손상 응답17및 게놈 각 인18제어 하는 가장 안정적인 히스톤 수정 될 여겨진다. Lysines 모노, 디, 또는 트라이 갠19 하 고 액세스할 수 히스톤 꼬리에 뿐만 아니라 히스톤20의 구형 도메인 내의 표시 수 있습니다. H3K4 및 H3K36에 특정 methylations euchromatin와 주로 관련 된, 모든 잔류물은 히스톤 꼬리14, 내에 있는 특정 methylations H3K9, H3K27, 또는 H4K20에 주로 heterochromatic 지구에서 발견은 19,21. H3K79 메 틸 화는 히스톤 구형 도메인 내에 있는 이며 transcriptional 활동, 뿐만 아니라 transcriptionally 불활성 게놈 지역22와 연결 되었습니다. 수정이 효 모, 송아지 흉 선, 닭, 및 인간의23에서 관찰 되었습니다 때문에 진화론 보존 됩니다. H3K79 모노, 디, 및 trimethylation (H3K79me1, me2, me3) 히스톤 methyltransferases DOT1L,2425 와26핵 설정된 도메인에 포함 된 단백질 2 (Nsd2) 의해 촉매 된다. DOT1L 확산, DNA 수리, 및27reprograming 휴대에 연루 이다. 쥐에서 Dot1l 의 손실 발달 단계 E10.5,2829주위 태아 죽음에 이르게. 심장 개발 및 myocardiocyte 차별화, DOT1L 유전자 표현 규칙30에 대 한 필수적입니다. 중앙 신 경계에 DOT1L 기능 신경 튜브 개발31에 연루 수 있습니다, 그것은 Tbr1억제에 관여-개 개발32, 중 식 그리고 ER 스트레스의 규정에서 작동 수 있습니다 응답 유전자33. 부분적으로 이해 하는32만 맞는 활성화 또는 억압 작업과 H3K79me의 특히 중앙 신경 시스템의 개발 같은 경우 vivo에서 날짜입니다. H3K79 메 틸 화는 히스톤 3의 구형 도메인에 위치 하 고 있습니다, 이후 그것은 sterically 유연한 히스톤 꼬리23에 수정에 비해 액세스. H3K79 메 틸 화의 기능을 이해 하려면 그것의 위치 및 게놈 환경 결정을 신뢰성과 재현성 분석 방법 필요 합니다. 이 방법 종이에서는 다른 신경 창시자 (피 질에 대 한 Cpc) 및 소 뇌에 대 한 CGNPs, 효과적인 DOT1L 억제제 치료, 및 칩 메서드 분석 정량 또는 다른 시간에 시퀀싱을 통해 메 틸 H3K79를의 격리 방법 소개 대뇌와 소 뇌 개발 하는 동안 포인트입니다. 에 대 한 프로토콜 및 그것의 가능성의, 그림 1을 참조 하십시오.

<table>
	<tbody>
		<tr>
			<td>Anti-GAPDH</td>
			<td>Abcam</td>
			<td>ab8245</td>
			<td>Category: Antibody 
			Abbreviation/Comment: Immunoblot dilution 1:5000</td>
		</tr>
		<tr>
			<td>Anti-H3</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Category: Antibody 
			Abbreviation/Comment: Immunoblot dilution 1:3000</td>
		</tr>
		<tr>
			<td>Anti-H3K79me2</td>
			<td>Diagenode</td>
			<td>pAb-051-050</td>
			<td>Category: Antibody 
			Abbreviation/Comment: ChIP antibody</td>
		</tr>
		<tr>
			<td>Anti-H3K79me2</td>
			<td>Abcam</td>
			<td>ab-051-050</td>
			<td>Category: Antibody 
			Abbreviation/Comment: Immunoblot dilution 1:1000</td>
		</tr>
		<tr>
			<td>Anti-rabbit-IgG</td>
			<td>Diagenode</td>
			<td>C15410206</td>
			<td>Category: Antibody 
			Abbreviation/Comment: ChIP Ctrl antibody</td>
		</tr>
		<tr>
			<td>Anti-Tubulin alpha</td>
			<td>Abcam</td>
			<td>ab108629</td>
			<td>Category: Antibody 
			Abbreviation/Comment: Immunoblot dilution 1:3000</td>
		</tr>
		<tr>
			<td>Apo-Transferrin (1 mg/ml)</td>
			<td>Sigma-Aldrich</td>
			<td>T1147</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>B27 Supplement (50x)</td>
			<td>Life Technologies</td>
			<td>17504044</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent technologies</td>
			<td>G2940CA</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For analysis of sheared chromatin</td>
		</tr>
		<tr>
			<td>Bioruptor NextGen</td>
			<td>Diagenode</td>
			<td>B01020001</td>
			<td>Category: ChIP 
			Abbreviation/Comment: Ultrasonicator</td>
		</tr>
		<tr>
			<td>Boric acid pH 8.4</td>
			<td>Sigma Aldrich</td>
			<td>B6768</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CPC culturing</td>
		</tr>
		<tr>
			<td>CFX Connect RT PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>1855201</td>
			<td>Category: ChIP Analysis 
			Abbreviation/Comment: Detection system for qPCR</td>
		</tr>
		<tr>
			<td>DMEM-F12</td>
			<td>Life Technologies</td>
			<td>11320-033</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CGM</td>
		</tr>
		<tr>
			<td>Dynabeads Protein A</td>
			<td>Invitrogen</td>
			<td>10001D</td>
			<td>Category: ChIP 
			Abbreviation/Comment: Magnetic beads, for ChIP</td>
		</tr>
		<tr>
			<td>EPZ-5676</td>
			<td>Selleckchem</td>
			<td>S7062</td>
			<td>Category: DOT1L inhibition 
			Abbreviation/Comment: For DOT1L inhibition in cell culture</td>
		</tr>
		<tr>
			<td>Ethylenediamine tetraacetic acid</td>
			<td>SERVA</td>
			<td>39760.01</td>
			<td>Category: ChIP 
			Abbreviation/Comment: EDTA</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum 10% (v/v)</td>
			<td>Gibco</td>
			<td>10082147</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CPC isolation and CGM</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G5767</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CGNP isolation</td>
		</tr>
		<tr>
			<td>Glutathione (1.25 mg/ml)</td>
			<td>Sigma-Aldrich</td>
			<td>G4251</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>3187</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For cell fixation</td>
		</tr>
		<tr>
			<td>GoTaq mastermix</td>
			<td>Promega</td>
			<td>A6002</td>
			<td>Category: ChIP Analysis 
			Abbreviation/Comment: DNA polymerase master mix for qPCR</td>
		</tr>
		<tr>
			<td>Hank&#8217;s Balanced Salt Solution</td>
			<td>Life Technologies</td>
			<td>14025-100</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: HBSS</td>
		</tr>
		<tr>
			<td>L-glutamine (200 mM)</td>
			<td>Life Technologies</td>
			<td>25030081</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>Laminin</td>
			<td>Sigma-Aldrich</td>
			<td>L2020</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CPC culturing</td>
		</tr>
		<tr>
			<td>Lithium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>L4408</td>
			<td>Category: ChIP 
			Abbreviation/Comment: LiCl</td>
		</tr>
		<tr>
			<td>N2 supplement</td>
			<td>Life Technologies</td>
			<td>17502048</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CGM</td>
		</tr>
		<tr>
			<td>NanoDrop 3300</td>
			<td>Thermo Fisher</td>
			<td>3300</td>
			<td>Category: ChIP 
			Abbreviation/Comment: Fluorospectrometer for DNA quantification</td>
		</tr>
		<tr>
			<td>NEB Next Ultra DNA Library Prep Kit for Illumina</td>
			<td>NEB</td>
			<td>E7645S</td>
			<td>Category: ChIP Analysis 
			Abbreviation/Comment: Kit for Library preparation</td>
		</tr>
		<tr>
			<td>NEBNext Multiplex Oligos for Illumina</td>
			<td>NEB</td>
			<td>E7335</td>
			<td>Category: ChIP Analysis 
			Abbreviation/Comment: Oligos for Library preparation</td>
		</tr>
		<tr>
			<td>Neurobasal medium</td>
			<td>Gibco</td>
			<td>21103049</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>NP-40 Alternative</td>
			<td>Calbiochem</td>
			<td>492016</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP buffer</td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Carl Roth</td>
			<td>335</td>
			<td>Category: ChIP 
			Abbreviation/Comment: PFA, for cell fixation</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin-Neomycin 1% (v/v)</td>
			<td>Life Technologies</td>
			<td>15640055</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: PSN, for CCM and CGM</td>
		</tr>
		<tr>
			<td>Phosphate buffered saline</td>
			<td>Life Technologies</td>
			<td>10010023</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: PBS, for CPC isolation</td>
		</tr>
		<tr>
			<td>PicoGreen Kit</td>
			<td>Thermo Fisher</td>
			<td>P11496</td>
			<td>Category: ChIP Analysis 
			Abbreviation/Comment: Visualizing dye for DNA quantification</td>
		</tr>
		<tr>
			<td>Poly-D-lysine</td>
			<td>Sigma-Aldrich</td>
			<td>P6407</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CGNP isolation</td>
		</tr>
		<tr>
			<td>Poly-L-ornithine hydrobromide</td>
			<td>Sigma Aldrich</td>
			<td>P3655</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CPC culturing</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Thermo Fisher</td>
			<td>AM9640G</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: KCl, for CGM</td>
		</tr>
		<tr>
			<td>Protease inhibitor</td>
			<td>Roche</td>
			<td>4693159001</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma-Aldrich</td>
			<td>3115879001</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP</td>
		</tr>
		<tr>
			<td>Qiagen MinElute</td>
			<td>Qiagen</td>
			<td>28004</td>
			<td>Category: ChIP 
			Abbreviation/Comment: Kit for DNA purification</td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Sigma-Aldrich</td>
			<td>R6513</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP</td>
		</tr>
		<tr>
			<td>SGC0946</td>
			<td>Selleckchem</td>
			<td>S7079</td>
			<td>Category: DOT1L inhibition 
			Abbreviation/Comment: For DOT1L inhibition in cell culture</td>
		</tr>
		<tr>
			<td>Sodium bicarbonate</td>
			<td>Carl Roth</td>
			<td>8551.1</td>
			<td>Category: ChIP 
			Abbreviation/Comment: for Elution buffer</td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Carl Roth</td>
			<td>9265</td>
			<td>Category: ChIP 
			Abbreviation/Comment: NaCl, for ChIP buffer</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma-Aldrich</td>
			<td>30970</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP</td>
		</tr>
		<tr>
			<td>Sodium dodecylsulfate</td>
			<td>Carl Roth</td>
			<td>183</td>
			<td>Category: ChIP 
			Abbreviation/Comment: SDS, for ChIP</td>
		</tr>
		<tr>
			<td>Sonic hedgehock (SHH)</td>
			<td>Sigma-Aldrich</td>
			<td>SRP6004</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CGNP isolation</td>
		</tr>
		<tr>
			<td>Superoxide dismutase (1mg/ml)</td>
			<td>Sigma-Aldrich</td>
			<td>S7571</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CCM</td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl)aminomethane</td>
			<td>Carl Roth</td>
			<td>9090</td>
			<td>Category: ChIP 
			Abbreviation/Comment: TRIS, for ChIP buffer</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Carl Roth</td>
			<td>X100</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For ChIP buffer</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA 0,05% (w/v)</td>
			<td>Sigma Aldrich</td>
			<td>59417C</td>
			<td>Category: Cell culture 
			Abbreviation/Comment: For CPC isolation</td>
		</tr>
		<tr>
			<td>Tween20</td>
			<td>Carl Roth</td>
			<td>28320</td>
			<td>Category: ChIP 
			Abbreviation/Comment: For bead preparation</td>
		</tr>
		<tr>
			<td colspan="4">Other Lab devices: Neubauer counting chamber, Incubator, Rotator, Shaker, Disection set, Water bath</td>
		</tr>
		<tr>
			<td>CCM: Cortical cell medium</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CGM: CGNP cell culture medium</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and cultivation of neural progenitors followed by chromatin-immunoprecipitation of histone 3 lysine 79 dimethylation mark

두뇌 개발 transcriptional 프로그램과 다른 morphogens의 기울기로 영역 공간 방식으로 제어 되는 복잡 한 과정 이다. 또한, 히스톤 메 틸 화 처럼 epigenetic chromatin 수정 설치 하 고이 프로세스에서 특정 세포 운명을 유지에 대 한 중요 한 역할이 있다. 대부분 히스톤 메 틸 화는 히스톤 한정자, 지우개, 및 히스톤 리더 단백질 유연한 히스톤 꼬리에 발생 합니다. 대조적으로, H3K79 메 틸 화는 히스톤 3의 구형 도메인에 있으며 다른 발달 기능에 연루. H3K79 메 틸 화 봤을 보존 하 고 찾을 수 있습니다 다양 한 종에서에서 호모 사피엔스 에서 Saccharomyces cerevisiae. 수정 신경 창시자를 포함 한 유기 체 내의 다른 세포 인구에서 발생 합니다. 히스톤 3의 구형 도메인에서 H3K79 메 틸 화의 위치는 평가 하기 어려운 있습니다. 여기, 우리가 격리 하는 방법을 제시 하 고 문화 대뇌 피 질의 조상 세포 (Cpc) 배아 대뇌 피 질의 뇌 조직 (E11.5-E14.5) 또는 소 뇌과 립 상 신경 창시자 (CGNPs)에서 출생 후 조직 (P5-P7), 그리고 효율적으로 immunoprecipitate에서 정량 PCR (정량) 및 게놈 넓은 시퀀싱에 대 한 H3K79me2.

신경 조상 격리, 재배, H3K79me2 칩과 칩 분석 방법의 일반적인 계획: 그림 1 H3K79me2 칩 또는 소 뇌과 립 상 신경 창시자의 미 발달 두뇌 개발 하는 동안 다른 시간 지점에서 대뇌 피 질의 조상 세포의 출생 후 단계에서 수행 하는 순서도 보여 줍니다. 첫 번째 단계로 뇌 격리 하 고 telencephalon (E11.5 E14.5 사이) 또는 소 뇌 (P5-P7)을 검색할 수 있다. DT는 VT로 나누어는 telencephalon의 다른 지구를 분석 가능 이후에 조직 균질 것 이다 고 신경 창시자 차별. 지금, 그것은 뿌리 세포 문화 DOT1L 억제제와 그들을 치료 하입니다. 또 다른 가능성은 창시자를 직접 수정 하 여 칩 절차 그들의 대상이입니다. 칩,는 chromatin 200-500 bp의 조각으로 전단 고 H3K79me2에 대 한 자석 구슬 결합 항 체로 그 후 인 큐베이 팅 됩니다. 비즈를 세척 하 고 DNA를 검색, 후 침전 된 DNA 시퀀싱 또는 정량 (그림 1A)를 분석할 수 있습니다. 그것은 다른 방법 ( 그림 1B에서 예) 또는 DNA 젤 전기 이동 법으로 조각 크기를 확인 하는 것이 좋습니다 그래서 전단, 후 chromatin 조각의 좋은 크기 분포를가지고 필수적입니다. 선택할 때 전체 게놈 시퀀싱, 추가 분석 (그림 1C)에 대 한 칩-seq-읽기 H3K79me2 인 fastq 파일로 제공 됩니다. 시퀀싱의 품질 FastQC의 응용 프로그램에 의해 평가 읽어들이고, 필요한 경우, fastq 파일 수 트림 TrimGalore를 사용 하 여. 생쥐 게놈 mm9 또는 mm10 매핑 Bowtie2를 사용 하 여 수행 하 고 PlotFingerprint을 통해 제어할 수 있습니다. 그것은 MarkDuplicates와 중복 제거 BamCoverage에 의해 읽기를 정상화 하 고 BamCompare와 입력 샘플 칩을 비교 하는 것이 좋습니다. 칩 seq 읽기 이후 시각화 된 게놈 넓은 heatmaps 또는 gene-wise 통합 게놈 뷰어 (IGV) 브라우저 세션에서 수 있습니다.
CPC 문화와 DOT1L 억제: Cpc는 고립 되었고 0 일과 2 일에 5 µ M DOT1L 억제제 SGC0946로 치료. 솔벤트 DMSO 컨트롤으로 사용 되었다. 3 일에 Cpc 수확 했다, 단백질 분리, 정량, 되었고 immunoblot (그림 2A)을 통해 분석. 그림 2A H3K79me2 수준을 효과적으로 CPC 경작 및 효과적인 억제제 치료 계획을 보장 하는 DOT1L 저해의 3 일 후에 감소를 보여 줍니다. 단백질 양의 H3, GAPDH, 또는 Tubulin 알파 컨트롤 로드로 봉사 했다 그로 인하여 장애. 같이 활성 caspase 3 (CASP3 +) apoptosis, HuC/D 시각화 하는 신경 세포에 대 한 검색에 대 한 항 체와 고정된 Cpc의 Immunostaining 문화, 3 일 후 증가 세포 죽음으로 이끌어 냈다 DOT1L 억제제와 Cpc의 그 치료를 표시 그림 2B. CASP3는 세포의 부 량 + DAPI + 또는 HuC/D + DAPI + CPC 문화 내에서 CASP3 + 셀 DOT1L 저해 시 세포 죽음 프로그램 공개의 상당한 상승 밝혀. 그러나 HuC/D-긍정적인 뉴런의 수는, 변경 되지 않은 (그림 2C) 남아 있었다.
Aft4, Ddit3, Scd1, Aft3, 및 Npm1 Cpc에서의 H3K79me2 칩 정량 DOT1L 억제제로 치료: DOT1L SGC0946 억제제 치료는 효율적이 고 H3K79me2의 특정 한 감소에 지도 하는 경우를 테스트 하려면 유전자, 우리 뒤에 3 일 동안 치료 하는 CPC의 정량 칩 분석 수행. 토끼 IgG 칩 제어로 사용 되었다. H3K79me2은 endoplasmatic 스트레스 반응 유전자 Aft4, Ddit3, Scd1, 및 Aft3 핵 수송 유전자 Npm133,38에에 위치 해 있습니다 알려져, 이후 우리가 사용 TSS, TES, 및 유전자 본문 내의 게놈 영역 H3K79me2 배포 DOT1L 억제 (그림 3A) 후에 차이 확인 하려면 취재 한 정량 Pcr 뇌관 유전자 H3K79me2 상부를 첫 번째 장소에서 같은 Atf4, Ddit3, 고 Npm1 억제제 치료에 가장 반응 했다 DOT1L의 저해의 3 일에 중요 한 지도 그래야 감소 H3K79me2의. Atf3 등 Scd1, 낮은 H3K79me2 범위와 유전자 H3K79me2 수준에 중요 한 변화가 나타났다.
개요의 H3K79me2 칩 seq 분석: E14.5, 수행 및 발표 계획 및 프로토콜 (그림 1), 분석에서 Cpc에서 H3K79me2 레벨의 게놈 넓은 분석 매우 고품질을 칩을 공개 했다. 지문 오 점 (그림 4A)에 입력된 읽기의 그들의 주파수에 따라 범주화 된 카운트, 균등 하 게 배 부 되었다, 반면 H3K79me2 건의 했다 성공 표시 되는 특정 지역 (쓰레기통 1 위)에 농축 염색 질 조각 H3K79에 축적 따라 유전자 그들의 TSS와 그들의 TES 사이 및 10 Kb 업스트림 또는 다운스트림 + H3K79me2의 heatmap 보여준다 (그림 4B)는 H3K79me2 봉우리는 TSS 주위 하 고 일반적으로 TES 감소. H3K79me2 완전히 덮여 있다, 유전자 및 유전자, TSS 지역 내 에서만 피크를가지고 있다. Endoplasmatic-스트레스 관련 유전자 Atf4와 같은 Ddit3, 및 nucleophosmin Npm1 항구, 전체 유전자 몸 (그림 4C) 따라 약간 감소 TSS에 예를 들어, 높은 H3K79me2 수준. 반면, Scd1 는 TSS와 아무 H3K79me2 유전자 신체 내에서 낮은 H3K79me2 인이 있다. 마지막 예제로 Atf3 다른 샤 프 하 고 낮은 수준의 H3K79me2 봉우리 진 몸 따라 있다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56631/56631fig1.jpg"> 그림 1: 격리 된 Cpc 또는 CGNPs 및 시퀀싱 분석의 순서도에서 H3K79me2 칩 프로토콜의 계획. (A) 제시 프로토콜의 개요. CPC 격리에 대 한 첫 번째 E14.5 두뇌 격리 되며 필요한 경우는 외피가 DT와 버몬트로 분할 될 수 있다. CGNPs, cerebelli P5-P7 쥐에서 검색할 수 있다. 조직 될 것 이다 무 균는 창시자는 차별, 그리고 셀 수 수 경작 및 적절 한 억제제로 치료 또는 직접 칩에 대 한 사용. 칩에 대 한 고정은 고 chromatin의 제어로 전단 및 안티-H3K79me2 항 체와 토끼 IgG immunoprecipitation에 선행 된다. DNA 정화 후 칩 샘플 라이브러리 준비 및 시퀀싱을 통해 분석할 수 있습니다 또는 통해 정량 분석할 수 있다. (B) 적절 하 고 부적 절 한 품질 chromatin의 예. DNA 조각 배포 혈압에에서 표시 됩니다. (C) 칩 seq 결과 프라이부르크/갤럭시 서버에서 분석 파이프라인을 받게 될 수 있습니다. 품질 관리 (FastQC), 후 읽기 TrimGalore 손질 고 마우스 게놈 (에 제시 경우 mm9)에 Bowtie2를 통해 매핑된 될 수 있습니다. PlotFingerprint 칩의 품질을 평가합니다. H3K79me2에 대 한 봉우리를 정의 하려면 MACSpeaks는 적용할 수 있습니다. 정규화 BamCoverage 및 입력된 BamCompare 비교를 위해 사용할 수 있습니다. 시각화 결과 IGV 브라우저와 heatmaps는 적당 하다. 예상된 파일 서식은 이탤릭체는. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56631/56631fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56631/56631fig2.jpg"> 그림 2: 대뇌 피 질의 뿌리 문화 및 DOT1L 저해. (A) Immunoblots DOT1L 저해 3 일 후에 E14.5에서 CPC H3K79me2 수준을 보여주는 (주 3, n = 3-11) DMSO 컨트롤에 비해. H3, GAPDH, Tubulin 알파 컨트롤 로드로 사용 되었다. (B) Immunocytological 2-3 일에 CPC의 문화의 얼룩. 활성화 된 Caspase 3 (CASP3 녹색)-긍정적인 세포와 뉴런 (HuC/d: 레드) 얼룩이 있었다. DAPI (파란색)는 세포 핵을 시각화 하기 위해 사용 되었다. 눈금 막대: 100 µ m.는 immunostainings의 부 량 (C) (B)에 제시. CASP3에 대 한 긍정적인 세포의 비율 + DAPI + 또는 HuC/D + DAPI + %에는 주어진. 통계 분석에 대 한 짝이 없는 학생의 t-테스트가 수행 되었습니다. p < 0.01 * *. 이 수치는 Roidl 그 외 여러분 에서 수정 된 33 , 38 <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56631/56631fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56631/56631fig3.jpg"> 그림 3: Aft4, Ddit3, Aft3, Scd1, 및 Npm1 Cpc에서의 H3K79me2 칩 정량 DOT1L 억제제로 치료. (A) E14.5 파생 Cpc 5 µ M DOT1L 억제 물 4-5 h로 치료 했다 격리 후 그리고 문화에서 하루 2에서 두 번째 시간. Cpc는 하루 3, chromatin 추출, 칩 실험 및 정량에 선행 되었다에 고정 했다. 결과 입력 (SEM) + 평균 %로 표시 됩니다 (n = 3). IgG 부정적인 제어로 사용 되었다. IgG 레벨의 의미는 파선으로 묘사 된다. 통계 분석에 대 한 양방향 ANOVA는 적용 했다. p < 005 *; p < 0.01 * *, p < 0.001 * * *; TSS transcriptional 시작 사이트, TES transcriptional 끝 사이트. 이 수치는 Roidl 그 외 여러분 에서 수정 된 33 , 38 <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56631/56631fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56631/56631fig4.jpg"> 그림 4: H3K79me2 칩 seq 분석의 개요. (A) 입력에 비해 E14.5 파생 Cpc에서 지문의 H3K79me2 칩 seq 높은 칩 seq 품질 H3K79me2에 대 한 DNA 파편의 농축을 보여줍니다. (B) H3K79me2 칩 seq 결과 heatmap에 플롯. 강하게 풍부한 게놈 지역 파란색으로 표시 됩니다. (짙은 빨간색)-0를 스케일링 45 (진한 파란색). H3K79me2는 TSS 근처 봉우리와 TES 3´로에서 하락. (C) H3K79me2 칩 seq 읽기 mm9 게놈에 매핑된 되었고 통합 게놈 뷰어 (IGV)와 시각. 유전자의 H3K79me2 인 칩 당 kilobase 당 입력된 읽기 사이의 읽기 비율 수의 log2 표시 됩니다 백만 (비율:-10 ~ 10). 빨간색 상자는 TSS를 포함 하 여 첫 번째 엑손 나타냅니다 Refseq 유전자 구조가 표시 됩니다. Aft4, Ddit3, Scd1, Aft3, 및 Npm1 유전자 표시 됩니다. 비교를 위해 동일한 게놈 영역의 H3K4me3 신호 표시 됩니다. TSS transcriptional 시작 사이트, TES transcriptional 끝 사이트. 이 그림은 Roidl38에서 수정 되었습니다. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56631/56631fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>유전자</td>
			<td>지역</td>
			<td colspan="2">뇌관은 앞으로 5'-3'</td>
			<td colspan="2">뇌관 리버스 5'-3'</td>
		</tr>
<tr>
<td>Aft4</td>
			<td>TSS</td>
			<td colspan="2">GGACGATCTCTAACGCCACA</td>
			<td colspan="2">GCCCTAAACCCGCCCTTTAT</td>
		</tr>
<tr>
<td>Aft4</td>
			<td>TSS + 1500</td>
			<td colspan="2">CTCCCGAATATGACATGAACCG</td>
			<td colspan="2">TCCATTCGAAACAGAGCATCG</td>
		</tr>
<tr>
<td>Aft4</td>
			<td>TES</td>
			<td colspan="2">CCGTAATAGGGTAGTCAGGTGC</td>
			<td colspan="2">AAAGAATGACACTGAAAACCCACA</td>
		</tr>
<tr>
<td>Ddit3</td>
			<td>TSS</td>
			<td colspan="2">GTACTGGCTCCGTCTAACCC</td>
			<td colspan="2">CAAGAGAGGGCCTGTAAGCA</td>
		</tr>
<tr>
<td>Ddit3</td>
			<td>TSS + 2500</td>
			<td colspan="2">TCAAGCAGCCGGTCTCATAG</td>
			<td colspan="2">CTCAGATCCCCCAATGGCTT</td>
		</tr>
<tr>
<td>Ddit3</td>
			<td>TSS + 4500</td>
			<td colspan="2">GAGCTGGAAGCCTGGTATGA</td>
			<td colspan="2">TCACCTCTTCGTTTCCTGGG</td>
		</tr>
<tr>
<td>Ddit3</td>
			<td>TES</td>
			<td colspan="2">CACCAAGCATGAACAGTGGG</td>
			<td colspan="2">GTACCGTCTATGTGCAAGCC</td>
		</tr>
<tr>
<td>Aft3</td>
			<td>TSS</td>
			<td colspan="2">AACTGAGAGCGCAACTCCTC</td>
			<td colspan="2">GCTGCCGTTCTTAGCTGGTA</td>
		</tr>
<tr>
<td>Aft3</td>
			<td>TES</td>
			<td colspan="2">CTGTTGGCACAAAGTGGCTC</td>
			<td colspan="2">GGGATCTGCCATGGTGGAAA</td>
		</tr>
<tr>
<td>Scd1</td>
			<td>TSS</td>
			<td colspan="2">TAGTGACCACACACAAAAGCTC</td>
			<td colspan="2">CCCAAGTGTAATTTGGATGATTTCC</td>
		</tr>
<tr>
<td>Npm1</td>
			<td>TSS</td>
			<td colspan="2">TCCCCCTCCAGTCAGTTACC</td>
			<td colspan="2">CGTCCTTTCCTTGGCGTGA</td>
		</tr>
<tr>
<td>Npm1</td>
			<td>TES</td>
			<td colspan="2">AGGGACATACTTAAGACAAGCCAG</td>
			<td colspan="2">AGGATTGAGGCAGACTGTCAAT</td>
		</tr>
<tr>
<td colspan="2">TSS: Transcriptional 시작 사이트</td>
			<td colspan="2"></td>
			<td colspan="2"></td>
		</tr>
<tr>
<td colspan="2">TES: Transcriptional 끝 사이트</td>
			<td colspan="2"></td>
			<td colspan="2"></td>
		</tr>
</tbody></table>표 1: 칩 정량에 사용 되는 뇌관의 목록입니다.

Watch this Scientific Journal Video about Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark at JoVE.com

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

절연 및 신경 창시자 Chromatin-Immunoprecipitation 히스톤 3 리 79 Dimethylation 마크의 뒤의 재배

우리 신경 조상 세포의 히스톤 3 리 79 dimethylation (H3K79me2)-내에 있는 히스톤 마크 chromatin immunoprecipitation (칩)에 대 한 미 발달 및 출생 후 뇌 조직에서 문화를 격리 하는 효과적이 고 재현 가능한 방법을 제시는 히스톤 3의 구형 도메인입니다.

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

isolation-cultivation-neural-progenitors-followed-chromatin

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Neuroscience

Unit 2

Analyzing Gene Expression and Function

SCIENTISTS IN ACTION

7.4K 조회수.  University of Freiburg. 우리 신경 조상 세포의 히스톤 3 리 79 dimethylation (H3K79me2)-내에 있는 히스톤 마크 chromatin immunoprecipitation (칩)에 대 한 미 발달 및 출생 후 뇌 조직에서 문화를 격리 하는 효과적이 고 재현 가능한 방법을 제시는 히스톤 3의 구형 도메인입니다.

비디오: Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Production of Chick Embryo Extract for the Cultivation of Murine Neural Crest Stem Cells

The neural crest arises from the neuro-ectoderm during embryogenesis and persists only temporarily. Early experiments already proofed pluripotent progenitor cells to be an integral part of the neural crest1. Phenotypically, neural crest stem cells (NCSC) are defined by simultaneously expressing p75 (low-affine nerve growth factor receptor, LNGFR) and SOX10 during their migration from the neural crest2,3,4,5. These progenitor cells can differentiate into smooth muscle cells, chromaffin cells, neurons and glial cells, as well as melanocytes, cartilage and bone6,7,8,9. To cultivate NCSC in vitro, a special neural crest stem cell medium (NCSCM) is required10. The most complex part of the NCSCM is the preparation of chick embryo extract (CEE) representing an essential source of growth factors for the NCSC as well as for other types of neural explants. Other NCSCM ingredients beside CEE are commercially available. Producing CCE using laboratory standard equipment it is of high importance to know about the challenging details as the isolation, maceration, centrifugation, and filtration processes. In this protocol we describe accurate techniques to produce a maximized amount of pure and high quality CEE.

To cultivate neural crest stem cells (NCSC) in vitro, a special medium (NCSCM) is required. Essential part of NCSCM is chick embryo extract (CEE). We here describe accurate techniques to produce a maximized amount of pure and high quality CEE, including details as the isolation, maceration, centrifugation, and filtration processes.

Murine 신경 크레스트 줄기 세포의 배양 칙의 배아 추출 생산

The neural crest arises from the neuro-ectoderm during embryogenesis and persists only temporarily. Early experiments already proofed pluripotent ...

연구

신경과학

Physiological, Morphological and Neurochemical Characterization of Neurons Modulated by Movement

The role of individual neurons and their function in neuronal circuits is fundamental to understanding the neuronal mechanisms of sensory and motor functions. Most investigations of sensorimotor mechanisms rely on either examination of neurons while an animal is static1,2 or record extracellular neuronal activity during a movement.3,4 While these studies have provided the fundamental background for sensorimotor function, they either do not evaluate functional information which occurs during a movement or are limited in their ability to fully characterize the anatomy, physiology and neurochemical phenotype of the neuron. A technique is shown here which allows extensive characterization of individual neurons during an in vivo movement. This technique can be used not only to study primary afferent neurons but also to characterize motoneurons and sensorimotor interneurons. Initially the response of a single neuron is recorded using electrophysiological methods during various movements of the mandible followed by determination of the receptive field for the neuron. A neuronal tracer is then intracellularly injected into the neuron and the brain is processed so that the neuron can be visualized with light, electron or confocal microscopy (Fig. 1). The detailed morphology of the characterized neuron is then reconstructed so that neuronal morphology can be correlated with the physiological response of the neuron (Figs. 2,3). In this communication important key details and tips for successful implementation of this technique are provided. Valuable additional information can be determined for the neuron under study by combining this method with other techniques. Retrograde neuronal labeling can be used to determine neurons with which the labeled neuron synapses; thus allowing detailed determination of neuronal circuitry. Immunocytochemistry can be combined with this method to examine neurotransmitters within the labeled neuron and to determine the chemical phenotypes of neurons with which the labeled neuron synapses. The labeled neuron can also be processed for electron microscopy to determine the ultrastructural features and microcircuitry of the labeled neuron. Overall this technique is a powerful method to thoroughly characterize neurons during in vivo movement thus allowing substantial insight into the role of the neuron in sensorimotor function.

A technique is described to quantify the in vivo physiological response of mammalian neurons during movement and correlate the physiology of the neuron with neuronal morphology, neurochemical phenotype and synaptic microcircuitry.

운동에 의해 변조된 뉴런의 생리, 형태학의 및 Neurochemical 특성화

The role of individual neurons and their function in neuronal circuits is fundamental to understanding the neuronal mechanisms of sensory and motor ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after injury (Teng et al., 2006). It is recognized that transcriptional programs essential for neurite and axonal outgrowth are 
reactivated upon injury in the PNS (Makwana et al., 2005). However the tools available to analyze neuronal gene regulation in vivo are limited and 
often challenging.
The dorsal root ganglia (DRG) offer an excellent injury model system because both the CNS and PNS are innervated by a 
bifurcated axon originating from the same soma. The ganglia represent a discrete collection of cell bodies where all transcriptional events occur, 
and thus provide a clearly defined region of transcriptional activity that can be easily and reproducibly removed from the animal. Injury of nerve 
fibers in the PNS (e.g. sciatic nerve), where axonal regeneration does occur, should reveal a set of transcriptional programs that are distinct from 
those responding to a similar injury in the CNS, where regeneration does not take place (e.g. spinal cord). Sites for transcription factor binding, 
histone and DNA modification resulting from injury to either PNS or CNS can be characterized using chromatin immunoprecipitation (ChIP). 
Here, we describe a ChIP protocol using fixed mouse DRG tissue following axonal injury. This powerful combination provides a means for characterizing the pro-regeneration chromatin environment necessary for promoting axonal regeneration.

We present a method for chromatin immunoprecipitation from dorsal root ganglia tissue following axonal injury. The approach can be used to identify specific transcription factor binding sites and epigenetic modification of histone and DNA important for the regeneration of injured axons in both the peripheral and central nervous system.

Axonal 상해 다음 도설 루트 신경 조직에서 염색질의 Immunoprecipitation

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Microregional Hypoxia in Mouse Cerebral Cortex by Two-photon Imaging of Endogenous NADH Fluorescence

The brain's ability to function at high levels of metabolic demand depends on continuous oxygen supply through blood flow and tissue oxygen diffusion. Here we present a visualized experimental and methodological protocol to directly visualize microregional tissue hypoxia and to infer perivascular oxygen gradients in the mouse cortex. It is based on the non-linear relationship between nicotinamide adenine dinucleotide (NADH) endogenous fluorescence intensity and oxygen partial pressure in the tissue, where observed tissue NADH fluorescence abruptly increases at tissue oxygen levels below 10 mmHg1. We use two-photon excitation at 740 nm which allows for concurrent excitation of intrinsic NADH tissue fluorescence and blood plasma contrasted with Texas-Red dextran. The advantages of this method over existing approaches include the following: it takes advantage of an intrinsic tissue signal and can be performed using standard two-photon in vivo imaging equipment; it permits continuous monitoring in the whole field of view with a depth resolution of ~50 &mu;m. We demonstrate that brain tissue areas furthest from cerebral blood vessels correspond to vulnerable watershed areas which are the first to become functionally hypoxic following a decline in vascular oxygen supply. This method allows one to image microregional cortical oxygenation and is therefore useful for examining the role of inadequate or restricted tissue oxygen supply in neurovascular diseases and stroke.

Here we describe a method to directly visualize microregional tissue hypoxia in the mouse cortex in vivo. It is based on concurrent two-photon imaging of nicotinamide adenine dinucleotide (NADH) and the cortical microcirculation. This method is useful for high resolution analysis of tissue oxygen supply.

내생 NADH 형광의 2 광자 이미징에 의한 마우스 대뇌 피질의 Microregional Hypoxia의 탐지

The brain's ability to function at high levels of metabolic demand depends on continuous oxygen supply through blood flow and tissue oxygen diffusion. ...

Reproducible Mouse Sciatic Nerve Crush and Subsequent Assessment of Regeneration by Whole Mount Muscle Analysis

Regeneration in the peripheral nervous system (PNS) is widely studied both for its relevance to human disease and to understand the robust regenerative response mounted by PNS neurons thereby possibly illuminating the failures of CNS regeneration1. Sciatic nerve crush (axonotmesis) is one of the most common models of peripheral nerve injury in rodents2. Crushing interrupts all axons but Schwann cell basal laminae are preserved so that regeneration is optimal3,4. This allows the investigator to study precisely the ability of a growing axon to interact with both the Schwann cell and basal laminae4. Rats have generally been the preferred animal models for experimental nerve crush. They are widely available and their lesioned sciatic nerve provides a reasonable approximation of human nerve lesions5,4. Though smaller in size than rat nerve, the mouse nerve has many similar qualities. Most importantly though, mouse models are increasingly valuable because of the wide availability of transgenic lines now allows for a detailed dissection of the individual molecules critical for nerve regeneration6, 7. Prior investigators have used multiple methods to produce a nerve crush or injury including simple angled forceps, chilled forceps, hemostatic forceps, vascular clamps, and investigator-designed clamps8,9,10,11,12. Investigators have also used various methods of marking the injury site including suture, carbon particles and fluorescent beads13,14,1. We describe our method to obtain a reproducibly complete sciatic nerve crush with accurate and persistent marking of the crush-site using a fine hemostatic forceps and subsequent carbon crush-site marking. As part of our description of the sciatic nerve crush procedure we have also included a relatively simple method of muscle whole mount we use to subsequently quantify regeneration.

In this report we describe a method to crush mouse sciatic nerve. This method uses readily available hemostatic forceps and easily and reproducibly produces complete sciatic nerve crush. In addition, we describe a method to prepare muscle whole mounts suitable for analysis of nerve regeneration after sciatic nerve crush.

전체 마운트 근육 분석에 의한 재현성 마우스 좌골 신경 크러시와 중생의 후속 평가

Regeneration in the peripheral nervous system (PNS) is widely studied both for its relevance to human disease and to understand the robust regenerative ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

배아 Murine 신경 튜브에서 신경 크레스트 세포의 분리 및 문화

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the intestine and lower urinary tract. Both during development and in mature tissues these cells are often widely dispersed throughout tissues so that isolation of discrete populations using methods like laser capture micro-dissection is difficult. They can however be directly visualized by expression of fluorescent reporters driven from regulatory regions of neuron-specific genes like Tyrosine hydroxylase (TH). We describe a method optimized for high yields of viable TH+ neuronal progenitors from fetal mouse visceral tissues, including intestine and lower urogenital tract (LUT), based on dissociation and fluorescence-activated cell sorting (FACS). 
The Th gene encodes the rate-limiting enzyme for production of catecholamines. Enteric neuronal progenitors begin to express TH during their migration in the fetal intestine1 and TH is also present in a subset of adult pelvic ganglia neurons2-4 . The first appearance of this lineage and the distribution of these neurons in other aspects of the LUT, and their isolation has not been described. Neuronal progenitors expressing TH can be readily visualized by expression of EGFP in mice carrying the transgene construct Tg(Th-EGFP)DJ76Gsat/Mmnc1. We imaged expression of this transgene in fetal mice to document the distribution of TH+ cells in the developing LUT at 15.5 days post coitus (dpc), designating the morning of plug detection as 0.5 dpc, and observed that a subset of neuronal progenitors in the coalescing pelvic ganglia express EGFP. 
To isolate LUT TH+ neuronal progenitors, we optimized methods that were initially used to purify neural crest stem cells from fetal mouse intestine2-6. Prior efforts to isolate NC-derived populations relied upon digestion with a cocktail of collagenase and trypsin to obtain cell suspensions for flow cytometry. In our hands these methods produced cell suspensions from the LUT with relatively low viability. Given the already low incidence of neuronal progenitors in fetal LUT tissues, we set out to optimize dissociation methods such that cell survival in the final dissociates would be increased. We determined that gentle dissociation in Accumax (Innovative Cell Technologies, Inc), manual filtering, and flow sorting at low pressures allowed us to achieve consistently greater survival (&gt;70% of total cells) with subsequent yields of neuronal progenitors sufficient for downstream analysis. The method we describe can be broadly applied to isolate a variety of neuronal populations from either fetal or adult murine tissues.

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An optimized procedure to purify neural crest-derived neuronal progenitors from fetal mouse tissues is described. This method takes advantage of expression from fluorescent reporter alleles to isolate discrete populations by fluorescence-activated cell sorting (FACS). The technique can be applied to isolate neuronal subpopulations throughout development or from adult tissues.

태아 쥐의 내장 장기에서 자율 신경 Progenitors의 형광 - 활성 셀 정렬 (FACS) 절연을위한 최적화된 절차

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Promotion of Survival and Differentiation of Neural Stem Cells with Fibrin and Growth Factor Cocktails after Severe Spinal Cord Injury

Neural stem cells (NSCs) can self-renew and differentiate into neurons and glia. Transplanted NSCs can replace lost neurons and glia after spinal cord injury (SCI), and can form functional relays to re-connect spinal cord segments above and below a lesion. Previous studies grafting neural stem cells have been limited by incomplete graft survival within the spinal cord lesion cavity. Further, tracking of graft cell survival, differentiation, and process extension had not been optimized. Finally, in previous studies, cultured rat NSCs were typically reported to differentiate into glia when grafted to the injured spinal cord, rather than neurons, unless fate was driven to a specific cell type. To address these issues, we developed new methods to improve the survival, integration and differentiation of NSCs to sites of even severe SCI. NSCs were freshly isolated from embryonic day 14 spinal cord (E14) from a stable transgenic Fischer 344 rat line expressing green fluorescent protein (GFP) and were embedded into a fibrin matrix containing growth factors; this formulation aimed to retain grafted cells in the lesion cavity and support cell survival. NSCs in the fibrin/growth factor cocktail were implanted two weeks after thoracic level-3 (T3) complete spinal cord transections, thereby avoiding peak periods of inflammation. Resulting grafts completely filled the lesion cavity and differentiated into both neurons, which extended axons into the host spinal cord over remarkably long distances, and glia. Grafts of cultured human NSCs expressing GFP resulted in similar findings. Thus, methods are defined for improving neural stem cell grafting, survival and analysis of in vivo findings.

Fibrin matrices containing growth factors were used to retain grafted neural stem cells into sites of complete spinal cord transection. Grafted cells completely filled the lesion cavity and differentiated into multiple neural cell types, including neurons that extended axons into host spinal cord over long distances.

중증 척수 손상 후 섬유소 및 성장 인자 칵테일 신경 줄기 세포의 생존 및 분화 촉진

Neural stem cells (NSCs) can self-renew and differentiate into neurons and glia. Transplanted NSCs can replace lost neurons and glia after spinal cord ...

A Quantitative Cell Migration Assay for Murine Enteric Neural Progenitors

Neural crest cells (NCC) are a transient and multipotent cell population that originates from the dorsal neural tube and migrates extensively throughout the developing vertebrate embryo. In addition to providing peripheral glia and neurons, NCC generate melanocytes as well as most of the cranio-facial skeleton. NCC migration and differentiation is controlled by a combination of their axial origin along the neural tube and their exposure to regionally distinct extracellular cues. Such contribution of extracellular ligands is especially evident during the formation of the enteric nervous system (ENS), a complex interconnected network of neural ganglia that locally controls (among other things) gut muscle movement and intestinal motility. Most of the ENS is derived from a small initial pool of NCC that undertake a long journey in order to colonize - in a rostral to caudal fashion - the entire length of the prospective gut. Among several signaling pathways known to influence enteric NCC colonization, GDNF/RET signaling is recognized as the most important. Indeed, spatiotemporally controlled secretion of the RET ligand GDNF by the gut mesenchyme is chiefly responsible for the attraction and guidance of RET-expressing enteric NCC to and within the embryonic gut. Here, we describe an ex vivo cell migration assay, making use of a transgenic mouse line possessing fluorescently labeled NCC, which allows precise quantification of enteric NCC migration potential in the presence of various growth factors, including GDNF.

We present an ex vivo cell migration assay that allows precise quantification of enteric neural crest cell migration potential in the presence of various growth factors.

쥐과 장내 신경 전구 세포에 대한 양이 세포 이동의 분석

Neural crest cells (NCC) are a transient and multipotent cell population that originates from the dorsal neural tube and migrates extensively throughout ...

Isolation and Quantification of Botulinum Neurotoxin From Complex Matrices Using the BoTest Matrix Assays

Accurate detection and quantification of botulinum neurotoxin (BoNT) in complex matrices is required for pharmaceutical, environmental, and food sample testing. Rapid BoNT testing of foodstuffs is needed during outbreak forensics, patient diagnosis, and food safety testing while accurate potency testing is required for BoNT-based drug product manufacturing and patient safety. The widely used mouse bioassay for BoNT testing is highly sensitive but lacks the precision and throughput needed for rapid and routine BoNT testing. Furthermore, the bioassay&#39;s use of animals has resulted in calls by drug product regulatory authorities and animal-rights proponents in the US and abroad to replace the mouse bioassay for BoNT testing. Several in vitro replacement assays have been developed that work well with purified BoNT in simple buffers, but most have not been shown to be applicable to testing in highly complex matrices. Here, a protocol for the detection of BoNT in complex matrices using the BoTest Matrix assays is presented. The assay consists of three parts: The first part involves preparation of the samples for testing, the second part is an immunoprecipitation step using anti-BoNT antibody-coated paramagnetic beads to purify BoNT from the matrix, and the third part quantifies the isolated BoNT&#39;s proteolytic activity using a fluorogenic reporter. The protocol is written for high throughput testing in 96-well plates using both liquid and solid matrices and requires about 2 hr of manual preparation with total assay times of 4-26 hr depending on the sample type, toxin load, and desired sensitivity. Data are presented for BoNT/A testing with phosphate-buffered saline, a drug product, culture supernatant, 2% milk, and fresh tomatoes and includes discussion of critical parameters for assay success.

The BoTest Matrix botulinum neurotoxin (BoNT) detection assays rapidly purify and quantify BoNT from a range of sample matrices.&#160;Here, we present a protocol for the detection and quantification of BoNT from both solid and liquid matrices and demonstrate the assay with BOTOX, tomatoes, and milk.

BoTest 매트릭스 분석 실험을 사용하여 복잡한 매트릭스에서 분리 및 보툴리눔 신경 독소의 정량화

Accurate detection and quantification of botulinum neurotoxin (BoNT) in complex matrices is required for pharmaceutical, environmental, and food sample ...