Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00.000+00:00
Duration: 13 min 14 s
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

우리는 전문가 기술 지원을 위한 Cytometry 시설 "CytoCell" (SFR 건강, Biogenouest, 낭트) 감사합니다. 우리는 그들의 기술 지원에 대 한 또한 모든 직원을의 재조합 단백질 생산 (P2R) 및 영향 플랫폼 (INSERM 1232, SFR 건강, Biogenouest, 낭트)의 감사합니다. 우리에 대 한 건설적인 의견 원고 에마뉘엘 Scotet 및 리처드 Breathnach 감사합니다. 이 작품 «Investissements d'Avenir» 프랑스 정부 프로그램, 여는 프랑스 국가 연구 기관 (ANR) (ANR-10-IBHU-005) 관리에 의해 자금 IHU Cesti 프로젝트에 의해 재정적으로 지원 되었다. IHU-Cesti 프로젝트도 낭트 메트로 지구의 드 라 루아르에 의해 지원 됩니다. 이 작품은 미래의 프로그램 ANR-11-LABX-0016-01의 투자를 통해 국립 연구 기관에서 지 원하는 LabEX IGO 프로그램의 맥락에서 실현 했다.

모든 인간 주변 혈액 샘플은 로컬 윤리 위원회 (Etablissement 프랑스어 뒤 상, EFS, 낭트, 프로시저 PLER 국세청-2016-08)에 따라 동의 후 익명 성인 기증자 로부터 얻은 했다.
1. 인간 주변 혈액 단 세포의 고립
참고: 시작 물자 수 총 인간 주변 혈액 또는 cytapheresis 샘플. 샘플 8 h 이상 해서는 안 되 고 응고 (예를들면, 헤 파 린)와 보충.
<ol><li>2 볼륨 (인간 주변 혈액) 혈액 또는 5 볼륨 (cytapheresis 샘플) RPMI (로스웰 파크 기념 연구소) 매체의 희석.</li>
	<li>신중 하 게 35 mL 50 mL 원뿔 튜브에 그라데이션 중간 밀도의 15 mL에 희석된 세포 현 탁 액의 레이어. 모든 희석된 혈액을 배포 하는 데 필요한 만큼 많은 튜브를 확인 합니다. 브레이크에서 실내 온도 진동 물통 회전자에 25 분 1,290 x g에서 원심.</li>
	<li>조심 스럽게 밀도 그라데이션 매체와 플라즈마 레이어 간의 인터페이스에 단 세포 층을 발음 하 고 새로운 50 mL 원뿔 튜브에 세포를 전송.</li>
	<li>튜브 RPMI 매체, 믹스를 실 온에서 10 분 동안 1,290 x g에서 원심. 조심 스럽게 제거는 상쾌한.</li>
	<li>20 ml RPMI 매체와는 혈소판을 제거 하는 10 분 x g 200에서 원심 분리기의 셀 펠 릿을 resuspend. 조심 스럽게 제거는 상쾌한. 일단이 단계를 반복 합니다.</li>
	<li>10%와 RPMI 매체에 셀 펠 릿 resuspend 태아 둔감 한 혈 청 (FBS). 참고: tetramer 라벨을 직접 진행 하거나 하룻밤 107 셀/mL의 농도에서 4 ° C에서 세포를 유지 합니다.</li>
</ol>2. Ag 특정 B 세포의 자기 농축 tetramer 관련
<ol><li>Ag-tetramers 중 PE 추가 하 여 준비 또는 APC 라는 프리미엄 학년 streptavidin 또는 BV421 표시 된 streptavidin biotinylated 항 원 단위체를 1: 4의 어 금 니 비율에서. 실 온에서 한 약 수 매 10 분을 추가 세 가지 별도 부분에 streptavidin 켤레의 적절 한 금액을 추가 합니다.</li>
	<li>15 mL 원뿔 튜브에 세포 (3 x 10까지8 튜브 당) 고 5 분 동안 460 x g에서 원심. 참고: 다음 프로토콜 1 개의 관입니다.</li>
	<li>2%와 PBS (인산 염 버퍼)의 200 µ L에서 셀 펠 릿 resuspend FBS. PE, APC 및 BV421 활용 된 tetramers, 10 µ g/mL의 최종 농도를 각각 추가 합니다. 잘 혼합 하 고 실 온에서 30 분 동안 품 어.</li>
	<li>PBS를 사용 하 여 0.5 %BSA (소 혈 청 알 부 민)과 EDTA (Ethylenediaminetetraacetic 산) 얼음 처럼 차가운 셀 분리 버퍼 (SB) 준비 2 m m.</li>
	<li>5 분 동안 460 x g에서 원심 분리에 의해 하고있다 펠 릿 세포의 10 mL를 추가 합니다.</li>
	<li>안티-APC 자기 microbeads의 안티-PE와 50 µ L의 얼음 처럼 차가운 하고있다 추가 50 µ L의 500 µ L 셀 resuspend</li>
	<li>잘 혼합 하 고 4 ° c.에 20 분 동안 품 어</li>
	<li>2.5 단계를 두 번 반복 합니다.</li>
	<li>제거는 상쾌한 신중 하 게 andresuspend 얼음 차가운 SB에서 2 x 108 셀/mL의 농도에서 세포 펠 릿.</li>
	<li>SB의 3 mL와 자석에 큰 자석 열 equilibrate</li>
	<li>Equilibrated 칼럼의 상단에 2.9에서 세포 현 탁 액을 전송 하 고 완전히 방전 있습니다. 중요 한 단계: 열의 응집을 방지 하려면 70 µ m 나일론 메쉬를 통해 세포를 전달 합니다.</li>
	<li>얼음 차가운 SB의 3 mL와 셀에 포함 된 튜브를 헹 구 고 (여과, 린스 70 µ m 나일론 메쉬)의 경우 열에 직접 버퍼 전송.</li>
	<li>버퍼는 완전히 열에 물기를 때 열을 얼음 차가운 SB의 또 다른 3 mL를 추가 합니다.</li>
	<li>또 다른 3 mL 세척을 위한 2.13 단계를 반복 합니다.</li>
	<li>15 mL 원뿔 수집 관을 통해 자석과 장소에서 열을 제거 합니다.</li>
	<li>열의 맨 위에 얼음 차가운 SB의 5 mL을 추가 하 고 즉시 플런저를 사용 하 여 열에서 셀을 플러시. 일단이 단계를 반복 합니다.</li>
	<li>5 분 동안 460 x g에서 수집 된 세포 (농축된 관련 tetramer 포지티브 셀 분수) centrifuge 고 추가 항 체 얼룩이 계속 합니다. 참고: 수영장 셀에서에서 수집 모든 튜브, 적절 한 경우.</li>
</ol>3. 자세-특정 인간 B 세포와 세포 분류의 얼룩
<ol><li>C d 3에 대 한 반대로 인간 항 체의 칵테일 셀 펠 릿 resuspend (마지막 희석: 1시 20분), CD19 (1:20), CD14 (1:50), CD16 (1:50), 및 7AAD (1:1000) 2%와 PBS의 100 µ L의 최종 볼륨에서 FBS. 4 ° c.에 30 분 동안 품 어</li>
	<li>셀, 5 분, 460 x g에서 원심 분리기에 PBS의 10 mL를 추가 하 고 제거는 상쾌한. 일단이 단계를 반복 합니다. PBS, 70 µ m 나일론 메쉬에 필터의 200 µ L에서 셀 펠 릿을 resuspend.</li>
	<li>100 µ m-노즐 및 20 psi의 압력 셀 정렬 cytometer에 단일 세포 수준에서 특정 B 세포 1000 이벤트/s9를 초과 하지 않고 정렬로 이동 합니다. 참고: 사용 되는 제어 전략 그림 1. 에 표시 됩니다. 셀에 CD14 문이 먼저 했다-CD16-7AAD- 셀 제외 monocytes, NK, 죽은 세포 ( 그림 1에 표시 되지 않음). 다음 CD19+ B 셀 더블 스테인드 셀에 게이팅 하기 전에 PE와 송출 관련 Ag-tetramers에 의해 선정 됐다. 비 특정 B 세포 게이팅 BV421 부정적인 세포 (없는 Ag tetramer 여 흠 없는)에 의해 제외 되었습니다.</li>
	<li>8-스트립 PCR 튜브 10 µ L 1 x PBS의 RNAse 억제제의 10 단위 이전 가득 및 96 microtubes에 대 한 선반에 배치로 단일 B 세포를 수집 합니다. 즉시-80 ° c.에 PCR 튜브를 고정 참고: cytometer 악기에 선택 정렬 마스크는 마스크 수율: 0, 순도 마스크: 32, 그리고 위상 마스크: 0. 필요한 경우 단일 셀 보증금 96 또는 384 잘 PCR 접시에 조정 될 수 있었다. 단일 B 세포는 최대한 빨리 동결 해야 합니다 하 고 필요한 경우에 몇 주 동안-80 ° C에 남아 수 있습니다.</li>
</ol>4. 단일 셀 RT-PCR
<ol><li>직접 건조 욕조에 5 분 동안 70 ° C에서 PCR 스트립에서 냉동된 샘플을가 열 하 여 세포를 lyse.</li>
	<li>얼음 1 mM dNTP, 25 µ g/mL oligod(T) 뇌관, 5 µ M 임의의 hexamers, RNAse 억제제의 20 단위 및 역전사의 400 단위를 포함 하는 마스터 믹스 버퍼 x 2의 튜브 당 10 µ L을 추가 하 여 전송 (RT)를 진행 하는 스트립을 전송 합니다. 참고: 셀 녹고, 후 RT 수행 되어야 합니다 신속 하 게 RNA 강 직을 피하기 위해.</li>
	<li>교배, 50 ° C에서 1 시간에 대 한 품 어 그리고 반응을 중지를 3 분 동안 95 ° C에 외피와 마무리를 임의의 hexamers 수 있도록 5 분 동안 25 ° C에서 품 어.</li>
	<li>각 인코딩 변수 무거운 (vH)와 카파 (vLκ) 또는 람다 경 쇄 (vLλ) 지역에 대 한 중첩 된 PCR 증폭의 2 라운드 진행. 참고: 또는, RT 샘플-20 ° C에서 냉동 고 1 주일 동안 보관.<ol>
<li>PCR의 첫 번째 라운드에 대 한 추가 1.5 m m MgCl2, 0.25 m m dNTPs, DNA 중 합 효소의 2.5 단위 및 200를 포함 하는 40 µ L 최종 볼륨에 대 한 cDNA의 3 µ L 외부 뇌관 (뇌관 시퀀스 그림 2 및 테이블의 자료 를 참조)의 nM. 참고: 외부 뇌관 혼합의 구성입니다. 무거운 사슬 확대를 위한: 4 뇌관 (5' LVH 믹스) 전달 및 2 반전 뇌관 (3' CµCγ 믹스). 빛 카파 체인 확대를 위한 3는 앞으로 프라이 머 (5' LV | 혼합) 1 반전 뇌관 (3' Cκ543-566). 빛 람다 체인 확대, 7 전달 뇌관 (5' LVl 믹스) 및 1 반전 뇌관 (3' Cl). 참고: 뇌관은 모든 무 겁 고 가벼운 체인 가족 유전자5의 확대를 위한 경 운 기 외. 에 의해 디자인 되었다.</li>
		<li>자전거 다음과 적용: 4 분, 94 ° C 30의 40 주기 다음 94 ° C, 30에서 s s 58 ° C VH와 VLκ (VLλ에 대 한 60 ° C), 및 55에서 최종 신장으로 72 ° C에 7 분 동안 72 ° C에 단계.</li>
		<li>두 번째 라운드 PCR에 대 한 사용 하 여 첫 번째 증폭 제품의 3 µ L 40의 최종 볼륨에 대 한 1.5 m m MgCl2, 0.25 m m dNTPs, DNA 중 합 효소의 2.5 단위 그리고 200 µ L 식으로 복제에 대 한 금지 효소 사이트를 포함 하는 내부 뇌관의 nM (뇌관 시퀀스 그림 2 및 테이블의 자료 를 참조)는 벡터 참고: 내부 뇌관 혼합의 구성입니다. 무거운 사슬 확대를 위한: 9 앞으로 프라이 머 (5' AgeIVH 믹스)와 3 반전 뇌관 (3' SalIJH 믹스). 빛 카파 체인 확대를 위한 9 뇌관 전달 (5' AgeIV | 믹스) 3 반전 뇌관 (3' BsiWIJκ 믹스). 빛 람다 체인 증폭 6 뇌관 (5' AgeIVl 믹스) 전달 및 1 반전 뇌관 (3' XhoICl). 참고: 뇌관 경 운 기 외., 모든5의 무 겁 고 가벼운 체인 가족 유전자 증폭에 의해 설계 되었습니다.</li>
		<li>자전거 다음과 적용: 4 분, 94 ° C 30의 40 주기 다음 s 94 ° C, 30에서 VH와 LCκ (LCλ에 대 한 60 ° C), 및 45 58 ° C에서 s s 최종 신장으로 72 ° C에서 7 분 동안 72 ° C에 단계.</li>
	</ol>
</li>
	<li>VH, vLκ 및 vLλ (500 bp 제품 가변 무거운 체인 인코딩 세그먼트에 대 한) 및 세그먼트를 인코딩 변수 빛 체인 350 bp 제품 1.5 %agarose 젤에 PCR 제품의 마이그레이션 5 μ에 의해 긍정적인 우물을 식별 합니다.</li>
	<li>외 막 PCR 제품의 정화에 대 한 설계를 사용 하 여 양수 우물에서 남은 나머지 35 µ L PCR 제품을 정화.</li>
	<li>H2o.의 60 µ L PCR 제품을 elute</li>
</ol>5. 식 복제
<ol><li>
삽입을 준비 참고: 소화 60 µ L 각 순화 된 PCR의 적절 한 제한 효소 버퍼를 포함 하는 100 µ L의 최종 볼륨에서 제품.<ol>
<li>VH PCR 제품, 사리의 50 단위와 AgeI의 50 대를 추가 하 고 37 ° c.에 1 시간에 대 한 품 어</li>
		<li>VLλ PCR 제품, XhoI의 50 단위와 AgeI의 50 대를 추가 하 고 37 ° c.에 1 시간에 대 한 품 어</li>
		<li>VLκ PCR 제품을 위한 AgeI의 50 단위를 추가 하 고 37 ° c.에 1 시간에 대 한 품 어 96 PCR 멤브레인을 사용 하 여 다이제스트를 정화 BsiWI 제한 효소 버퍼의 100 µ L의 최종 볼륨에서 60 µ L eluate H2o. 다이제스트의 60 µ L 함께 elute, BsiWI, 50 단위를 추가 하 고 1 h 55 ° c.에 품 어</li>
		<li>15 분 동안 80 ° C에가 열 하 여 효소 비활성화.</li>
	</ol>
</li>
	<li>
표현 하는 벡터의 준비 참고: vH PCR 제품 지속적인 무거운 체인 IgG1 Cγ1를 포함 하는 식 벡터 (HCγ1)에 복제 됩니다. vLκ PCR 제품 상수 빛 체인 Cκ를 포함 하는 식 벡터 (LCκ)에 복제 됩니다. vLλ PCR 제품 상수 빛 체인 Cλ를 포함 하는 식 벡터 (LCλ)에 복제 됩니다.<ol>
<li>다음 소화를 수행.<ol>
<li>믹스 1 µ g 식의 HCγ1 AgeI의 10 단위와 사리 endonucleases, 제조업체에서 권장 하는 제한 버퍼의 20 µ L의 총 볼륨에서의 10 단위 벡터 그리고 1 h 37 ° c.에 품 어</li>
			<li>제한 버퍼의 20 µ L의 전체 볼륨에 AgeI 제한 효소의 10 단위 식 벡터 LCκ의 믹스 1 µ g는 제조업체에서 권장 하 고 37 ° c.에 1 시간에 대 한 품 어 BsiWI 제한 효소의 10 단위를 추가 하 고 1 시간 55 ° c.에 대 한 품 어</li>
			<li>AgeI의 10 단위 및 XhoI endonucleases 제한 버퍼의 20 µ L의 총 볼륨에서의 10 단위 식 벡터 LCλ의 믹스 1 µ g는 제조업체에서 권장 하 고 37 ° C에서 1 시간에 대 한 품 어</li>
		</ol>
</li>
		<li>10 분 제한 효소 비활성화 65 ° C에서 각 소화 혼합물이 열.</li>
		<li>2 µ L로 소화 PCR 제품의 5 µ L의 결 찰을 수행 (100 ng) 4 ° c.에서 하룻밤 배양 하 여 T4 DNA 리가의 1 단위와 DNA 리가 버퍼 x 1의 20 µ L의 총 볼륨의 해당 선형화 식 벡터의 참고: 또는, 결 찰 3 h 4 ° c.에 대 한 수행 됩니다.</li>
	</ol>
</li>
	<li>
복제
	<ol>
<li>수 제 electrocompetent TOP10 대장균 (섹션 1.8.4-1.8.8 분자 생물학에 있는 현재 프로토콜)의 45 µ L로 20 µ L 결 찰 혼합물의 Electroporate 1 µ L. 즉시 2 X YT 매체의 500 µ L을 추가 하 고 변형 확산 박테리아 YT 암 피 실린 판 x 2에 30 분 동안 37 ° C에서 물 욕조에 품 어. 37 ° c.에서 밤새 품 어</li>
		<li>각 변환에 대 한 8 개의 식민지 PCR에 의해 화면.<ol>
<li>얼음에 다음과 같이 반응 프리 믹스를 설정: PCR 버퍼, MgCl2 (25 m m)의 12 µ L, (에서 각각의 주식 포함 10 mM) dNTPs의 4 µ L, 앞으로 뇌관 (주식 10 µ M) 벡터 시퀀스 (뇌관 Ab vec 감지) 하 교배 시키기의 10 µ L x 5의 45 µ L 그리고 지속적인 무거운 또는 가벼운 체인 지역 타겟팅 역방향 뇌관 (주식 10 µ M)의 10 µ L (뇌관 시퀀스에 대 한 재료의 표 참조). H2o. 200 µ L의 최종 볼륨을 구성 하 DNA 중 합 효소 효소 (5 U / µ L)의 4 µ L를 추가 합니다.</li>
			<li>얼음에 8 스트립 PCR 튜브 당 반응 프리 믹스의 25 µ L를 배포 합니다.</li>
			<li>메 마른이 쑤 시 게를 사용 하 여 개별 식민지를 데리 러. 복제 판을 구성 하 여 PCR 반응 관에 그것을 찍어 2 x TY 암 피 실린 접시에 이쑤시개 행진</li>
			<li>다음 자전거 조건 심사 PCR을 수행: 10 분, 94 ° C 30의 25 주기 다음 s 94 ° C, 30에서 55 ° c, s 및 50 72 ° c.에 s</li>
			<li>1.5 %agarose 젤에 PCR 제품의 마이그레이션 5 µ L에 의해 긍정적인 박테리아를 식별 합니다. 참고: 긍정적 식민지에 게 PCR 제품 약 850 무거운 체인 벡터 및 600 bp bp 빛 체인 벡터에 대 한.</li>
		</ol>
</li>
		<li>복제 판에서 4 개의 긍정적인 식민지 파운드 매체의 2 mL에 접종 하 고 하룻밤 200 rpm에서 떨고와 37 ° C에서 품 어.</li>
		<li>제조 업체에 의해 표시 된 대로 플라스 미드 플라스 미드 정화 키트를 사용 하 여 액체 문화에서 추출 합니다.</li>
		<li>생어 변수 도메인의 정확한 삽입 확인 Ab vec 감지 뇌관 플라스 미드의 연속. 참고: 올바른 삽입 (HC 및 해당 LC 인코딩) 플라스 미드는 분 비에 대 한 293A 셀으로 cotransfected 이다. 작은 규모 생산 mAbs의 특이성은 ELISA에 의해 분석 됩니다. 다음, 대규모 생산은 해당 하는 경우 수행 됩니다.</li>
	</ol>
</li>
</ol>6입니다. mAbs의 생산
<ol><li>
특이성 검사에 대 한 작은 규모의 생산
	<ol>
<li>200 µ L의 Dulbecco의 수정이 글 중간 (DMEM) 10% 보충에 전날 transfection, 씨앗 15000 인간 미 발달 신장 293A (293A HEK) 세포 당 96 잘 접시에 잘 FBS. 37 ° c.에는 CO2 (5% CO2) 인큐베이터에서 밤새 품 어</li>
		<li>DMEM 매체 10% 포함 된 293A 셀 cotransfect FBS transfection 시 약으로 선형 polyethylenimine 파생을 사용 하 여. 참고: triplicates에 있는 transfection를 수행 합니다. 다음 프로토콜 플랫 바닥 96 잘 접시의 한 잘 이다.<ol>
<li>150 mM NaCl의 10 µ L에 0.5 µ L DNA transfection 시 약의 희석. 150 mM NaCl의 10 µ L로 0.125 µ g의 vH와 vL 표현 벡터의 0.125 µ g을 희석. 와 동 각 희석 10 s.</li>
			<li>10 µ L 희석 DNA transfection 시 약 10 µ L DNA 솔루션에 추가 합니다. 소용돌이 15 s와 실 온에서 15 분 동안 품 어. 293A 셀에 drop-wise 20 µ L 믹스를 추가 하 고 부드럽게 접시 소용돌이 의해 혼합.</li>
		</ol>
</li>
		<li>혈 청 무료 매체에서 5 일 동안 transfection 및 문화 셀 후 중간 16 h를 교체 합니다. 주: 혈 청 자유로운 매체를 사용 하 여 혈 청 Igs 항 체 생산된 오염 방지.</li>
		<li>5 분 동안 460 x g에서 원심 분리 하 여 세포와 파편을 제거 합니다.</li>
		<li>다중 채널 피 펫과 포부에 의해 supernatants 수확 하 고 V-하단 96 잘 접시에 그들을 전송.</li>
		<li>외 투 관련 Ag 재구성된 ELISA/ELISPOT 코팅의 당 100 µ L에 4 ° C에서 하룻밤 96-잘 ELISA 격판덮개에 2 µ g/mL의 최종 농도에 1 x를 버퍼링 합니다. 9에서 예제를 참조 하십시오.</li>
		<li>37 ° C에서 2 시간에 대 한 10% FBS DMEM 매체와 웰 스 블록</li>
		<li>6.1.5, 단계에서 transfected 293A 셀의 supernatants의 50 µ L을 추가 하 고 실시간에 2 h에 대 한 품 어</li>
		<li>양 고추냉이 과산화 효소 (HRP) 효소 1 µ g/mL에서 IgG Ab 활용 하는 반 인간의 100 µ L을 추가 하 고 실 온에서 1 h에 품 어. 50 µ L 비 기판 (TMB), 추가 하 고 20 분 동안 품 어.</li>
		<li>450에서 광학 밀도 읽기는 분 광 광도 계에 nm. 참고: 특정 mAbs ELISA 분석 결과 의해 밝혀 더 큰 규모에서 생성 될 수 있다 고 순화 단백질에 인간 IgG에 대 한 선호도 제시 하는 열.</li>
	</ol>
</li>
	<li>
대규모 생산 및 특정 mAbs의 정화
	<ol>
<li>전날 transfection, 씨앗 6 x 106 인간 미 발달 신장 293A (293A HEK) 25 mL DMEM 10% 보충을 포함 하는 175 cm2 플라스 크에 세포 FBS. 37 ° c.에는 CO2 (5% CO2) 인큐베이터에서 밤새 품 어 참고: 셀 70% 합칠 때 페 이어야 한다.</li>
		<li>DMEM 매체 10% 포함 된 293A 셀 cotransfect FBS transfection 시 약으로 선형 polyethylenimine 파생을 사용 하 여.<ol>
<li>150 mM NaCl의 450 µ L로 DNA transfection 시 약의 50 µ L를 희석. 150 mM NaCl의 500 µ L에 10 µ g의 vH와 vL 표현 벡터 10 µ g을 희석. 10 소용돌이 s 각 희석.</li>
			<li>DNA 솔루션을 희석된 DNA transfection 시 약을 추가 합니다. 소용돌이 15 s와 실 온에서 15 분 동안 품 어. 셀, drop-wise 1 mL 믹스를 추가 하 고 부드럽게 플라스 크를 소용돌이 의해 혼합.</li>
		</ol>
</li>
		<li>혈 청 무료 매체에서 5 일 동안 transfection 및 문화 셀 후 중간 16 h를 교체 합니다.</li>
		<li>25 mL 피 펫으로 발음 하 여 매체를 수확.</li>
		<li>5 분 동안 460 x g에서 원심 분리 하 여 세포와 파편을 제거 합니다.</li>
		<li>4 ° c.에 고속 단백질 액체 착 색 인쇄기 (FPLC) 시스템에 단백질 코팅 1 mL 열을 사용 하 여 항 체 정화<ol>
<li>단백질 sepharose 열 20 m m 인산 버퍼 (pH 7) equilibrate</li>
			<li>6.2.5 1.22 µ m 필터 다음 0.45 μ m 필터를 사용 하 여에서 세포 배양 매체를 필터링 합니다.</li>
			<li>열에 필터링 된 매체를 로드 하십시오.</li>
			<li>20 m m 인산 버퍼 (pH 7)로 세척 하 고 0.1 M 구 연산 염 버퍼 (pH 3.5)와 함께 elute.</li>
			<li>280에서 광학 밀도 읽고 nm 흡수 분 광 광도 계에 그리고 즉시 중화 1 M Tris 버퍼 (pH 9) 단백질을 포함 하는 분수.</li>
		</ol>
</li>
		<li>3.5 K 분자량 PBS 버퍼 (pH 7.4)에 대 한 차단으로 카세트에 4 ° C에서 하룻밤 순화 Ab dialyze</li>
		<li>0.2 µ m 여과 및 제어 순으로 제조 업체에 의해 표시 된 크기 배제 크로마토그래피에 의해 소독.</li>
	</ol>
</li>
</ol>

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

저자는 공개 없다.

제안 된 프로토콜 Ag 특정 B 세포는 혈액 순환에서 직접 인간의 mAbs의 세대에 대 한 강력한 방법입니다. 그것은 세 가지 중요 한 측면을 결합 한다: (i) tetramer 관련 자기 농축, 심지어 드문 Ag 바인딩 B 세포;의 비보 전 격리 수 있는의 사용 (ii)을 사용 하 여 3 Ag tetramers (2 개의 관련 것 들 그리고 한 없는 하나) 이라는 세 가지 다른 형광으로, cytometry, 여 BCR 특정 원하는 Ag;에 대 한 표현 B 셀만 제어 전략 (iii) 해당 재조합의 재건 mAb cDNAs RT-PCR에 의해 단일 세포 수준 및 인간 세포에서 cDNAs의 표현.
이전 연구는 mAbs는 격리 된 B 세포6,7,8에서 정렬 및 후속 생산 전에 인간 B 세포를 하나 또는 두 개의 형광 관련 항을 사용 하 여 제안 했다. 류 마티스 관절염 환자에서 한 분석 및 자가 면역 질환 마우스 모델에서 하나 autoreactive B 셀을 특성화 하 고 그들의 주파수10,11결정에 무관 한 형광 항 원을 관련 있다. 우리가 아는 두 형광 관련 항 원 tetramers의 조합을 사용 하 고 한 없는 항 tetramer 하지 완전히 인간의 mAbs의 생산을 위한 그들의 사용 전에 특정 B 세포의 농축에 대 한 이전 설명 하고있다. 이 최적화 방법은 완전히 인간의 구별 mAbs 약간 달에서 얻을 수 있으며 순진한 B 셀 레 퍼 토리에서 시작 하는 경우에 성공적으로 수행할 수 있습니다. 따라서, 그것은 인간 B 세포 immortalization 파지 디스플레이의 주요 결점의 아무도 또는 다른 이전 분자 생물학 기반 mAb 재건 절차 설명.
이 셀 전략 정렬 Ag 특정 인간의 mAbs의 고수익 복구 발생 합니다. 무 겁 고 가벼운 체인 세그먼트가 단일 격리 된 B 세포에서의 쌍은 약 50%의 성공률와 함께 증폭 됩니다. 가벼운 체인 세그먼트는 증폭 거의 항상, 하지만 이것은 무거운 사슬 세그먼트에 대 한 사실이 아니다. RT-PCR 효율 주로 다음 사항을 존중에 의존: 나) 정렬 된 단일 B 세포; 최대한 빨리 동결 해야 합니다 ii) RNase 억제제의 30 단위를 추가 하 고 냉동 실에서 B 세포를 복용 하 고 RT 반응; 발사 사이 시간을 최소화 iii) 녹고 얼음; 모든 뇌관 4) 결코 냉동/녹고 뇌관 3 배 이상; v) 1 년의 최대 뇌관 여기 비축과 됩니다.
원하는 구체적으로 해당 재조합 mAbs의 생산 효율성에 관하여 pMHC 특정 mAbs에 대 한 경우의 약 30 ~ 40%입니다. 이러한 특정 mAbs는 펩 티 드와 매우 요구 하는 MHC 분자를 인식 해야 하 고 우리가 이전 전통적인 항 원에 대하여 지시 하는 특정 mAbs의 복구의 전반적인 수확량은 우수, 최대 100%를 Β-galactosidase 항 원9. 그것 없는 tetramer에 대 한 적절 한 자세의 선택은 생산 mAbs의 특이성을 증가 하는 것이 중요 하는 스트레스를 해야 합니다.
현재 문서에서 설명 하는 안티-HLA-A2/Pp65 mAb (PC1.02)의 선호도 7 x 10-6 M, 유사는 TCR의 선호도 대 한 상대적으로 낮은입니다. 이 결과, B 세포 격리 순진한 기증자에서 수행한 예상 했다. 대부분 tetramer+ B 세포 IgM+IgG-, 좋은 Ag-바인더를 얻기의 확율을 감소 시키는 있었다. 그럼에도 불구 하 고,이 방법을 만들 수 있습니다 또한 가능한 정렬 cross-reactive 메모리 B 세포 순진한 기증자 로부터 원하는 Ag에 대 한 개인12의 면역학 과거 때문에. 또한,이 방법은 예방 접종 또는 감염 된 환자 또는 면역된 인간 답게 동물에 쉽게 적용 9에 설명 된 대로 친 화력 성숙 vivo에서 약 1 x 10-9 을 결과 mAbs의 선호도 높일 수 있습니다 M. 다양 한 절차는 또한 mAbs에서 생체 외에서특히 신체적인 hypermutation ( 13에서 검토) 항 체를 표현 하는 셀에서을 통해 재현의 선호도 향상 시키기 위해 기술 되었다.
결론적으로, 우리는 순진한 예방 접종된 기증자 또는 자가 면역 질환에서 고통의 환자 개별에서 상황의 다양 한 종류에 사용할 수 있는 매우 구별 mAbs 생산을 위한 다양 한 전략을 제안 합니다. 기초 연구와 immunotherapy 모두 원하는 피토 프에 대 한 이러한 방법으로 생성 하는 완전히 인간의 mAbs 유용할 수 있었다.

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

여기 설명 하는 방법을 완벽 하 게 인간 단일 클론 항 체의 (mAbs) 원하는 항 원 (Ag)에 대 한 신속 하 고 다양 한 생산 수 있습니다. mAbs는 많은 기초 연구 응용 프로그램 체 외 및 생체 내에서필수 도구: flow cytometry, 조직학, 서 럽 고 차단 실험 예. 또한, mAbs는 사용 되 고 더 의학에서 자가 면역 질환, 암, 치료 하 고 이식 거부1제어 하. 예를 들어 안티-CTLA-4 및 안티-PD-1 (또는 반대로 PD L1) mAbs 최근 암 치료2검사점 면역 억제제로 사용 되었다.
첫 번째 mAbs 면역 글로불린 (Ig)에 의해 제작-면역된 쥐 또는 쥐의 비장 세포에서 얻은 hybridomas 은닉. 그러나, murine 또는 쥐 mAbs에 대 한 강한 면역 반응을 그들의 신속한 통관 및 과민 반응3의 가능한 유도 인 간에 있는 그들의 치료 사용을 지장을 초래할 수 있습니다. 이 문제를 해결 하려면 mAbs의 동물성 단백질 시퀀스 부분적으로 소위 공상 마우스 인간 또는 인간 답게 된 항 체를 생성 하 인간 그들에 의해 대체 되었습니다. 그러나,이 전략 부분적 으로만 immunogenicity, 실질적으로 비용 및 시간-생산의 규모를 증가 하는 동안 감소. 인간의 mAbs 인간 B 세포에서 직접 생성 하는 고이 대 한 몇 가지 전략을 사용할 수 있습니다. 그들 중 하나 살 균 소 또는 효 모 디스플레이의 사용 이다. 이 무거운 무작위 인간의 Ig의 조합 도서관에서 변수 도메인 표시과 빛 연결에 페이지 또는 효 모, 그리고 관심의 특정 항 원을 사용 하 여 선택 단계를 수행. 이 전략의 주요 단점은 무 겁 고 가벼운 사슬은 무작위로 연결 된, 생성 된 항 체의 다양성에 아주 큰 증가에 지도입니다. 얻은 항 체 특정 Ag에 대 한 자연 면역 반응에서 발생 하는 것을 그에 해당 하는 있지 않습니다. 또한, 인간 단백질 폴딩과 포스트 번역 상 수정은 체계적으로 복제 않을 원핵생물 또는 효 모에도. 두 번째 인간 mAb 생산 방법은 엡 스타인-바 바이러스 감염이 나 안티 apoptotic 요인 BCL-6 및 BCL XL4의 식에 의해 자연 인간 B 세포 immortalization입니다. 그러나,이 메서드는 메모리 B 세포에만 적용 이며 효율적인, 수많은 mAb 생성 불멸 하 게 B 세포의 몇 가지 (해당 되는 경우) mAb 클론 원하는 항 원 특이성을 식별 하는 검사를 요구 하지 않습니다. 방법은 이렇게 비용과 시간이 소요입니다.
최근 새로운 프로토콜에서 고립 된 단 하나 B 세포5인간의 mAbs의 생산에 대 한 설명 하고있다. 그것에 최적화 된 단일 셀 반전 전사-연쇄 반응 (RT-PCR) 증폭의 두 무거운-및 빛-체인 인코딩 단일 정렬 된 B 세포에서 세그먼트에 대 한 의존 합니다. 이것 완전히 인간의 mAb의 재건 되므로 진 핵 식 시스템에 복제 하 고 이러한 세그먼트의 표현에 의해 선행 된다. 이 프로토콜은 예방 접종된 기증자에서 B 세포에서 시작 하 고 성공적으로 사용 되었습니다. 셀 B 세포는 원하는 자세에 대 한 감독의 더 높은 주파수를 가져오고 따라서6심사에 필요한 시간을 제한 하는 예방 접종 후 몇 주를 수확 했다. 다른 완전히 인간 mAbs 또한 HIV+ (인간 면역 결핍 바이러스)에 감염 된 환자7 과 흑색 종 환자8에서 제작 되었습니다. 이러한 발전에도 불구 하 고 아직도 그들의 메모리 표현 형 또는 주파수의 독립적인 Ag 특정 B 세포의 분리를 가능 하 게 사용할 수 없는 절차가입니다.
절차 설명 여기 뒤에 높은 수율 및 낮은 심사 시간 완전 인간 항 원 특정 mAbs의 생산 그들의 BCR 특이성에 따라 인간의 순환 B 세포의 효율적인 비보 전 절연 리드. 메서드를 사용 하면 메모리 B 세포 또는 항 체 은닉 B 세포는 면역 반응 후 유도에 제한 되지 않습니다 하지만 인간의 순진한 B 셀 레 퍼 토리에도 적용 될 수 있습니다. 그것은 매우 낮은 주파수에 Ag 특정 B 세포에서 시작 작동 효율성의 좋은 표시 이다. 방법의 원리는 다음과 같습니다: 주변 혈액 단 세포 (PBMC)는 관심사의 항 원을 제시 하는 2 개의 tetramers 물, 각각 다른 형광 색소 (예를 들어, Phycoerythrin (PE) 및 Allophycocyanin (APC))와 함께 표시 그리고 세 번째 형광 색소 (예를 들어, 화려한 바이올렛 421 (BV421))와 밀접 하 게 관련 된 항 원 제시 3 tetramer 활용. 항 원 바인딩 셀에 대 한 풍부 하 셀은 다음 인 큐베이 팅 구슬 안티-PE 코팅 및 안티-APC Abs, 셀 분리 열에 정렬. APC PE+ + 셀 분수 선택, mAbs PBMC 셀 종류 B 세포의 식별을 허용에 대 한 특정의 다양 한 스테인드 그리고 복종 flow cytometry 셀 정렬 합니다. B 세포는 PE+ +, 화려한 바이올렛-, 그러나 APC 격리 됩니다. 이 단계는 카운터 B 세포 또는 항 원 tetramerized에 바인딩되지 않습니다 그러나 PE 또는 APC (이 셀 것 PE+ - APC 또는 PE- APC+) 또는 사용 (이 tetramers의 비 항 원 부분에 바인딩 할 셀을 선택 셀 BV421 될 것입니다+). 이 단계에서 B 세포 높은 관심의 피토 프에 대 한 특정 카운터 선택 또한 (이 셀 BV421 됩니다+). 따라서,이 메서드는 매우 구체적인 B 세포 B 세포 수용 체 (BCRs) 두 매우 밀접 하 게 관련 된 항 원 사이 차별 있게 표현 정화 수 있습니다. 튜브에 수집 되는 단일 특정 B 세포 그들의 PCR 증폭 Ig cDNAs (보완 deoxyribonucleic 산) 복제 하 고 IgG mAbs 분 비로 인간 세포 선으로 표현.
개념의 증거로 서이 연구는 펩 티 드 제시한 중요 한 조직 적합성 복잡 한 클래스 나 인식 인간의 mAbs의 효율적인 생성에 설명 합니다 (MHC-나) 분자가 펩 티이 드와 같은에 로드 된 다른 펩 티 드 사이 차별 수 있습니다 MHC-나 대립 유전자. 이 자세의 복잡성 수준을 중요 하지만이 방법을 사용 하면 (i) Ag 관련 mAbs;의 고수익 복구 (2) 두 개의 구조적으로 가까운 Ags 사이 차별 있게 mAbs의 생산. 이 방법은 프로토콜 수정 없이 예방 접종 또는 감염 된 환자에 게 확장 될 수 있습니다 그리고 또한 이미 성공적으로 인간 답게 쥐 시스템9에서 구현 되었습니다. 따라서,이 연구는 기초 연구에 immunotherapy 사용할 수 있는 완전 인간 mAbs를 생성 하는 다양 하 고 효율적인 접근 방식을 설명 합니다.

<table><tbody><tr><td>HEK 293A cell line</td><td>Thermo Fisher scientific</td><td>R70507</td><td></td></tr><tr><td>DMEM (1X) Dulbecco&#039;s Modified Eagle Medium</td><td>Gibco by life technologies</td><td>21969-035</td><td>(+) 4,5g/L D-Glucose&lt;br/&gt; 0,11g/L Sodium Pyruvate&lt;br/&gt; (-) L-Glutmine</td></tr><tr><td>RPMI medium1640 (1X)</td><td>Gibco by life technologies</td><td>31870-025</td><td></td></tr><tr><td>Bovine Serum Albumine (BSA)</td><td>PAA</td><td>K45-001</td><td></td></tr><tr><td>Nutridoma-SP</td><td>Roche</td><td>11011375001</td><td>100X Conc</td></tr><tr><td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td><td>Ambion</td><td>AM9624</td><td></td></tr><tr><td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td><td>Invitrogen by Life Technologies</td><td>15575-020</td><td></td></tr><tr><td>Fetal Bovine serum (FBS)</td><td>Dominique Dutscher</td><td>S1810-500</td><td></td></tr><tr><td>Ficoll - lymphocytes separation medium</td><td>EuroBio</td><td>CMSMSL01-01</td><td>density 1,0777+/-0,001</td></tr><tr><td>streptavidin R-phycoerythrin conjugate</td><td>Invitrogen by Life Technologies</td><td>S21388</td><td>premiun grade 1mg/ml contains 5mM sodium azide</td></tr><tr><td>Streptavidin, allophycocyanin conjugate</td><td>Invitrogen by thermoFisher scientific</td><td>S32362</td><td>1mg/ml&lt;br/&gt; 2mM azide premium grade</td></tr><tr><td>Brilliant violet 421 streptavidin</td><td>Biolegend</td><td>405225</td><td>conc : 0,5mg/ml</td></tr><tr><td>Anti-PE conjugated magnetic MicroBeads</td><td>Miltenyi Biotec</td><td>130-048-801</td><td></td></tr><tr><td>Anti-APC conjugated magnetic MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855</td><td></td></tr><tr><td>MidiMACs or QuadroMACS separotor</td><td>Miltenyi Biotec</td><td>130-042-302/130-090-976</td><td></td></tr><tr><td>LS Columns</td><td>Miltenyi Biotec</td><td>130-042-401</td><td></td></tr><tr><td>CD3 BV510 BD horizon</td><td>BD Pharmingen / BD Biosciences</td><td>563109</td><td>Used dilution 1:20</td></tr><tr><td>CD19 FITC</td><td>BD Pharmingen / BD Biosciences</td><td>345788</td><td>Used dilution 1:20</td></tr><tr><td>CD14 PerCPCy5.5</td><td>BD Pharmingen / BD Biosciences</td><td>561116</td><td>Used dilution 1:50</td></tr><tr><td>CD16 PerCPCy5.5</td><td>BD Pharmingen / BD Biosciences</td><td>338440</td><td>Used dilution 1:50</td></tr><tr><td>7AAD</td><td>BD Pharmingen / BD Biosciences</td><td>51-68981E (559925)</td><td>Used dilution 1:1000</td></tr><tr><td>FACS ARIA III Cell Sorter Cytometer</td><td>BD Biosciences</td><td></td><td></td></tr><tr><td>8-strip PCR tubes</td><td>Axygen</td><td>321-10-061</td><td></td></tr><tr><td>Racks for 96 microtubes</td><td>Dominique Dutscher</td><td>45476</td><td></td></tr><tr><td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td><td>Invitrogen by thermoFisher scientific</td><td>10777-019</td><td>qty:5000U (40U/ul)</td></tr><tr><td>Distilled Water Dnase/Rnase Free</td><td>Gibco</td><td>10977-035</td><td></td></tr><tr><td>Oligod(T)18 mRNA Primer</td><td>New England BioLabs</td><td>S1316S</td><td>5.0 A260unit</td></tr><tr><td>Random hexamers</td><td>Invitrogen by thermoFisher scientific</td><td>N8080127</td><td>qty : 50uM, 5nmoles</td></tr><tr><td>Superscript III Reverse transcriptase</td><td>Invitrogen by thermoFisher scientific</td><td>18080-044</td><td>qty : 10000U (200U/ul)</td></tr><tr><td>GoTaq G2 Flexi DNA polymerase</td><td>Promega</td><td>M7805</td><td></td></tr><tr><td>dNTP Set, Molecular biology grade</td><td>Thermo Scientific</td><td>R0182</td><td>4*100umol</td></tr><tr><td>5LVH1</td><td>Eurofins</td><td>ACAGGTGCCCACT&lt;br/&gt; CCCAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVH3</td><td>Eurofins</td><td>AAGGTGTCCAGTG&lt;br/&gt; TGARGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVL4_6</td><td>Eurofins</td><td>CCCAGATGGGTCC&lt;br/&gt; TGTCCCAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVH5</td><td>Eurofins</td><td>CAAGGAGTCTGTT&lt;br/&gt; CCGAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>3HuIgG_const_anti</td><td>Eurofins</td><td>TCTTGTCCACCTT&lt;br/&gt; GGTGTTGCT</td><td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td></tr><tr><td>3CuCH1</td><td>Eurofins</td><td>GGGAATTCTCACA&lt;br/&gt; GGAGACGA</td><td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td></tr><tr><td>5AgeIVH1_5_7</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; GAGGTGCAGCTGGTGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAGGTGCAGCTGGTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3_23</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAGGTGCAGCTGTTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH4</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTGCAGCTGCAGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH4_34</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTGCAGCTACAGCAGTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH1_18</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTTCAGCTGGTGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH1_24</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTCCAGCTGGTACAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3__9_30_33</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAAGTGCAGCTGGTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH6_1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTACAGCTGCAGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>3SalIJH1_2_4_5</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAGGAGACGGTGACCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>3SalIJH3</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAAGAGACGGTGACCATTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>3SalIJH6</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAGGAGACGGTGACCGTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>5&#039;LVk1_2</td><td>Eurofins</td><td>ATGAGGSTCCCYG&lt;br/&gt; CTCAGCTGCTGG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVk3</td><td>Eurofins</td><td>CTCTTCCTCCTGC&lt;br/&gt; TACTCTGGCTCCCAG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVk4</td><td>Eurofins</td><td>ATTTCTCTGTTGC&lt;br/&gt; TCTGGATCTCTG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>3&#039;Ck543_566</td><td>Eurofins</td><td>GTTTCTCGTAGTC&lt;br/&gt; TGCTTTGCTCA</td><td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td></tr><tr><td>5&#039;AgeIVk1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GACATCCAGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk1_9_1&amp;ndash;13</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGACATCCAGTTGACCCAGTCT</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk1D_43_1_8</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTGT&lt;br/&gt; GCCATCCGGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk2</td><td>Eurofins</td><td>CTGCAACCGGTGTACATGGG&lt;br/&gt; GATATTGTGATGACCCAGAC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk2_28_2_30</td><td>Eurofins</td><td>CTGCAACCGGTGTACATGGG&lt;br/&gt; GATATTGTGATGACTCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_11_3D_11</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGAAATTGTGTTGACACAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_15_3D_15</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCA&lt;br/&gt; GAAATAGTGATGACGCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_20_3D_20</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGAAATTGTGTTGACGCAGTCT</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk4_1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCG&lt;br/&gt; GACATCGTGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk1_2_4</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TGATYTCCACCTTGGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk3</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TGATATCCACTTTGGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk5</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TAATCTCCAGTCGTGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;LVl1</td><td>Eurofins</td><td>GGTCCTGGGCCCA&lt;br/&gt; GTCTGTGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl2</td><td>Eurofins</td><td>GGTCCTGGGCCCA&lt;br/&gt; GTCTGCCCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl3</td><td>Eurofins</td><td>GCTCTGTGACCTC&lt;br/&gt; CTATGAGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl4_5</td><td>Eurofins</td><td>GGTCTCTCTCSCA&lt;br/&gt; GCYTGTGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl6</td><td>Eurofins</td><td>GTTCTTGGGCCAA&lt;br/&gt; TTTTATGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl7</td><td>Eurofins</td><td>GGTCCAATTCYCA&lt;br/&gt; GGCTGTGGTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5LVl8</td><td>Eurofins</td><td>GAGTGGATTCTCA&lt;br/&gt; GACTGTGGTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>3&#039;Cl</td><td>Eurofins</td><td>CACCAGTGTGGCC&lt;br/&gt; TTGTTGGCTTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;AgeIVl1</td><td>Eurofins</td><td>CTGCTACCGGTTCCTGGGCC&lt;br/&gt; CAGTCTGTGCTGACKCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl2</td><td>Eurofins</td><td>CTGCTACCGGTTCCTGGGCC&lt;br/&gt; CAGTCTGCCCTGACTCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl3</td><td>Eurofins</td><td>CTGCTACCGGTTCTGTGACC&lt;br/&gt; TCCTATGAGCTGACWCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl4_5</td><td>Eurofins</td><td>CTGCTACCGGTTCTCTCTCS&lt;br/&gt; CAGCYTGTGCTGACTCA</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl6</td><td>Eurofins</td><td>CTGCTACCGGTTCTTGGGCC&lt;br/&gt; AATTTTATGCTGACTCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl8</td><td>Eurofins</td><td>CTGCTACCGGTTCCAATTCY&lt;br/&gt; CAGRCTGTGGTGACYCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>3&#039;XhoICl</td><td>Eurofins</td><td>CTCCTCACTCGAG&lt;br/&gt; GGYGGGAACAGAGTG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -Reverse primers - Bacteria PCR screening</td></tr><tr><td>Ab-vec-sense</td><td>Eurofins</td><td>GCTTCGTTAGAAC&lt;br/&gt; GCGGCTAC</td><td>Bacteria PCR screening</td></tr><tr><td>QA Agarose-TM, Molecular Biology Grade</td><td>MP Bio</td><td>AGAH0500</td><td></td></tr><tr><td>NucleoFast 96 PCR Plate</td><td>Macherey Nagel</td><td>743.100.100</td><td></td></tr><tr><td>Enzyme Age I HF</td><td>New England Biolabs</td><td>R3552L</td><td>20000U/ml</td></tr><tr><td>Enzyme SalI HF</td><td>New England Biolabs</td><td>R3138L</td><td>20000U/ml</td></tr><tr><td>Enzyme Xho I</td><td>New England Biolabs</td><td>R0146L</td><td>20000U/ml</td></tr><tr><td>Enzyme BSIWI</td><td>New England Biolabs</td><td>R0553L</td><td>10000U/ml</td></tr><tr><td>HCg1 (Genbank accession number FJ475055)</td><td></td><td></td><td></td></tr><tr><td>LCk (Genbank accession number FJ475056 )</td><td></td><td></td><td></td></tr><tr><td>LCl (Genbank accession number FJ517647)</td><td></td><td></td><td></td></tr><tr><td>T4 DNA ligase</td><td>Invitrogen by thermoFisher scientific</td><td>15224.017</td><td>100U (1U/ul)</td></tr><tr><td>2X YT medium</td><td>Sigma Aldrich</td><td>Y1003-500ML</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma Aldrich</td><td>10835242001</td><td></td></tr><tr><td>LB (Luria Bertani) Broth (Lennox)</td><td>Sigma Aldrich</td><td>L3022-250G</td><td></td></tr><tr><td>Nucleospin Plasmid DNA, RNA and protein purification</td><td>Macherey Nagel</td><td>740588.250</td><td></td></tr><tr><td>Jet PEI DNA transfection reagent</td><td>PolyPlus</td><td>101-40</td><td></td></tr><tr><td>Flat bottom96-well plate</td><td>Falcon</td><td>353072</td><td></td></tr><tr><td>V-bottom 96-well plate</td><td>Nunc/Thermofisher</td><td>055142</td><td></td></tr><tr><td>Nunc easy 175 cm2 flasks</td><td>Nunc/Thermofisher</td><td>12-562-000</td><td></td></tr><tr><td>ELISA/ELISPOT coating buffer</td><td>eBiosciences</td><td>00-0044-59</td><td></td></tr><tr><td>Nunc maxisorp flat bottom 96 well ELISA plates</td><td>Nunc/Thermofisher</td><td>44-2404-21</td><td>high protein binding</td></tr><tr><td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td><td>BD Pharmingen / BD Biosciences</td><td>55788</td><td></td></tr><tr><td>TMB substrate</td><td>BD Biosciences</td><td>555214</td><td></td></tr><tr><td>Streptavidin</td><td>Sigma</td><td>S0677</td><td></td></tr><tr><td>1 mL-HiTrap protein A HP column</td><td>GE Healthcare</td><td>17-0402-01</td><td></td></tr><tr><td>&amp;Auml;KTA FPLC</td><td>GE Healthcare</td><td>18190026</td><td></td></tr><tr><td>Superdex 200 10/300 GL column</td><td>GE Healthcare</td><td>17517501</td><td></td></tr><tr><td>NGC Quest 10 Plus Chromatography System</td><td>BioRad</td><td>7880003</td><td></td></tr></tbody></table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

단일 클론 항 체 (mAbs)는 모두 근본적인 연구와 의학에 유용한 강력한 도구입니다. 그들의 높은 특이성 항 체 매우 관련된 구조 (예를 들면, 정상적인 단백질 및 그 돌연변이 버전) 사이 구별 하는 경우 필수 되지 않습니다. 같은 구별 mAbs 생성의 현재 방법은 비용과 시간이 소요 여러 Ab 생산 하는 B 세포의 광범위 한 검사를 포함 한다. 우리 제안 여기 신속 하 고 비용 효과적인 방법의 구별, 세대에 대 한 완전히 인간의 mAbs B 림프 톨을 순환 하는 인간의 혈액에서 시작 합니다. 이 전략의 독창성은 쉽게 사용할 수 있는 주변 혈액 단 세포 (PBMC)를 사용 하 여 다른 모든 셀의 카운터 선택과 결합 하는 특정 항 원 바인딩 B 세포의 선택 때문 이다. 일단 특정 B 세포 격리, 해당 mAb 코딩 하는 cDNA (보완 deoxyribonucleic acid) 시퀀스는 얻은 단일 셀 반전 전사-연쇄 반응 (RT-PCR) 기술을 사용 하 여 이후 인간의 표현 셀입니다. 1 달 만큼 적게, 내 자연스럽 게 B 셀 레 퍼 토리에 의해 감지 하는 거의 모든 원하는 항 원에 대하여 지시 하는 매우 구별 인간의 mAbs의 밀리 그램을 생산 가능 하다.

이 프로젝트 선물 Pp65495 펩 티 드를 인식 인간의 mAbs의 세대 건강 한 기증자에서 PBMC에서 출발 (Pp65, 인간의 세포에서) 제시한 중요 한 조직 적합성 복잡 한 클래스 나 (MHC-나) 분자 HLA-A * 0201 ( HLA-A2). 이러한 mAbs이 복잡 하 고 다른 펩 티 드 같은 MHC에 적재를 대표 하는 단지 사이 차별 수-내가 분자.
PBMC는 HLA A2/Pp65 PE, HLA-A2/Pp65-APC와 HLA A2/MelA2 BV421 tetramers 위의 프로토콜에 설명 된 대로 얼룩이 있었다. Immunomagnetic PE 및 APC tetramer 포지티브 셀의 셀 농축, 후 eluted 셀 추가 mAbs와 얼룩이 있었다. 교류 cytometry 셀 정렬에서 자석으로 풍부한 셀 처음 가능한 CD14에 문이 했다-CD16-CD3-CD19+ singlets (B 세포). 그림 1 에서는 BCRs HLA A2/Pp65 다른 간을 구별할 수 있게 표현 하는 B 세포를 분리 하는 데 사용 하는 제어 전략 관련 HLA A2/펩 티 드 복합물. 다양 한 관심사의 B 세포 게이팅 HLA A2/Pp65 PE+ 및 HLA A2/Pp65 APC+ 더블-되었다면, PE+ 또는+APC 스테인드 홀로 된 형광 색소 특정 B 세포를 제외 후 수행 되었다. 마지막으로, 매우 구체적인 B 세포는 HLA A2/MelA2 BV421 부정적인 세포에 게이팅에 의해 확인 되었다. 이로써 BCRs HLA-A2/Pp65, 펩 티 드 및 HLA A2 종속 방식으로 바인딩할 수이 B 세포와 β2 microglobulin, biotin, HLA A2, 또는 그 어떤 차별 하지 않습니다에 대 한 감독 그 사이 감 별을 표현 하는 B 세포의 식별 사이 펩 티 드 MHC 바인딩 홈에. 이러한 후자의 셀 BV421 긍정적인 셀 것입니다. 이전 표시 하 고 추가 Ag의 다른 종류와 설명,이 제외 전략 Ag9에 대 한 B 세포의 구별 능력에 있는 증가 때문에 더 중요 하다.
일단 단일 특정 B 셀 정렬 했다, RT-PCR에 의해 증폭 했다 cDNAs 무거운 및 빛 Ig 체인에 대 한 인코딩. 무 겁 고 가벼운 사슬 세그먼트 코딩의 쌍 단 B 세포 테스트 (표 1)의 약 50%에서 얻은 했다. 시퀀스 식에 다음 복제 된 변수 도메인 포함 해당 상수 도메인 시퀀스 (무거운 일정 1 및 빛 상수 κ 또는 λ) 벡터 스 인간 미 발달 신장 세포 (HEK, 293A 세포)는 무 겁 고 가벼운 사슬 벡터와 cotransfected 했다. IgG1 isotype의 secreted mAbs transfection (참조 그림 3 완전히 인간의 mAbs 생산의 글로벌 전략에 대 한) 후 5 일 293A 세포의 문화 supernatants에서 수확 했다. 이 성공적으로 생산 하는 한 HLA A2/Pp65 특정 항 체 저조한 무 겁 고 가벼운 사슬 세그먼트 (표 1) 코딩의 쌍 3 하나의 B 림프 구 세포에서 시작. ELISA 분석 실험은 명확 하 게이 mAb 두 MHC와 펩 티 드-종속 HLA A2/Pp65 단지 (그림 4A)에 그것의 바인딩 위한 이었고 mAb의 몇 밀리 그램 (예를 들어, 선호도 분석, 추가 분석에 대 한 제작 쉽게 설명 기능 분석 실험)입니다. 표면 플라스몬 공명 (SPR)에 의해 결정 하는 바인딩 선호도 약 7 × 10-6 M (그림 4B) 했다.
따라서,이 문서에서는 설명 합니다 i) 관련 Ag 특정 B 세포의 탐지를 허용 하는 과민 하 고 효율적인 방법의 조합을, 심지어 때 건강 한 기증자의 혈액과 ii) 높은 구별 인간의 mAbs의 생성에 아주 낮은 주파수에서 제시.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56508/56508fig1.jpg"> 그림 1: 인간의 PBMC에서 HLA A2/Pp65 특정 B 세포의 탐지. 3 x 108 PBMC HLA A2/Pp65 PE, HLA-A2/Pp65-APC, HLA-A2/MelA2-BV421 tetramers와 얼룩이 있었다. Immunomagnetic PE 및 APC tetramer 포지티브 셀의 셀 농축, 후 eluted 셀 추가 mAbs와 얼룩이 있었다. 셀에 가능한 내의 CD14 먼저 문이 했다 교류 cytometry 셀 정렬,-CD16 CD19 다음에 (표시 되지 않음),- 림프 톨+CD3- 셀. 다음, B 세포는 HLA A2/Pp65 PE와 HLA A2/Pp65 APC tetramers 물 문이 되었다. HLA A2/MelA BV421 tetramer HLA-A2/Pp65, 펩 티 드와 MHC 종속 방식으로 인식 하지 않았다 B 셀 제외 하 사용 되었다.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56508/56508fig2.jpg"> 그림 2: 증폭 및 Ig 유전자의 복제에 대 한 전략. 빛과 무거운 Ig 체인 인코딩 유전자 중첩된 RT-PCR에 의해 증폭 되었다. 첫 번째 PCRs 지도자 지역 및 역방향 뇌관 적절 한 무거운, 카파, 또는 가벼운 람다 체인의 일정 지역에 대 한 특정을 교배 시키기 앞으로 뇌관의 믹스와 함께 수행 했다. 두 번째 PCRs 금지 사이트를 포함 한 뇌관으로 수행 되었다, 앞으로 역 뇌관 각각 V 세그먼트의 시작 및 J 세그먼트의 끝에 대 한 특정 했다. 금지 효소로 소화 하 고 식 벡터 포함 된 적절 한 상수 도메인에서에서 복제 된 PCR 제품 시퀀싱 했다. CMV: 세포 발기인; AmpR: 암 피 실린에 대 한 저항 유전자입니다.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56508/56508fig3.jpg"> 그림 3: 재조합 인간 mAbs의 재건의 전반적인 전략. Tetramer 기반 정렬 전략 관심의 B 세포의 탐지를 허용 한다. 매우 구체적인 B 세포 단일 셀 정렬 했다. 빛과 무거운 Ig 체인 인코딩 세그먼트 RT-PCR를 사용 하 여 증폭 했다. 변수 도메인 시퀀스 프레임에 별도 진 핵 식 벡터에 유전자 세그먼트 인코딩 상수 빛과 무거운 영역으로 복제 했다. 해당 완전히 인간의 mAbs 정도 페 HEK 293A 세포에 의해 표현 하 고 표면에 뜨는 문화에서 정화 했다. 이 수치는 Ouisse 그 외 여러분 에서 수정 된 (2017) 9.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56508/56508fig4.jpg">
HLA A2/Pp65 인간 주변 혈액 순환 하는 B 세포에서에서 생성 된에 대 한 대표적인 매우 구별 mAb의의 그림 4: 특성화 A) mAb HLA A2/Pp65에 대 한 PC1.02의 특이성 ELISA 테스트. 플레이트 관련 (HLA-A2/Pp65) 또는 HLA A2 제한 펩 티 드를 포함 하는 없는 HLA A2 단지 코팅 했다: MelA, n s 3 (HCV-1), 및 GagP17 (HIV-1) 2 µ g/mL, PC1.02 추가 되었습니다, mAb 및 IgG HRP Ab는 검색에 사용 되는 안티 인간에서. 광학 밀도 (OD) 450에서 읽어온 nm. B) mAb CM5 칩 바인딩된 mAb 통해 HLA A2/Pp65 단지의 다양 한 농도 흐르는 표면 플라스몬 공명 (SPR)를 사용 하 여 PC1.02의 선호도 결정. 이 수치는 Ouisse 그 외 여러분 에서 수정 된 (2017) 9.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td></td>
			<td>PBMC의 수</td>
			<td>PE + APC + 농축 후 셀의 수</td>
			<td>제외 (BV421 +) 셀의 수</td>
			<td>정렬 된 단일 셀의 수</td>
			<td>분석 된 우물의 수</td>
			<td>HC와 LC 우물의 수 (% 복구) 관련</td>
			<td>생산 mAbs의 수</td>
			<td>특정 mAbs의 수</td>
		</tr>
<tr>
<td>HLA A2/Pp65 mAb (PC1.02)</td>
			<td>3 x 108
</td>
			<td>818</td>
			<td>117</td>
			<td>161</td>
			<td>7</td>
			<td>3 (43%)</td>
			<td>3</td>
			<td>1</td>
		</tr>
</tbody></table>표 1: HLA A2/Pp65 특정 B 세포의 분석. 난다 B 세포, Ig 유전자 증폭 및 절연된 HLA A2/Pp65 특정 B 세포에서 mAb 생산 수율의 배제 전략의 영향 평가/측정 했다.

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

인간의 혈액에서 회람 하는 드문 B 세포에서 시작 인간 항 체의 항 원에 대 한 특정의 생산 하는 방법을 설명 합니다. 이러한 자연 항 체의 생성은 효율적이 고 신속한, 그리고 얻은 항 체 매우 관련된 항 원 사이 차별 수 있습니다.

희귀 한 항 원 특정 B 세포 혈액 순환에서 구별 인간 단일 클론 항 체의 생성

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

generation-discriminative-human-monoclonal-antibodies-from-rare

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

10.3K 조회수.  Université de Nantes. 인간의 혈액에서 회람 하는 드문 B 세포에서 시작 인간 항 체의 항 원에 대 한 특정의 생산 하는 방법을 설명 합니다. 이러한 자연 항 체의 생성은 효율적이 고 신속한, 그리고 얻은 항 체 매우 관련된 항 원 사이 차별 수 있습니다.

비디오: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide antigens presented by MHC (human ortholog HLA) molecules through the T cell receptor (TCR) in a highly sensitive and specific manner. While the primary function of T cells is to mediate protective immune responses to foreign antigens presented by self-MHC, T cells respond robustly to antigenic differences in allogeneic tissues. T cell responses to alloantigens can be described as either direct or indirect alloreactivity. In alloreactivity, the T cell responds through highly specific recognition of both the presented peptide and the MHC molecule. The robust oligoclonal response of T cells to allogeneic stimulation reflects the large number of potentially stimulatory alloantigens present in allogeneic tissues. While the breadth of alloreactive T cell responses is an important factor in initiating and mediating the pathology associated with biologically-relevant alloreactive responses such as graft versus host disease and allograft rejection, it can preclude analysis of T cell responses to allogeneic ligands. To this end, this protocol describes a method for generating alloreactive T cells from naive human peripheral blood leukocytes (PBL) that respond to known peptide-MHC (pMHC) alloantigens. The protocol applies pMHC multimer labeling, magnetic bead enrichment and flow cytometry to single cell in vitro culture methods for the generation of alloantigen-specific T cell clones. This enables studies of the biochemistry and function of T cells responding to allogeneic stimulation.

This article describes a method for the generation and propagation of human T cell clones that specifically respond to a defined alloantigen. This protocol can be adapted for cloning human T cells specific for a variety of peptide-MHC ligands.

말초 혈액에서 인간 Alloantigen 특정 T 세포의 생성

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

연구

면역학 및 감염병학

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

정렬 된 불멸화 된 B 세포로부터 재조합 인간 IgG 단일 클론 항체의 생성

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding molecules is time-consuming and laborious due to the complicated handling and lack of alternatives. The aim of this protocol is to provide one standard method for the generation of monoclonal antibodies using hybridoma technology. This technology combines two steps. Step 1 is an appropriate immunization of the animal and step 2 is the fusion of B lymphocytes with immortal myeloma cells in order to generate hybrids possessing both parental functions, such as the production of antibody molecules and immortality. The generated hybridoma cells were then recloned and diluted to obtain stable monoclonal cell cultures secreting the desired monoclonal antibody in the culture supernatant. The supernatants were tested in enzyme-linked immunosorbent assays (ELISA) for antigen specificity. After the selection of appropriate cell clones, the cells were transferred to mass cultivation in order to produce the desired antibody molecule in large amounts. The purification of the antibodies is routinely performed by affinity chromatography. After purification, the antibody molecule can be characterized and validated for the final test application. The whole process takes 8 to 12 months of development, and there is a high risk that the antibody will not work in the desired test system.

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

하이 브리 도마 기술에 의해 쥐 단일 클론 항체의 생성

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate and enrich these rare cells for studies of their phenotype and biology. Approaches are inevitably based on the principle that B cells recognize native antigen by virtue of cell surface receptors that are representative in specificity of antibodies that will eventually be secreted by their differentiated daughters. Perhaps the most obvious approach to the problem involves use of fluorochrome-conjugated antigens in conjunction with fluorescence-activated cell sorting (FACS). However, the utility of these methods is limited by cell frequency and the achievable rate of analysis and isolation by electronic sorting. A novel method to enrich rare antigen-specific B cells using magnetic nanoparticles that results in high yield enrichment of antigen-reactive B cells from large starting cell populations is described. This method enables improved monitoring of the phenotype and biology of antigen reactive cells before and following in vivo antigen encounter, such as after immunization or during development of autoimmunity.

A simple yet effective method that employs magnetic nanoparticles to detect and enrich antigen-reactive B cells for functional and phenotypic analysis is described.

표현형 및 기능 분석에 대한 검색 및 희귀의 농축 항원 특이 적 B 세포

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...

Generation of Monoclonal Antibodies Against Natural Products

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional Chinese medicine and food safety/toxicology. Many of the classical analysis techniques require expensive equipment and/or expertise. Notably, enzyme-linked immunosorbent assays (ELISAs) have become an emerging method for the analysis of foods and natural products. This method is based on antibody-mediated detection of the target components. However, as many of the bioactive components in natural products are small (&lt;1,000 Da) and do not induce an immune response, creating monoclonal antibodies (mAbs) against them is often difficult. In this protocol, we provide a detailed explanation of the steps required to generate mAbs against target molecules as well as those needed to create the associated indirect competitive (ic)ELISA for the rapid analysis of the compound in multiple samples. The procedure describes the synthesis of the artificial antigen (i.e., the hapten-carrier conjugate), immunization, cell fusion, monoclonal hybridoma preparation, characterization of the mAb, and the ELISA-based application of the mAb. The hapten-carrier conjugate was synthesized by the sodium periodate method and evaluated by MALDI-TOF-MS. After immunization, splenocytes were isolated from the immunized mouse with the highest antibody titer and fused with the hypoxanthine-aminopterin-thymidine (HAT)-sensitive mouse myeloma cell line Sp2/0 -Ag14 using a polyethylene glycol (PEG)-based method. The hybridomas secreting mAbs reactive to the target antigen were screened by icELISA for specificity and cross-reactivity. Furthermore, the limiting dilution method was applied to prepare monoclonal hybridomas. The final mAbs were further characterized by icELISA and then utilized in an ELISA-based application for the rapid and convenient detection of the example hapten (naringin (NAR)) in natural products.

This article provides a detailed protocol for the preparation and evaluation of monoclonal antibodies against natural products for use in various immunoassays. This procedure includes immunization, cell fusion, indirect competitive ELISA for positive clone screening, and monoclonal hybridoma preparation. The specifications for antibody characterization using MALDI-TOF-MS and ELISA analyses are also provided.

천연 제품에 대 한 단일 클론 항 체의 생성

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...

Single-cell Screening Method for the Selection and Recovery of Antibodies with Desired Specificities from Enriched Human Memory B Cell Populations

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational methods, such as next generation sequencing (NGS), yield enormous sets of data on the antibody repertoire at the sequence level, functional data is required to identify which sequences are relevant for a particular antigen or set of antigens. Here, we describe a method to identify and recover individual antigen-specific antibodies from peripheral blood mononuclear cells (PBMCs) from a human blood donor. This method utilizes an initial enrichment of mature B cells and requires a combination of phenotypic cell markers and fluorescently-labeled protein to isolate IgG memory B cells via flow cytometry. The heavy and light chain variable regions are then cloned and re-screened. Although limited to the memory B cell compartment, this method takes advantage of flow cytometry to interrogate millions of B cells and returns paired heavy and light chain sequences from a single cell in a format ready for expression and confirmation of specificity. Antibodies recovered with this method can be considered for therapeutic potential, but can also link specificity and function with bioinformatic approaches to assess the B cell repertoire within individuals.

The BSelex method to identify and recover individual antigen-specific antibodies from human peripheral blood mononuclear cells combines flow cytometry with single cell PCR and cloning.

농축 된 인간 기억 B 세포 집단에서 원하는 특이성을 가진 항체의 선택 및 회복을위한 단세포 스크리닝 방법

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational ...

Flow Cytometric Characterization of Murine B Cell Development

Extensive studies have characterized the development and differentiation of murine B cells in secondary lymphoid organs. Antibodies secreted by B cells have been isolated and developed into well-established therapeutics. Validation of murine B cell development, in the context of autoimmune prone mice, or in mice with modified immune systems, is a crucial component of developing or testing therapeutic agents in mice and is an appropriate use of flow cytometry. Well established B cell flow cytometric parameters can be used to evaluate B cell development in the murine peritoneum, bone marrow, and spleen, but a number of best practices must be adhered to. In addition, flow cytometric analysis of B cell compartments should also complement additional readouts of B cell development. Data generated using this technique can further our understanding of wild type, autoimmune prone mouse models as well as humanized mice that can be used to generate antibody or antibody-like molecules as therapeutics.

We describe herein a simple analysis of the heterogeneity of the murine immune B cell compartment in the peritoneum, spleen, and bone marrow tissues by flow cytometry. The protocol can be adapted and extended to other mouse tissues.

뮤린 B 세포 발달의 유동 세포 측정 특성화

Extensive studies have characterized the development and differentiation of murine B cells in secondary lymphoid organs. Antibodies secreted by B cells ...

Antibody Generation: Producing Monoclonal Antibodies Using Hybridomas

Source: Frances V. Sjaastad1,2, Whitney Swanson2,3, and Thomas S. Griffith1,2,3,4 
1 Microbiology, Immunology, and Cancer Biology Graduate Program, University of Minnesota, Minneapolis, MN 55455 
2 Center for Immunology, University of Minnesota, Minneapolis, MN 55455 
3 Department of Urology, University of Minnesota, Minneapolis, MN 55455 
4 Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455
Polyclonal antibodies are defined as a collection of antibodies directed against different antigenic determinants of an antigen or several antigens (1). While polyclonal antibodies are powerful tools for identifying biological molecules, there is one important limitation - they are unable to distinguish between antigens that share antigenic determinants. For example, when bovine serum albumin is used to immunize an animal, B cells with different surface Ig will respond to different antigenic determinants on bovine serum albumin. The result is a mixture of antibodies in the antiserum. Because bovine serum albumin shares some epitopes with human serum albumin in evolutionarily conserved regions of the protein, this anti-bovine serum albumin antiserum will also react with human serum albumin. Therefore, this antiserum will not be useful for distinguishing between bovine and human serum albumins.
Several approaches have been taken to overcome the specificity issue of polyclonal antisera. One is by absorbing the unwanted antibodies by passing the antiserum through a chromatography column of immobilized antigens (2). This method is tedious and frequently unable to completely remove the unwanted antibodies. Another approach is to isolate individual antibody-producing B cells and expand them in culture. However, like most normal untransformed cells, B cells do not survive in long-term culture.
To overcome the inability of B cells to survive in culture, one approach is to prepare a myeloma-B cell hybridoma. In 1847, Henry Bence-Jones discovered that patients with multiple myeloma, a lymphoid tumor, produced a large quantity of antibodies (3). B cells in these patients have become malignant and grow uncontrollably. Since the malignant B cells are derived from a single clone, they are identical and produce only a single type of antibody (i.e., a monoclonal antibody, or mAb). However, most of these myeloma cells produce antibodies of unknown specificities. In 1975, by fusing a myeloma cell to a B cell, Cesar Milstein and Georges Kohler succeeded in producing a hybridoma that can be cultured indefinitely in vitro and produces an unlimited number of monoclonal antibodies of known antigenic specificity (4). The rationale behind their approach is to combine the immortal properties of the myeloma cell and the antibody producing properties of the B cell. Their technique revolutionized antibody production and provides a powerful means for identification and purification of biological molecules using monoclonal antibodies.
Generally, preparing a monoclonal antibody requires several months. The general procedure includes the following steps:
<ol>
	<li>Immunization and screening of antibody titer</li>
	<li>Fusion of antibody-producing B cells and myeloma cells</li>
	<li>Selective growth of the hybridoma</li>
	<li>Screening the hybridomas for producing the desired monoclonal antibody</li>
	<li>Cloning by limiting dilution - a process whereby cells are diluted to a concentration to statistically allow for less than 1 cell to be added to the wells of a 96-well plate. Some wells will end up with 0 cells and some will have 1 cell. The wells with seeded with 1 cell will eventually grow into a monoclonal population of cells.</li>
	<li>Growth of the hybridoma and preparation of monoclonal antibody</li>
</ol>
This protocol focuses on the last step - growth of the hybridoma and preparation of the monoclonal antibody. The antibody is purified from the culture supernatant by ammonium sulfate precipitation (often referred to as salting out) - a commonly used method of removing proteins from a solution. Proteins in solution form hydrogen bonds, along with other hydrophilic interactions, with water through their exposed polar and ionic groups. When concentrations of small, highly charged ions (such as ammonium or sulfate) are added, these groups compete with the proteins for binding to water. This removes the water molecules from the protein and decreases its solubility, resulting in precipitation of the protein.

Producing Monoclonal Antibodies Using Hybridomas

항체 생성: 융합 세포를 사용한 단일 클론 항체 생성

Source: Frances V. Sjaastad1,2, Whitney Swanson2,3, and Thomas S. Griffith1,2,3,4
1 Microbiology, Immunology, and Cancer Biology Graduate Program, ...

교육

JoVE Science Education

심화생물학

면역학

Generating Recombinant Monoclonal Antibodies From Mammalian Cell Cultures

Source: Nogales-Gadea, G. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/52830">Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells.</a>&#160;J. Vis. Exp.&#160;(2015)
This video demonstrates a method of antibody generation from mammalian cells by introducing plasmid vectors with heavy and light chain genes. These vectors interact with polyethylenimine and enter the cells by forming polyplexes; later, they are translated into individual proteins and assembled into complete antibodies, which are secreted into the extracellular medium.

포유류 세포 배양에서 재조합 단클론 항체 생성

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Isolation of Peripheral Blood ...

JoVE Encyclopedia of Experiments

Immunology

Antibody-Based Technologies

Production and Purification

A Technique to Generate Monoclonal Antibodies from Antigen-Specific B Cells

Source: Devilder, M., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/56508">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood.</a> J. Vis. Exp. (2018).
The video demonstrates a technique for generating monoclonal antibodies from antigen-specific B cells. Eukaryotic expression vectors encoding the heavy and light chains of antibodies, cloned from isolated antigen-specific B cells, are introduced into mammalian cells using polyplexes. Once inside the cells, these vectors undergo translation, and the resulting heavy and light chain peptides assemble into antibodies, which are subsequently secreted by the cells.