CD31 항 체 사용 박사 카 렌 탄, 에든버러 대학에서에서 관대 한 선물 했다. 이 연구는 생명 공학 및 생물 과학 연구 위원회 (BBSRC)는 연구소 전략적 프로그램 그랜트 (BB/J004316/1;의 형태로 자금에 의해 지원 되었다 BBS/E/D/20221657) (누구와 CF)는 연구소 경력 경로 친목 BB/F023928/1 (누구), 그리고 재학 BBSRC 경우 재학 BB/K011618/1 (LC)를 통해 자금.

모든 동물 실험 위원회 사용자는로 슬 린 연구소의 동물에 의해 승인 했다 및 동물 치료 동물의 사용에 대 한 홈 오피스 (영국) 지침에 따라 유지 되었다. 아래에 설명 된 프로토콜에 대 한 5 주 오래 된, 남성 Sprague Dawley 쥐 사용 되었다.
1. 시 약 조리법
<ol><li>Dulbecco의 수정이 글 중간 (DMEM)과 영양소 혼합 F-12 (DMEM/F12)를 사용 하 여 문화 매체 를 준비 합니다. 10% 소독 열 비활성화 태아 둔감 한 혈 청 (FBS)와 1 %gentamicin 추가 합니다.</li>
	<li>석 회화 매체 문화 매체와 2.7 m m Ca/2.5 m m 파이 사용 하 여 준비 합니다.<ol>
<li>555 mg CaCl2 개 무게와 1m CaCl2의 5 mL을 증류수 5 mL 물에 용 해 하 여 1 M 칼슘 염화 물 (CaCl2)를 준비 합니다. 솔루션 솔루션 소독 0.22 μ m 주사기 필터를 통해 필터링.</li>
		<li>710 mg 무수 염기 나트륨 인산 염 (Na2HPO4)과 각각 별도로 증류수 5 mL에 용 해의 무수 이수소 나트륨 인산 염 (NaH2포4), 600 밀리 그램 무게 1 M 나트륨 인산 염 을 준비합니다 물입니다. 솔루션을 소독 하는 0.22 μ m 주사기 필터를 통해 나2HPO4 의 3,870 µ L와 1130 µ L NaH2포4, 및 필터를 결합 합니다.</li>
	</ol>
</li>
	<li>버퍼를 세척 포함 하는 행 크의 균형 소금 솔루션 (HBSS) 및 1 %gentamicin 준비.</li>
</ol>2입니다. 절 개 후드의 준비
<ol><li>모든 해 통풍 후드, 이전 샘플 및 시 약의 무 균을 보장 하기 위해 70% 에탄올으로 소독을 실시 합니다.</li>
	<li>압력가 마로 소독 그들 뒤에 70% 에탄올 이전 사용에 들어 있는 비 커에 도구 팁을 immersing에 의해 해 부 도구를 소독.</li>
	<li>워시 버퍼를 포함 하는 비 커를 준비 하 고 해 부 도구 동물 또는 조직 접촉으로 오기 전에 워시 버퍼에 담근 다. 모든 시간에 얼음에 워시 버퍼를 유지.</li>
</ol>3입니다. 기본 쥐 피해자의 추출
참고: 아래에서 설명 하는 프로토콜에 대 한 5 주 오래 된, 남성 Sprague Dawley 쥐 사용 되었다.
<ol><li>쥐를 추려 (~ 100 g) 영국 본사 지침에 따라 자 궁 경부 전위에 의해.</li>
	<li>각 쥐의 심장 밖으로 해 부하는 동물 부정사 유리 해 부 보드에 놓고 70% 에탄올을 분사 하 여 피부를 소독 합니다.</li>
	<li>해 부가 위, 복 부 구멍을 노출 하 고 흉 곽과 폐, 심장 폭로 조심 스럽게 제거의 도움으로 쥐의 중간에 4 cm 절 개를 확인 합니다.</li>
	<li>샤 프의 쌍을 가진 심 혼을 제거 하 고 곡선된가 위, 봄은 쥐의 모든 총 해 완료 될 때까지 해 부 심장 얼음 차가운 워시 버퍼에 저장.</li>
	<li>마이크로 해 부 각 심장, 페 트리 접시에 후자 전송 워시 버퍼에 덮여. 오름차순 대동맥 및 대동맥 루트 작은 지역으로 남아 있을 봄 연속가 위 (6 m m 블레이드)와 심장 근육을 잘라.</li>
	<li>동일을 사용 하 여 직선 위 (6 m m 블레이드) 봄, 신중 하 게 자르면 오름차순 대동맥 좌 심 실 쪽으로 고 노출 대동맥 밸브 전단지.</li>
	<li>신선 하 고, 멸 균 페 트리 접시에 전송 열린된 대동맥 HBSS 가득합니다. 대동맥 밸브 전단지, 욕실이 형 capsulotomy 마이크로-가 위 (3 m m 블레이드)와 대동맥의 기지에서 그들의 독특한 'U' 모양으로 표시를 해 부.</li>
	<li>1.5 mL microcentrifuge 튜브 모든 해 완료 될 때까지 얼음 차가운 워시 버퍼의 1 mL에 모든 전단지를 저장 합니다.</li>
	<li>일단 모든 전단지 수확 되어, 워시 버퍼를 제거 하 4 ° C에서 1 분 x 100g에 그들을 원심.</li>
	<li>살 균을 위해 셀 문화 후드에서 다음 단계를 수행 합니다. 100 µ L 425 U/mL 콜라 II 37 ° c.에 5 분에 전단지 소화에 VECs를 제거 하려면 부드럽게 200 µ L 피 펫 팁을 사용 하 여 위아래로 pipetting으로 소화를 방해.</li>
	<li>30 100 x g에서 원심 분리기 전단지, 펠 렛은 상쾌한을 신중 하 게 삭제 하는 s. 500 µ L 워시 버퍼와 두 번 세척 하 고 다시 30 100 x g에서 원심 분리 하 여 세포를 작은 s.</li>
	<li>전단지에서 피해자를 수확, 2 h, 425 U/mL 콜라 II의 100 µ L를 소화 하 고 200 µ L 피 펫 팁을 사용 하 여 위아래로 부드럽게 pipetting으로 피해자를 놓습니다.</li>
	<li>문화 매체 및 작은 피해 자들은 고 나머지 밸브 전단지 파편을 5 분 동안 670 x g에서 원심 분리기의 19 ml에서 콜라 II 희석. 상쾌한, 취소 및 전단지 피해 자들은 문화 접시/플라스 크에 따라 전송 (표 1).</li>
	<li>문화 문화 매체, confluency 37 ° C, 5% (이산화탄소) CO2, 존재에 도달할 때까지 5-7 일에 대 한 피해 자들은 후 72 h 매체를 변경. 생체 외에서 실험에 사용에 대 한 통행 최대 5 배까지 일단 confluency에 도달 100% 합니다.</li>
</ol>4입니다. 쥐 피해자의 석 회화의 유도
참고: 모든 실험, 세포는 hemocytometer 포함.
<ol><li>시드 및 오염을 방지 하기 위해 소독된 후드에 뿌리고 모든 1 차 셀을 수행 합니다. 기본 쥐 피해 자들은 실험 체 외에 석 회화를 준비 하려면 셀 150, 000 셀/잘 6-잘 접시의 조밀도에 씨. ≥ 90 %confluency (일반적으로 72 h)까지 문화 매체에 유지 합니다.</li>
	<li>제어 매체 대 석 회화와 피해자를 취급 하 고 37 ° C, 5% CO2, 추가 72 h에 대 한 존재에서 품 어.</li>
	<li>석 회화 기본 쥐 피해 자들은 후속 다운스트림 분석에 대 한 연구, 석 회화/제어 매체를 제거 하 고 세척 비 바운드 Ca 및 Pi 이온 제거에 워시 버퍼와 monolayers.</li>
</ol>5. 쥐 빅 특성화
<ol><li>Immunostaining vimentin와 α-SMA, 씨앗 150, 000 셀/잘 6 잘 플레이트의 밀도에 쥐 피해 자들은 같은 phenotypic 표식에 대 한 모니터링에 대 한 커버 전표 (셀 커버 전표의 표면에 성장할 것입니다)를 포함 하 고 50 %confluency 성장.</li>
	<li>문화 매체를 발음 하 고 수정 셀 monolayers 4 %paraformaldehyde (PFA)와 10 분 동안 그들 버퍼링 하는 인산 염 (PBS), 3 시간을 세척 하기 전에 5 분 각 시간에 대 한. 주의: PFA 독성 이며 신중 하 게 처리 해야 합니다.</li>
	<li>차단 하 고 permeabilization 버퍼와 셀 단층을 품 어 (1 x PBS, 2 차 항 체로 동일한 종에서 정상적인 혈 청의 5%, 0.3% 트라이 톤 X-100) 실 온에서 1 h.</li>
	<li>마우스 안티 vimentin 및 토끼 안티-α-SMA 항 체 항 체 희석 버퍼에 희석 된 셀 monolayers를 품 어 (1% 소 혈 청 알 부 민 + 0.3 %PBS Triton X-100) 하룻밤 4 ° C에서 부드럽게 흔들어 로커에. 주: 부정적인 컨트롤 비 활용 된 마우스 IgG와 토끼 IgG, 같은 희석을 사용 하 여 테스트 샘플으로 구성 되어 있습니다.</li>
	<li>다음 날, 3 번 5 분 때마다 PBS로 1 차 항 체를 씻어.</li>
	<li>부드럽게 로커에 떨고 실 온에서 1 h에 대 한 2 차 항 체 fluorophore 활용으로 셀 monolayers를 품 어.</li>
	<li>PBS, 3 번 세척 하 고 부드럽게 핀셋 (쥐 피해 자들은 포함)는 coverslips에 밖으로 한 쌍의 집게와 coverslip 포함 4', 6-diamidino-2-phenylindole (DAPI)에와. 4 ° C에서 24 시간 이상 형광 현미경으로 시각화 하기 전에 치료 하는 슬라이드를 둡니다.</li>
	<li>서쪽 오 점 분석에 대 한 150, 000의 밀도에서 피해 자들은 셀/6 잘 플레이트에 잘하고 confluent 100%까지 문화 매체에 성장에 두고 쥐 씨.</li>
	<li>단백질의 8 µ g를 사용 하 여 실행 CD31 표현을 측정 하 여 VEC 오염을 배제 서쪽 오 점. 참고: 앞에서 설명한9표준 서쪽 오 점 프로토콜 미행 했다.</li>
	<li>유전자 연구에 대 한 제조업체의 지침에 따라 상업 키트를 사용 하 여 ribonucleic 산 (RNA)을 추출 합니다.</li>
	<li>반전 녹음 방송을 사용 하 여 대상 유전자 식 연쇄 반응 (PCR)를 사용 하 여 측정 하는 cDNA를 취득 및 실시간 PCR (RT-PCR; 일컬어 정량) 녹색 fluorophore 감지 Gapdh 이전 참조 유전자로 사용 하 여 설명된10.<ol>
<li>다음 프로그램을 사용 하 여 PCR 분석: 30 94 ° C의 30 주기 3 분, 94 ° C의 1 주기 s, 63 ° C 30에 대 한 s, 72 ° C 35 s, 그리고 5 분 동안 72 ° C의 마지막으로 1 사이클.</li>
		<li>다음 프로그램을 사용 하 여 정량 분석: 95의 40 주기 10 분 동안 95 ° C의 1 주기 30 s, 및 95 ° C 30에 대 한 15 초, 1 분, 1 분, 55 ° C 95 ° C의 추가 주기 위한 60 ° C에 ° C s.</li>
	</ol>
</li>
	<li>트리 스/Borate/EDTA (TBE) 버퍼에는 2 %agarose 젤을 사용 하 여 PCR 제품 분석을 젤 전기 이동 법을 실행 합니다.</li>
</ol>6. 쥐 빅 석 회화 연구
<ol><li>알리자린 레드 S 및 생 화 확 적인 석 회화 연구, 4 섹션에 설명 된 시드 및 석 회화 지침을 따르시기 바랍니다.</li>
	<li>5% 붉은 알리자린 S 솔루션, 부드럽게 20 분 통에 락 셀 monolayers 얼룩. 이후 5 분 때마다 증류수 3 번 씻어. 각 잘의 이미지를 취득 합니다.</li>
	<li>생화학 Ca 분석 결과 키트를 사용 하 여 계량 Ca 증 착. 캘리포니아2 + 이온 0.6 M 염 산 (HCl)를 사용 하 여 부드러운 동요와 4 ° C에서 24 h에 대 한 거.</li>
	<li>수확은 상쾌한 측정 분석 결과 Ca를 사용 하 여 Ca 농도 키트 ( 재료의 표참조) 제조 업체의 지침에 따라.</li>
	<li>총 세포질 단백질의 일부분으로 칼슘 농도 계산 합니다. 0.1 M 수산화 나트륨 (NaOH) + 0.1% 나트륨 라우릴 황산 염 (SDS) 세포 monolayers에서 세포질 단백질 변성 제조업체의 지침에 따라 세제 호환 (DC) 단백질 분석을 사용 하 여 총 단백질 농도 결정 합니다.</li>
</ol>

<ol>
	<li>Dweck, M. R., Boon, N. a., Newby, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcific+aortic+stenosis:+a+disease+of+the+valve+and+the+myocardium.">Calcific aortic stenosis: a disease of the valve and the myocardium.</a> J Am Coll Cardiol. 60 (19), 1854-1863 (2012).</li><li>Freeman, R. V., Otto, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrum+of+calcific+aortic+valve+disease:+Pathogenesis,+disease+progression,+and+treatment+strategies.">Spectrum of calcific aortic valve disease: Pathogenesis, disease progression, and treatment strategies.</a> Circulation. 111, 3316-3326 (2005).</li><li>Mohler, E. R., Gannon, F., Reynolds, C., Zimmerman, R., Keane, M. G., Kaplan, F. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+formation+and+inflammation+in+cardiac+valves.">Bone formation and inflammation in cardiac valves.</a> Circulation. 103 (11), 1522-1528 (2001).</li><li>Monzack, E. L., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Can+valvular+interstitial+cells+become+true+osteoblasts?+A+side-by-side+comparison.">Can valvular interstitial cells become true osteoblasts? A side-by-side comparison.</a> J Heart Valve Dis. 20 (4), 449-463 (2011).</li><li>Osman, L., Yacoub, M. H., Latif, N., Amrani, M., Chester, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+human+valve+interstitial+cells+in+valve+calcification+and+their+response+to+atorvastatin.">Role of human valve interstitial cells in valve calcification and their response to atorvastatin.</a> Circulation. 114 (Suppl 1), (2006).</li><li>Gu, X., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+the+Rho+pathway+in+regulating+valvular+interstitial+cell+phenotype+and+nodule+formation.">Role of the Rho pathway in regulating valvular interstitial cell phenotype and nodule formation.</a> Am J Physiol Heart Circ Physiol. 300 (2), H448-H458 (2011).</li><li>Rodriguez, K. J., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+valvular+interstitial+cell+calcification+by+components+of+the+extracellular+matrix.">Regulation of valvular interstitial cell calcification by components of the extracellular matrix.</a> J Biomed Mater Res A. 90 (4), 1043-1053 (2009).</li><li>Rattazzi, M., Iop, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clones+of+interstitial+cells+from+bovine+aortic+valve+exhibit+different+calcifying+potential+when+exposed+to+endotoxin+and+phosphate.">Clones of interstitial cells from bovine aortic valve exhibit different calcifying potential when exposed to endotoxin and phosphate.</a> Arterioscler Thromb Vasc Biol. 28 (12), 2165-2172 (2008).</li><li>Zhu, D., Hadoke, P. W. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ablation+of+the+androgen+receptor+from+vascular+smooth+muscle+cells+demonstrates+a+role+for+testosterone+in+vascular+calcification.">Ablation of the androgen receptor from vascular smooth muscle cells demonstrates a role for testosterone in vascular calcification.</a> Sci Rep. 6 (April), 24807 (2016).</li><li>Zhu, D., Mackenzie, N. C. W., Millan, J. L., Farquharson, C., Macrae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+IGF2+expression+during+vascular+calcification.">Upregulation of IGF2 expression during vascular calcification.</a> J Mol Endocrinol. 52 (2), 77-85 (2014).</li><li>Latif, N., Quillon, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+human+valve+interstitial+cell+phenotype+and+function+using+a+fibroblast+growth+factor+2+formulation.">Modulation of human valve interstitial cell phenotype and function using a fibroblast growth factor 2 formulation.</a> PLoS ONE. 10 (6), (2015).</li><li>Liu, A. C., Joag, V. R., Gotlieb, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+valve+interstitial+cell+phenotypes+in+regulating+heart+valve+pathobiology.">The emerging role of valve interstitial cell phenotypes in regulating heart valve pathobiology.</a> Am J Pathol. 171 (5), 1407-1418 (2007).</li><li>Katwa, L. C., Ratajska, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiotensin+converting+enzyme+and+kininase-II-like+activities+in+cultured+valvular+interstitial+cells+of+the+rat+heart.">Angiotensin converting enzyme and kininase-II-like activities in cultured valvular interstitial cells of the rat heart.</a> Cardiovasc Res. 29 (1), 57-64 (1995).</li><li>Shao, J. S., Cheng, S. L., Pingsterhaus, J. M., Charlton-Kachigian, N., Loewy, A. P., Towler, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Msx2+promotes+cardiovascular+calcification+by+activating+paracrine+Wnt+signals.">Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals.</a> J Clin Invest. 115, 1210-1220 (2005).</li><li>Mackenzie, N. C. W., Zhu, D., Longley, L., Patterson, C. S., Kommareddy, S., MacRae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOVAS-1+cell+line:+a+new+in+vitro+model+of+vascular+calcification.">MOVAS-1 cell line: a new in vitro model of vascular calcification.</a> Int J Mol Med. 27, 663-668 (2011).</li><li>Kiffer-Moreira, T., Yadav, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pharmacological+inhibition+of+PHOSPHO1+suppresses+vascular+smooth+muscle+cell+calcification.">Pharmacological inhibition of PHOSPHO1 suppresses vascular smooth muscle cell calcification.</a> J Bone Miner Res. 28, 81-91 (2013).</li><li>Cui, L., Rashdan, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End+stage+renal+disease-induced+hypercalcemia+may+promote+aortic+valve+calcification+via+Annexin+VI+enrichment+of+valve+interstitial+cell+derived-matrix+vesicles.">End stage renal disease-induced hypercalcemia may promote aortic valve calcification via Annexin VI enrichment of valve interstitial cell derived-matrix vesicles.</a> J Cell Physio. , (2017).</li><li>Tsang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+novel+valve+interstitial+cell+lines+to+study+calcific+aortic+valve+disease.">Exploiting novel valve interstitial cell lines to study calcific aortic valve disease.</a> Mol Med Rep. , (2017).</li></ol>

저자는 공개 없다.

이 상세한 프로토콜 기본 쥐 피해 자들은, 효소 소화를 통해 쥐 심장 밸브에서 이러한 셀의 사용의 수집에 대 한 실제적인 방법을 설명 합니다. 우리의 방법은 더 지원 하 고 관상동맥 밸브 석 회화13연구 모델 생체 외에서 이전에 보고 된 쥐의 사용을 확장 합니다. 대동맥 밸브에서 피해자의 격리 이웃 VECs에서 오염에 대 한 가능성을 소개합니다. 그러나, 우리의 면역 형광 검사 데이터 초기 소화 단계 고립 된 세포를 내 피 세포 마커, CD31 부정적인 렌더링 VECs 제거 충분 한지 확인 합니다. 또한, α-SMA 얼룩 확인는 피해자의 활성화 형은 석 회화12필요 합니다.
빅 격리 이전에 보고 된 큰 동물 모델6,,78. 그러나, 이러한 종 다운스트림 연구로 전 세계 실험실에서 그들의 제한 된 액세스에 사용할 수 있는 제한 된 유전 및 분자 도구에 의해 제약 됩니다. 반면, 이러한 도구를 쉽게 사용할 수 있는 설치류에 따라서 능력을 분리 쥐 파생 된 피해자 수는 큰 실험 설계 용량 잘 설립 있습니다. 젊은 쥐에서 피해자의 사용 또한 세포는 상대적으로 더 오래 된 쥐, 따라서 더 많은 세포를 더 적은 동물이 요구 보다 증식을 의미 합니다. 마우스는 쉽게 액세스할 수, 하지만 쥐 때문 특히 작은 마음, 격리 하는 데 기본 마우스의 피해자 더 많은 시간이 소요 될 것 이라고 하 고 상당히 많은 동물 쥐 모델 셀의 동일한 수익률을 격리 하는 데 필요한 것입니다.
이 기술된 접근의 중요 한 이점은 피해 자들은 야생 종류와 유전자 변형 쥐 뿐만 아니라 심혈 관 질환과 밸브 상해의 쥐 모델에서 일시적으로 고립 될 수 있다 이다. 쥐 모델을 사용 하 여 필요 동물의 더 큰 수 대규모 실험, 따라서 동물 사용을 줄이기 위해, 그것을 잘 특징은 일단 셀 라인 생산 주 쥐 피해 자들은 변형 될 수 있다.
CAVD의 심각한 임상 의미 널리 인식 하 고, 하는 동안 근본적인 원인이 메커니즘은 아직 확인할 수 있다. 또한, 효과적인 약물 치료를 방지 하 고 잠재적으로 관상동맥 밸브 석 회화 치료 수 있습니다에서 사용할 수 있습니다 선물. 석 회화 조건 아래 피해자의 문화는 그러므로 CAVD의 관련성이 높은 생체 외에서 모델을 제공 합니다. 우리는 높은 Ca 및 Pi 수준 osteogenic 유전자 마커 Msx2, Alpl및 Phospho1의 표현에 수 반하는 증가 가진 고립 된 쥐 피해자의 체 외에 석 회화 유도 보여. 그것은 널리 이러한 마커 혈관 석 회화14,,1516의 병 적인 프로세스와 관련 된 설립. 우리의 데이터는 따라서 쥐 피해 자들은 중간 석 회화에 문화는 관상동맥 밸브 석 회화 시험관을 공부 하는 적절 한 모델을 보여준다. 실제로, 우리의 실험실에서 최근 연구는 캘리포니아 빅 파생 매트릭스 소포17의 Annexin VI 농축을 통해 관상동맥 밸브 석 회화 촉진 입증이 모델을 활용 하 고 있다.
쥐 피해 자들은 그들의 효율적인 특성을 사용 하 여의 혜택에도 불구 하 고 몇 가지 제한이 여전히 존재 한다. 첫째, 쥐 밸브 내 빅 인구의 크기는 매우 작습니다, 그리고 따라서 많은 동물 광범위 한 생체 외에서 연구에 대 한 충분 한 셀 번호를 생성 하기 위해 필요. 그러나, 그것은 불멸 하 게 밸브 중간 셀 라인, 최근에18, 우리가 보고 하 고 이후 주 문화를 고용 확인 하 고 이러한 연구 결과 확장 사업 예비 연구 하 여이 제한을 극복 하기 위해 가능 하다.
요약, 설명된 방법 성공적인 절연, 문화, 및 기본 쥐 수 있습니다 이후에 평가 분석을 포함 한 생 화 확 적인 분석 실험 단백질 및 RNA 분석의 다양 한을 사용 하 여 피해자의 석 회화를 설명 합니다. 이 모델 CAVD에서 생체 외에서조사 하는 안정적이 고 편리한 시스템 고이 파괴적인 질병에 대 한 책임 분자 메커니즘을 조사에 대 한 유용한 도구를 제공 합니다.

건강 한 관상동맥 밸브는 밸브의 개폐 중 기계적 스트레스의 분포는 똑같이 apportioned 세 전단지의 구성 됩니다. 밸브 전단은 3 개의 명료한 층의 정의 구조: fibrosa, spongiosa, 및 ventricularis, 어떤 집 우위 한 세포 유형으로 중간 셀 (피해 자들은) 밸브. 이러한 3 개의 계층 밸브 내 피 세포 (VECs)1의 두 침대 사이 끼워 넣으면 됩니다.
피해자의 Calcific 대동맥 밸브 석 회화 (CAVD), 서방 세계에서 가장 일반적인 심장 밸브 질병 진행에서 중요 한 역할을 한다. CAVD은 적극적으로 판 막 병 조직과 그 주변 microenvironment에 의해 규제 진보적인 조건으로 설명 되어 있습니다. 세포질 변화는 처음 거리 두껍게, 그리고 결국 대동맥 밸브 전단의 광범위 한 석 회화 발생할. 이 다음 중요 한 관상동맥 밸브 협 착 증에 지도 하 고 궁극적으로, 왼쪽 심 실 유출 방해2, 떠나는 유일한 치료로 수술 밸브 교체.
CAVD의 이상 복잡 하지만 생리 뼈 강화 작용3비슷한 메커니즘을 공유 합니다. 연구의 숫자 osteogenic 트랜스-차별화 및 석 회화4,5을 피해자의 능력을 보여 준, 하는 동안이 과정을 underpinning 메커니즘은 아직 완전히 해명 될 강조는 모델을 실현 하 고 관련 생체 외에서 CAVD의 중요 한 요구 사항입니다.
실험실 수로 이전 작업, 돼지와 소 모델에서 피해자를 고립 된 성공적으로 있으며 조건6,,78석 회화에서이 세포 배양. 이러한 모델에 관상동맥 밸브의 큰 크기로 인해 효소 소화를 통해 세포의 고립 세포의 순수한 인구 생성에 매우 효과적인 되었습니다. 그러나,이 모델은 대형 동물 종에 대 한 분자 도구의 한정 된 가용성으로 인해 제한 수 있습니다. 대조적으로, 설치류 모델 상대적으로 낮은 비용, 유전자 조작에 대 한 잠재력 및 분자 도구를 쉽게 사용할 수의 광범위 한 배열 유리한 유지. 그러나, 작은 동물 모델에서 피해자의 격리 하지 널리 채택 된다, 작은 조직 샘플을 작업할 때 발생 하는 어려움의 가능성이 결과입니다.
이 상세한 프로토콜 쥐 피해자의 직접 격리에 대 한 포괄적인 방법을 보고합니다. 밸브, 일련의 효소 소화 다음의 주의 해 부에 의해 피해자는 절연 고 실험 기법, 셀 문화, 석 회화, 및 진 식 등의 다양 한 고용 될 수 있습니다. CAVD의 모델 관련성이 높은 생체 외에서 이 의심할 여 지 없이이 병 적인 과정의 우리의 지식을 증가에 필수적인 기여를 하게된다.

<table>
	<tbody>
		<tr>
			<td>Dissection scissors</td>
			<td>World Precision Instruments</td>
			<td>14393</td>
			<td>Autoclave before use.</td>
		</tr>
		<tr>
			<td>Spring curved (14 cm)</td>
			<td>World Precision Instruments</td>
			<td>14112</td>
			<td>Autoclave before use.</td>
		</tr>
		<tr>
			<td>Spring straight (8 mm blade)</td>
			<td>World Precision Instruments</td>
			<td>15905</td>
			<td>Autoclave before use.</td>
		</tr>
		<tr>
			<td>SuperFine Vannas scissors (3 mm blade, 8 cm)</td>
			<td>World Precision Instruments</td>
			<td>501778</td>
			<td>Autoclave before use.</td>
		</tr>
		<tr>
			<td>Dumont #5 tweezers (11 cm)</td>
			<td>World Precision Instruments</td>
			<td>500342</td>
			<td>Autoclave before use.</td>
		</tr>
		<tr>
			<td>DMEM-F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11320074</td>
			<td></td>
		</tr>
		<tr>
			<td>Foetal bovine serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>10500064</td>
			<td>Filter before adding to culture medium.</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710049</td>
			<td></td>
		</tr>
		<tr>
			<td>Absolute ethanol</td>
			<td>Thermo Fisher Scientific</td>
			<td>E/0650DF/17</td>
			<td>Dilute to 70% v/v in distilled water.</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>Thermo Fisher Scientific</td>
			<td>H1150PB17</td>
			<td>Dilute to 0.6M with distilled water.</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Thermo Fisher Scientific</td>
			<td>UN1823</td>
			<td>Dilute to 0.1M with distilled water.</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Thermo Fisher Scientific</td>
			<td>P36931</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 594 goat anti-mouse antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A11005</td>
			<td>1/250 dilution in antibody dilution buffer.</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-rabbit antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A21206</td>
			<td>1/250 dilution in antibody dilution buffer.</td>
		</tr>
		<tr>
			<td>Superscript II kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064014</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>18427013</td>
			<td></td>
		</tr>
		<tr>
			<td>Random primers</td>
			<td>Thermo Fisher Scientific</td>
			<td>P/N58875</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq Polymerase kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18038026</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris/Borate/EDTA (TBE)</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9863</td>
			<td>Dilute to 1x with distlled water, before use.</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>16500</td>
			<td>2% in 1x Tris/Borate/EDTA(TBE).</td>
		</tr>
		<tr>
			<td>Lysis buffer (RIPA)</td>
			<td>Thermo Fisher Scientific</td>
			<td>89900</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flask</td>
			<td>Thermo Fisher Scientific</td>
			<td>156472</td>
			<td></td>
		</tr>
		<tr>
			<td>T175 flask</td>
			<td>Thermo Fisher Scientific</td>
			<td>159920</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0990</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat Msx2 primer</td>
			<td>Qiagen</td>
			<td>QT01084090</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat Alpl primer</td>
			<td>Qiagen</td>
			<td>QT00190680</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat Enpp1 primer</td>
			<td>Qiagen</td>
			<td>QT00181426</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy minikit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Sigma</td>
			<td>CLS3516</td>
			<td></td>
		</tr>
		<tr>
			<td>T25 flask</td>
			<td>Sigma</td>
			<td>CLS430639</td>
			<td></td>
		</tr>
		<tr>
			<td>Monobasic phosphate</td>
			<td>Sigma</td>
			<td>S5011</td>
			<td></td>
		</tr>
		<tr>
			<td>Dibasic phosphate</td>
			<td>Sigma</td>
			<td>S5136</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride</td>
			<td>Sigma</td>
			<td>C1016</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulphate (SDS)</td>
			<td>Sigma</td>
			<td>5030</td>
			<td>Dilute to 0.1% with 0.1M NaOH.</td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P6148</td>
			<td>Dilute to 4% with PBS.</td>
		</tr>
		<tr>
			<td>Triton X100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumin (BSA)</td>
			<td>Sigma</td>
			<td>A3059</td>
			<td></td>
		</tr>
		<tr>
			<td>Alizarin red S</td>
			<td>Sigma</td>
			<td>A5533</td>
			<td>Make up to 2% with distilled water, and adjust to pH 4.2.</td>
		</tr>
		<tr>
			<td>TGF&#946;-1 primer pair: f: GCTACCATGCCAACTTCTGT r: TGTGTTGGTTGTAGAGGGCA</td>
			<td>Sigma</td>
			<td></td>
			<td>Concentration used: 10 &#956;M</td>
		</tr>
		<tr>
			<td>TGF&#946;-2 primer pair: f: GAAGGCAGAGTTCAGGGTCT r: CGCTGGGTTGGAGATGTTAG</td>
			<td>Sigma</td>
			<td></td>
			<td>Concentration used: 10 &#956;M</td>
		</tr>
		<tr>
			<td>Monoclonal Anti-&#946;-Actin&#8722;Peroxidase antibody produced in mouse</td>
			<td>Sigma</td>
			<td>A3854</td>
			<td>1/50000 dilution in 5% BSA in tris-buffered saline + 0.1% Tween (TBS/T).</td>
		</tr>
		<tr>
			<td>Mouse anti-vimentin antibody</td>
			<td>Sigma</td>
			<td>v6389</td>
			<td>1/900 dilution in antibody dilution buffer (1x phosphate buffered saline (PBS), 1% bovine serum albumin (BSA), 0.3% Triton X-100).</td>
		</tr>
		<tr>
			<td>Mouse IgG</td>
			<td>Sigma</td>
			<td>I5381</td>
			<td>Diluted to the same stock concentration as mouse anti-vimentin antibody prior to dilution in antibody dilution buffer.</td>
		</tr>
		<tr>
			<td>Rabbit IgG</td>
			<td>GeneTex</td>
			<td>GTX35035</td>
			<td>Diluted to the same stock concentration as rabbit anti-&#945;-smooth muscle actin antibody prior to dilution in antibody dilution buffer.</td>
		</tr>
		<tr>
			<td>Rabbit anti-&#945;-smooth muscle actin antibody</td>
			<td>Abcam</td>
			<td>ab5694</td>
			<td>1/200 dilution in antibody dilution buffer.</td>
		</tr>
		<tr>
			<td>Rabbit anti-CD31</td>
			<td>Abcam</td>
			<td>ab28364</td>
			<td>1/50 dilution in 5% BSA inTBS/T.</td>
		</tr>
		<tr>
			<td>HRP-conjugated goat anti-rabbit antibody</td>
			<td>Dako</td>
			<td>P0448</td>
			<td>1/3000 dilution in in 5% BSA in TBS/T.</td>
		</tr>
		<tr>
			<td>Collagenase II</td>
			<td>Worthington</td>
			<td>41512862</td>
			<td>Adjust to 425 U/mL with distilled water, and then filter.</td>
		</tr>
		<tr>
			<td>SYBR green mastermix</td>
			<td>Primerdesign</td>
			<td>PrecisionPLUS-MX-SY</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium assay kit</td>
			<td>Randox</td>
			<td>CA590</td>
			<td></td>
		</tr>
		<tr>
			<td>DC protein assay kit</td>
			<td>Bio-Rad</td>
			<td>5000111</td>
			<td></td>
		</tr>
		<tr>
			<td>ECL reagent</td>
			<td>GE Healthcare</td>
			<td>RPN2109</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyperfilm ECL</td>
			<td>GE Healthcare</td>
			<td>28906837</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose membrane</td>
			<td>GE Healthcare</td>
			<td>10600007</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR ladder</td>
			<td>Bioline</td>
			<td>BIO-33057</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading dye for gel electrophoresis</td>
			<td>New England Biolabs</td>
			<td>B7025S</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe filters (0.22 &#956;m)</td>
			<td>Merck Millipore</td>
			<td>SLGP033RS</td>
			<td></td>
		</tr>
		<tr>
			<td>Coverslips</td>
			<td>Scientific Laboratory Supplies LTD</td>
			<td>MIC3100</td>
			<td></td>
		</tr>
		<tr>
			<td>Hematocytometer</td>
			<td>Marienfeld Superior</td>
			<td>640030</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Camera set up for Alizarin red images:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Camera</td>
			<td>Nikon D800</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lens</td>
			<td>Nikon AF_s Micro, Nikko 105 mm, 1:2.8 GED</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and characterization of primary rat valve interstitial cells: a new model to study aortic valve calcification

Calcific 대동맥 밸브 질환 (CAVD) 대동맥 밸브 전단의 진보적인 두껍게 특징 이다. 그것은 노인 및 끝 단계 신장 질병 (ESRD) 환자, 일반적으로 hyperphosphatemia와 아 고통에서 자주 발견 하는 조건이 다. 현재,의 진행을 막을 수 없습니다 약물 요법이 있다. 이 병 적인 과정의 기반이 되는 메커니즘은 불분명 남아 있다. 대동맥 밸브 전단 밸브 중간 셀 (피해자)는 VECs 사이 대동맥 cusps의 외부 표면에 얇은 층의 밸브 내 피 세포 (VECs)로 구성 된다. 쥐 모델의 사용에는 vivo에서 physiopathological 혈 청 인산 (Pi) 및 hyperphosphatemia와 아에서 고통 받는 환자의 칼슘 (Ca) 수준에 따라 소성 석 회화의 생체 외에서 연구를 수 있습니다. 설명된 프로토콜 세부 순수한 쥐 빅 인구의 빅 표시자의 식에 의해 표시 된 대로: 알파-부드러운 근육 걸 (α-SMA) vimentin 및 조직 성장 인자 베타 (TGFβ) 1과 2, 그리고 차별화 (CD) 31, 한 VEC의 클러스터의 부재 표식입니다. 이러한 피해자를 확대 하 여 연구 하 고 해명 CAVD underpinning 키 중재자 생화학, 유전, 및 이미징 연구를 수행할 수 있습니다.

이 프로토콜의 목표 기본 쥐 피해자의 격리를 설명 하 고 석 회화 실험 체 외에 문화를 했다. 위에서 설명한 방법을 사용 하 여 쥐 피해 자들은 성공적으로 고립 되 고 CAVD에 대 한 책임 메커니즘의 연구에 대 한 확장.
쥐 주 피해자 공동 설립된 빅 마커 지역화:
격리 된 셀 빅 형 빅 표식에 대 한 면역 형광 검사를 통해 확인 했다: vimentin와 α-SMA (빨간색과 녹색, 각각 그림 1A), 이전 보고서11,12계약입니다. 비 활용 된 마우스와 토끼 IgG 사용 하 여 대표 부정적인 컨트롤 그림 1B에서 표시 됩니다. 또한, 빅-성장 레 귤 레이 터 TGFβ-1 TGFβ-2의 식 PCR 분석 (그림 1C)을 사용 하 여 확인 되었다. 서쪽 오 점 분석 그 쥐를 확인 하기 위해 수행 되었다, 고립 된 쥐 주 피해자 했다 내 피 오염에서 무료로 확인 피해 자들은 부정 했다 CD31, 내 피 세포 표식에 대 한 긍정적인 제어 ( 로 개 mitral VECs를 사용 하 여 그림 1D).
Ca와 Pi 쥐 빅 석 회화 유도:
높은 조직의 Ca 또는 Pi 농도 일반적으로 피해자 체 외의 석 회화를 드라이브. 피해 자들은 격리 된 쥐의 석 회화 가능성, 감사 셀 ESRD 환자에서 병 적인 아 및 hyperphosphatemia 조건 모방 Ca와 Pi의 높은 수준에 노출 되었다. 2.7 m m Ca/2.5 m m 파이와 피해자의 치료 유도 석 회화, 알리자린 레드 S Ca 증 착 (그림 2A)와 HCl (81 배; leaching 다음 Ca 레벨의 색도계 결정에 대 한 얼룩에 의해 결정 되 학생의 t를 사용 하 여 p < 0.05-테스트; 그림 2B)입니다.
진 식 변경 빅 석 회화와 관련 된:
생체 외에서 혈관 세포의 석 회화 별개 분자 프로 파일에 연결 됩니다. 현재 연구에서 2.7 m m Ca/2.5 m m 파이와 피해자의 치료 osteogenic 마커의 mRNA 식에 상당한 증가 유발: Msh homeobox 2, Msx2 (2.04 배 변화; p < 0.01; 그림 3A), 알칼리 성 인산 가수분해 효소, Alpl (1.49 배 변화; p < 0.001; 그림 3B), 및 phosphoethanolamine/phosphocholine 인산 가수분해 효소, Phospho1 (4.7 배 변화; p < 0.01 일방통행 ANOVA;를 사용 하 여 그림 3C)입니다. 그러나, osteogenic 표식, Runx2및 석 회화 억제 물 ectonucleotide pyrophasphatase, Enpp1의 식을 그대로 (그림 3D-E) 남아 있었다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56126/56126fig1.jpg"> 그림 1입니다. 빅 마커의 식. (A) 면역 형광 밸브 중간 셀 (피해자)에 더블 얼룩, 알파-부드러운 근육 말라 (α-SMA; 녹색)와 vimentin의 colocalization를 보여주는. (B) 마우스와 토끼 IgG 사용 하 여 부정적인 컨트롤의 대표 이미지. 핵은 블루 4', 6-diamidino-2-phenylindole를 사용 하 여 (DAPI)에 물 들 다. 눈금 막대 = 50 µ m. (C) 변형 시키는 성장 인자 beta 1 (TGFβ-1)의 존재와 피해자에 TGFβ-2 (차선 1-3) PCR 분석에 의해 표시 된 대로. 레인 4 물 컨트롤입니다. 사용 하는 참조 유전자 Gapdh이었다입니다. (D) 서쪽 오 점 분석 CD31의 풍부한 식 식이 없는 피해자에 비해 개 승 모 판 내 피 세포 (VECs)에서 보여주는. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56126/56126fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56126/56126fig2.jpg"> 그림 2입니다. 쥐 피해 자들은의 석 회화 생체 외에서 . 피해 자들은 증 착 Ca 치료 2.7 m m Ca/2.5 m m Pi에 따라: (A) 사진 보여주는 알리자린 레드 S 잘, 그리고 (B) HCl leaching 다음 Ca 레벨의 색도계 결정에 전체 셀 monolayers의 얼룩. 학생의 t-테스트 두 데이터 그룹 간의 의미 분석을 수행 했다. 결과 ± S.E.M.를 의미 하는 대로 표시 됩니다 *p < 0.5 제어;와 비교 (n = 4).
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56126/56126fig3.jpg"> 그림 3입니다. 빅 석 회화와 관련 된 유전자 표현 변경. Msx2(A), (B) Alpl, (C) Phospho1, (D) Runx2, 배 osteogenic 마커의 mRNA 식에서 변경 하 고 (E) Enpp1 피해자에서 Ca/2.5 m m에 대 한 Pi 2.7 m m로 치료 48 h. mRNA 식 생 참조 유전자에 비해 배 변화로 표시 됩니다 Gadph. 쌍 단위 비교를 통합 하는 일반 선형 모델을 사용 하 여 단방향 ANOVA 여러 그룹 간의 의미 분석을 수행 했습니다. 결과 ± S.E.M.를 의미 하는 대로 표시 됩니다 * *p < 0.01; p < 0.001 제어;에 비해 (n = 6). <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56126/56126fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>밸브 전단의 수</td>
			<td>문화 접시/플라스 크</td>
		</tr>
<tr>
<td>9 ~ 15</td>
			<td>1 12-잘 접시에 잘</td>
		</tr>
<tr>
<td>15 ~ 30</td>
			<td>6 잘 플레이트에서 1</td>
		</tr>
<tr>
<td>30 +</td>
			<td>T25</td>
		</tr>
</tbody></table>표 1. 초기 시드에 필요한 전단지의 번호에 대 한 일반적인 지침.

Watch this Scientific Journal Video about Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification at JoVE.com

Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

절연 및 기본 쥐의 밸브 중간 세포: 관상동맥 밸브 석 회화를 공부 하는 새로운 모델

이 프로토콜 절연, 문화, 및 석 회화의 쥐 파생 밸브 중간 셀의 calcific 대동맥 밸브 질환 (CAVD)의 높은 생리 적 체 외에서 모델에 설명합니다. 이 쥐 모델의 착취 셀 및 분자 메커니즘이 복잡 한 병 적인 과정을 기초에 CAVD 연구를 촉진 한다.

Calcific aortic valve disease (CAVD) is characterized by the progressive thickening of the aortic valve leaflets. It is a condition frequently found in ...

isolation-characterization-primary-rat-valve-interstitial-cells-new

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

9.7K 조회수.  University of Edinburgh. 이 프로토콜 절연, 문화, 및 석 회화의 쥐 파생 밸브 중간 셀의 calcific 대동맥 밸브 질환 (CAVD)의 높은 생리 적 체 외에서 모델에 설명합니다. 이 쥐 모델의 착취 셀 및 분자 메커니즘이 복잡 한 병 적인 과정을 기초에 CAVD 연구를 촉진 한다.

비디오: Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

연구

발생학

Isolation and Characterization of Satellite Cells from Rat Head Branchiomeric Muscles

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent problems in speech, swallowing, and sucking. In vitro culture systems that allow the study of satellite cells (myogenic stem cells) from head muscles are crucial to develop new therapies based on tissue engineering to promote muscle regeneration after surgery. These systems will offer new perspectives for the treatment of cleft palate patients. A protocol for the isolation, culture and differentiation of satellite cells from head muscles is presented. The isolation is based on enzymatic digestion and trituration to release the satellite cells. In addition, this protocol comprises an innovative method using extracellular matrix gel coatings of millimeter size, which requires only low numbers of satellite cells for differentiation assays.

This protocol describes the isolation of satellite cells from branchiomeric head muscles of a 9 week-old rat. The muscles originate from different branchial arches. Subsequently, the satellite cells are cultured on a spot coating of millimeter size to study their differentiation. This approach avoids the expansion and passaging of satellite cells.

쥐 머리 Branchiomeric 근육에서 분리 및 위성 세포의 특성

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

분리 및 Zebrafish의 배아에서 단일 세포의 특성

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta

The human umbilical cord (UC) and placenta are non-invasive, primitive and abundant sources of mesenchymal stromal cells (MSCs) that have increasingly gained attention because they do not pose any ethical or moral concerns. Current methods to isolate MSCs from UC yield low amounts of cells with variable proliferation potentials. Since UC is an anatomically-complex organ, differences in MSC properties may be due to the differences in the anatomical regions of their isolation. In this study, we first dissected the cord/placenta samples into three discrete anatomical regions: UC, cord-placenta junction (CPJ), and fetal placenta (FP). Second, two distinct zones, cord lining (CL) and Wharton&#39;s jelly (WJ), were separated. The explant culture technique was then used to isolate cells from the four sources. The time required for the primary culture of cells from the explants varied depending on the source of the tissue. Outgrowth of the cells occurred within 3 - 4 days of the CPJ explants, whereas growth was observed after 7 - 10 days and 11 - 14 days from CL/WJ and FP explants, respectively. The isolated cells were adherent to plastic and displayed fibroblastoid morphology and surface markers, such as CD29, CD44, CD73, CD90, and CD105, similarly to bone marrow (BM)-derived MSCs. However, the colony-forming efficiency of the cells varied, with CPJ-MSCs and WJ-MSCs showing higher efficiency than BM-MSCs. MSCs from all four sources differentiated into adipogenic, chondrogenic, and osteogenic lineages, indicating that they were multipotent. CPJ-MSCs differentiated more efficiently in comparison to other MSC sources. These results suggest that the CPJ is the most potent anatomical region and yields a higher number of cells, with greater proliferation and self-renewal capacities in vitro. In conclusion, the comparative analysis of the MSCs from the four sources indicated that CPJ is a more promising source of MSCs for cell therapy, regenerative medicine, and tissue engineering.

Here, we present a protocol for the dissection of human umbilical cord (UC) and fetal placenta sample into cord lining (CL), Wharton&#39;s jelly (WJ), cord-placenta junction (CPJ), and fetal placenta (FP) for the isolation and characterization of mesenchymal stromal cells (MSCs) using the explant culture technique.

인간 제대혈 및 태아 태반에서 중간 엽 기질 세포의 분리 및 특성

The human umbilical cord (UC) and placenta are non-invasive, primitive and abundant sources of mesenchymal stromal cells (MSCs) that have increasingly ...

Using Primary Neurosphere Cultures to Study Primary Cilia

The primary cilium is fundamentally important for the proliferation of neural stem/progenitor cells and for neuronal differentiation during embryonic, postnatal, and adult life. In addition, most differentiated neurons possess primary cilia that house signaling receptors, such as G-protein-coupled receptors, and signaling molecules, such as adenylyl cyclases. The primary cilium determines the activity of multiple developmental pathways, including the sonic hedgehog pathway during embryonic neuronal development, and also functions in promoting compartmentalized subcellular signaling during adult neuronal function. Unsurprisingly, defects in primary cilium biogenesis and function have been linked to developmental anomalies of the brain, central obesity, and learning and memory deficits. Thus, it is imperative to study primary cilium biogenesis and ciliary trafficking in the context of neural stem/progenitor cells and differentiated neurons. However, culturing methods for primary neurons require considerable expertise and are not amenable to freeze-thaw cycles. In this protocol, we discuss culturing methods for mixed populations of neural stem/progenitor cells using primary neurospheres. The neurosphere-based culturing methods provide the combined benefits of studying primary neural stem/progenitor cells: amenability to multiple passages and freeze-thaw cycles, differentiation potential into neurons/glia, and transfectability. Importantly, we determined that neurosphere-derived neural stem/progenitor cells and differentiated neurons are ciliated in culture and localize signaling molecules relevant to ciliary function in these compartments. Utilizing these cultures, we further describe methods to study ciliogenesis and ciliary trafficking in neural stem/progenitor cells and differentiated neurons. These neurosphere-based methods allow us to study cilia-regulated cellular pathways, including G-protein-coupled receptor and sonic hedgehog signaling, in the context of neural stem/progenitor cells and differentiated neurons.

The primary cilium is fundamentally important in neural progenitor cell proliferation, neuronal differentiation, and adult neuronal function. Here, we describe a method to study ciliogenesis and the trafficking of signaling proteins to cilia in neural stem/progenitor cells and differentiated neurons using primary neurosphere cultures.

차 섬모를 연구에 차 Neurosphere 문화를 사용하여

The primary cilium is fundamentally important for the proliferation of neural stem/progenitor cells and for neuronal differentiation during embryonic, ...

Application of Chronic Stimulation to Study Contractile Activity-induced Rat Skeletal Muscle Phenotypic Adaptations

Skeletal muscle is a highly adaptable tissue, as its biochemical and physiological properties are greatly altered in response to chronic exercise. To investigate the underlying mechanisms that bring about various muscle adaptations, a number of exercise protocols such as treadmill, wheel running, and swimming exercise have been used in the animal studies. However, these exercise models require a long period of time to achieve muscle adaptations, which may be also regulated by humoral or neurological factors, thus limiting their applications in studying the muscle-specific contraction-induced adaptations. Indirect low frequency stimulation (10 Hz) to induce chronic contractile activity (CCA) has been used as an alternative model for exercise training, as it can successfully lead to muscle mitochondrial adaptations within 7 days, independent of systemic factors. This paper details the surgical techniques required to apply the treatment of CCA to the skeletal muscle of rats, for widespread application in future studies.

This protocol describes the use of the chronic contractile activity model of exercise to observe stimulation-induced skeletal muscle adaptations in the rat hindlimb.

수축 성 활동 유도 된 쥐 골격 근육 Phenotypic 적응 연구 만성 자극에의 응용

Skeletal muscle is a highly adaptable tissue, as its biochemical and physiological properties are greatly altered in response to chronic exercise. To ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

꼬마 선 충 생식 핵의 분포, 단백질, 및 골격을 전산 분석

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Culture and Transfection of Zebrafish Primary Cells

Zebrafish embryos are transparent and develop rapidly outside the mother, thus allowing for excellent in vivo imaging of dynamic biological processes in an intact and developing vertebrate. However, the detailed imaging of the morphologies of distinct cell types and subcellular structures is limited in whole mounts. Therefore, we established an efficient and easy-to-use protocol to culture live primary cells from zebrafish embryos and adult tissue.
In brief, 2 dpf zebrafish embryos are dechorionated, deyolked, sterilized, and dissociated to single cells with collagenase. After a filtration step, primary cells are plated onto glass bottom dishes and cultivated for several days. Fresh cultures, as much as long term differenciated ones, can be used for high resolution confocal imaging studies. The culture contains different cell types, with striated myocytes and neurons being prominent on poly-L-lysine coating. To specifically label subcellular structures by fluorescent marker proteins, we also established an electroporation protocol which allows the transfection of plasmid DNA into different cell types, including neurons. Thus, in the presence of operator defined stimuli, complex cell behavior, and intracellular dynamics of primary zebrafish cells can be assessed with high spatial and temporal resolution. In addition, by using adult zebrafish brain, we demonstrate that the described dissociation technique, as well as the basic culturing conditions, also work for adult zebrafish tissue.

We present an efficient and easy-to-use protocol for preparing primary cell cultures of zebrafish embryos for transfection and live cell imaging as well as a protocol to prepare primary cells from adult zebrafish brain.

문화와 Zebrafish 기본 세포의 Transfection

Zebrafish embryos are transparent and develop rapidly outside the mother, thus allowing for excellent in vivo imaging of dynamic biological processes in ...

A Hyperandrogenic Mouse Model to Study Polycystic Ovary Syndrome

Hyperandrogenemia plays a critical role in reproductive and metabolic function in females and is the hallmark of polycystic ovary syndrome. Developing a lean PCOS-like mouse model that mimics women with PCOS is clinically meaningful. In this protocol, we describe such a model. By inserting a 4 mm length of DHT (dihydrotestosterone) crystal powder pellet (total length of pellet is 8 mm), and replacing it monthly, we are able to produce a PCOS-like mouse model with serum DHT levels 2 fold higher than mice not implanted with DHT (no-DHT). We observed reproductive and metabolic dysfunction without changing body weight and body composition. While exhibiting a high degree of infertility, a small subset of these PCOS-like female mice can get pregnant and their offspring show delayed puberty and increased testosterone as adults. This PCOS-like lean mouse model is a useful tool to study the pathophysiology of PCOS and the offspring from these PCOS-like dams.

We describe the development of a lean PCOS-like mouse model with&#160;dihydrotestosterone pellet to study the pathophysiology of PCOS and the offspring from these PCOS-like dams.

Polycystic 난소 증후군 연구 Hyperandrogenic 마우스 모델

Hyperandrogenemia plays a critical role in reproductive and metabolic function in females and is the hallmark of polycystic ovary syndrome. Developing a ...

Assessment of Oxidative Damage in the Primary Mouse Ocular Surface Cells/Stem Cells in Response to Ultraviolet-C (UV-C) Damage

The ocular surface is subjected to regular wear and tear due to various environmental factors. Exposure to UV-C radiation constitutes an occupational health hazard. Here, we demonstrate the exposure of primary stem cells from the mouse ocular surface to UV-C radiation. Reactive oxygen species (ROS) formation is the readout of the extent of oxidative stress/damage. In an experimental in vitro setting, it is also essential to assess the percentage of dead cells generated due to oxidative stress. In this article, we will demonstrate the 2&#39;,7&#39;-Dichlorofluoresceindiacetate (DCFDA) staining of UV-C exposed mouse primary ocular surface stem cells and their quantification based on the fluorescent images of DCFDA staining. DCFDA staining directly corresponds to ROS generation. We also demonstrate the quantification of dead and live cells by simultaneous staining with propidium iodide (PI) and Hoechst 3332 respectively and the percentage of DCFDA (ROS positive) and PI positive cells.

Assessment of Oxidative Damage in the Primary Mouse Ocular Surface Cells/Stem Cells in Response to Ultraviolet-C UV-C Damage

This protocol demonstrates the simultaneous detection of reactive oxygen species (ROS), live cells, and dead cells in live primary cultures from mouse ocular surface cells. 2&#39;,7&#39;-Dichlorofluoresceindiacetate, propidium iodide, and Hoechst staining are used to assess the ROS, dead cells, and live cells, respectively, followed by imaging and analysis.

자외선-C (UV-C) 손상에 응하여 1 차 마우스 안구 표면 세포/줄기 세포에 있는 산화 손상의 평가

The ocular surface is subjected to regular wear and tear due to various environmental factors. Exposure to UV-C radiation constitutes an occupational ...