이 작품은 부분적으로 CD에 NIDA / NIH 보조금 DA024558, DA30896, DA033892 및 DA021471에 의해 지원됩니다. 우리는 또한 RCMI 부여 G12MD007586을 인정, 밴더빌트 CTSA는 UL1RR024975을 부여의 Meharry 중개 연구의 중앙에 NCRR / NIH의 NIMHD / NIH에서 U54 그랜트 MD007593, 그리고 테네시 CFAR 보조금 P30의 AI110527에서 (MeTRC) CTSA 부여 U54의 RR026140.

1. 바이러스 생산 참고 : 감염성 HIV-1의 높은 역가를 생성 활성화 된 덴드리머 기반의 형질 전환 시약을 사용하여 감염성 HIV-1 분자 복제와 인간 배아 신장 (HEK) 세포주 293T를 형질합니다. 이 인산 칼슘 트랜 스펙 션 방법은 유사한 결과를 얻을 수 있음이 관찰되었다. <ol><li> 바이오 안전성 레벨 2 (BSL2) 실험실, 종자 8 10cm 접시 당 3 × 10 6 293T 세포 mL의 10 % 태아 소 혈청 (FBS), 페니실린과 스트렙토 마이신이 보충 된 둘 베코의 수정 독수리 중간 (DMEM)의. 문화 37 ° C로 설정 배양기 5 %의 셀 CO 2 O / N. </li><li> 다음날, 각 10cm 접시에 세포를 형질 감염에 대한 혈청과 항생제가없는 DMEM 300 μL의 최종 볼륨에 pNL4-3 플라스미드 DNA (참조 자료 표)의 8 μg의 희석. 의 형질 전환 시약 80 μL를 추가 피펫으로 잘 혼합하고 실온에서 부화5 - 형질 전환 복합체 형성을위한 10 분. </li><li> 흡인하여 요리에서 배지를 제거하고 혈청과 항생제가 포함 된 신선한 DMEM의 접시 당 7 mL를 넣어. </li><li> , 트랜 단지에 DMEM 포함 된 혈청과 항생제 1 mL를 넣고 피펫으로 혼합하고, 세포 혼합물을 추가합니다. 조심스럽게 형질 단지의 균일 한 분포를 용이하게 접시를 소용돌이 친다. </li><li> 즉시 48 시간 동안 세포를 CO 2, 37 ℃, 5 %로 설정 인큐베이터에서 BSL3 실험실 배치하는 셀을 전송하고 배양. </li><li> 피펫을 이용하여 바이러스 - 함유 조직 배양 상등액을 수집 한 후 원심 분리 튜브로 옮긴다. 5 분 동안 300 × g으로 원심 분리는 세포 파편 펠렛 후, 0.45 ㎛의 공극 크기의 주사기 필터로 상청액을 필터링한다. </li><li> 이 무 세포 바이러스 제제의 임의 이월 플라스미드 DNA를 제거하기 위해 1 시간 동안 37 ° C에서 하나의 DNase (20 μg의 / mL)로 처리한다. </li><li> 을 정량화하기그것은 일상적인 사용 (22)에 대한 신속하고 의무 방법으로 HIV-1 역가,은 P24 특정 효소 면역 분석 (ELISA)를 사용합니다. 주 : P24 ELISA 물리적 역가 (바이러스 입자의 수)를 측정된다는 사실을 주목해야한다. 대안으로, 바이러스 관련된 RT 활동 (외인성 RT 분석) 또는 바이러스 감염 (TZM-BL 표시 세포주 계 감염성 분석)를 측정하는 감염성 바이러스 입자를 제외한 판독을 제공한다. </li></ol> 먹어 볼래요-T1 세포의 2. 바이러스 감염 (BSL3 실험실) <ol><li> BSL2 연구실에서 1 6 10 × 10 × 1.0 6 2.0 세포 / 로즈웰 파크 기념 연구소 (RPMI) 10 % 열 - 불 활성화 FBS, 페니실린 보충 매체 및 스트렙토 마이신의 ㎖ (분할 비율 먹어 볼래요-T1 세포를 유지 : 2 매 2-3 D). 배양 플라스크로부터 섭-T1 세포 풀 피펫 팅하여 잘 혼합하고, 혈구 및 트리 판 블루 배제 성을 이용하여 생존 세포 수를 결정방법을 aining. <ol><li> 50 mL의 원뿔 원심 분리기 튜브에 (바이러스 감염 당) 80 × 10 6 세포의 분취 필요한 수를 준비합니다. </li><li> 500 XG에서 스윙 버킷 로터에서 세포를 원심 분리기, 5 분 동안 25 ° C. 세포 배양 배지를 제거하지 않고, 상기 처리를 위해 BSL3 실험실로 펠렛 세포를 함유하는 튜브에 옮긴다. 조심스럽게 세포 펠렛을 방해하지 않고, 튜브로부터 세포 배양 배지를 흡인. </li></ol></li><li> 관의 세포의 DNase I 처리 된 바이러스 접종 물을 적당량 첨가하고 부드럽게 피펫 팅하여 잘 혼합한다. 80 × 10 6 세포의 경우, DNase의 I-처리 바이러스 (P24-해당하는 바이러스의 50 μg의) 30 ㎖를 사용합니다. 참고 : 기능 PICS는의 분리는 감염의 매우 높은 다중도 (MOI)와 표적 세포를 감염이 필요합니다. </li><li> 균일 즉이 6 잘 조직 배양 플레이트 (12 X 2.5 mL를 씩 사이의 혼합물을 배포, 감염되고 당이 판을 사용이온). </li><li> spinoculation를 들어, 스윙 버킷 480 XG에 로터와 2 시간 동안 25 ° C를 사용하여 플레이트 캐리어 원심 분리기의 문화 판을 놓습니다. </li><li> 5 시간 동안 CO (2)을 37 ° C에서 spinoculated 세포를 인큐베이션하고, 5 %. </li></ol> 감염된 세포의 3. 수확 및 용해 (BSL3 실험실) <ol><li> 한 50㎖ 원추형 원심 분리 튜브에 배양 플레이트에서 각각 감염에 대응하는 셀 (~ 총 30 ml)에 풀. </li><li> 300 × g으로 원심 분리하여 세포를 수확하고 10 분 동안 25 ° C. 조심스럽게 튜브에서 뜨는을 대기음 (또는, 피펫 사용). </li><li> 남아있는 바이러스 입자를 제거하려면 버퍼 K 2 ㎖를 추가하여 각각의 세포 펠렛을 씻어 - / - (150 밀리미터의 KCl, 20 mM의 HEPES, pH가 7.6, 5 밀리미터의 MgCl 2) 300 XG에 샘플 25 ° C에 대한 원심 분리 10 분. 그 후, 펠렛을 방해하지 않고, 조심스럽게 흡인에 의해 또는 피펫을 이용하여 상층 액을 제거합니다. </li><li> Repeat 단계 3.3. </li><li> 조심스럽게 마이크로 피펫을 사용하여 남아있는 버퍼를 제거합니다. 빙냉 용해 완충액 K 2 ㎖에 각 세포 펠렛을 재현 탁 + / + (버퍼 K - / - 0.025 %의 디기 토닌, 1 mM의 DTT, 20 μg의 / ㎖ 아프로 티닌 보충) 부드러운 피펫 팅하여 내용물을 혼합하고, 편입 2 ML의 microcentrifuge 관. </li></ol> 세포질의 PICS는 4. 준비 (BSL3 실험실) <ol><li> 실온에서 10 분 동안 회전 진탕 기에서 샘플 락. </li><li> 1,500 XG에서, 4 ° C에 예비 냉각 로터와, 샘플을 원심 분리기 4 분 동안 4 ° C. </li><li> 펠렛을 방해하지 않고, 신중 16,000 XG에서 새로운 microcentrifuge 관과 원심 분리기에 뜨는을 전송하고 1 분 4 ° C. </li><li> 조심스럽게 새로운 microcentrifuge 관에 뜨는을 전송합니다. 30 분 (NO 요동)을 실온에서 20 μg의 내용 / ㎖ (찍어 2ml를 2 μL)의 최종 농도의 RNase A (20 ㎎ / ㎖)를 첨가하고, 배양한다. &lt;/ 리&gt; <li> 7 %의 최종 농도로 부드러운 피펫으로 잘 혼합 (- - / 버퍼 K에 w 60 % / v)의 크로스를 추가합니다. 액체 질소에서 동결 플래시 및 장소에서 -80 장기 보존 C 냉동기 °, 마이크로 원심 튜브에 분취 찍어 (예, 200 μL)를 준비한다. </li></ol> 체외 통합 5. (IVI) 분석 실험은 HIV-1 사진을 사용하여 <ol><li> 주문 제작 프라이머, phiX174-F와 phiX174-R을 사용하여 PCR로 phiX174 플라스미드 DNA에서 2.0 kb의 영역을 증폭하여 IVI 분석에 사용되는 타겟 DNA를 준비합니다. <ol><li> 표 1에 기재된 바와 같이 PCR 혼합물을 조립한다. 표 2에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다. (제조사 권장 프로토콜 다음) 겔 정제 키트를 사용하여 PCR 생성물을 겔 - 정제하고, 사용시까지 -80 ℃에서 분취로 정제 된 타겟 DNA를 저장한다. </li></ol></li><li> (200)에 표적 DNA 600 ng의 추가 - &amp; #(181), PICS는의 L 나누어지는이 잘 혼합하고, 45 분 동안 37 ° C에서 품어. 참고 : 인테그라 제 억제제 (예를 들어, Raltegravir)을 대상 DNA를 생략하거나 포함 IVI 반응은 제어 반응을 권장합니다. </li><li> 0.5 %, 8 mm의 각각 0.5 ㎎ / ㎖의 최종 농도로 SDS, EDTA, 및 프로 티나 제 K를 첨가하여 IVI 반응을 멈춘다. 철저하게 반응 내용을 혼합하고 하룻밤에 56 ° C를 품어. </li><li> 그 다음날, 페놀 / 클로로포름 추출 및 에탄올 침전에 의해 IVI 반응에서 전체 DNA를 정제. 16,000 XG 및 RT의 모든 원심 분리 단계를 수행하십시오. </li><li> 2 분 들어, 탈 단백 시료에 페놀의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 원심 분리기. 조심스럽게 위 수성 상을 제거하고 새로운 튜브로 전송할 수 있습니다. </li><li> 단계를 반복 5.5. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> , 클로로포름 혼합물 텍싱에 의해 격렬하게 혼합하고, 원심 분리 기용 : 1 페놀 : 1의 동일한 볼륨을 추가R 2 분. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> 클로로포름의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 2 분 동안 원심 분리. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> , DNA를 침전 0.3 M의 최종 농도 0.1 μg의 / μL, 초산 나트륨 3 M의 최종 농도로 글리코겐을 추가하고, 100 % 에탄올 (빙냉) 2.5 볼륨. 소용돌이는 내용을 수집, 원심 분리기 간략하게 혼합하고, -80 ° CO / N에 튜브를 배치합니다. </li><li> 다음 날, 16,000 XG에서 30 분 동안 샘플을 원심 분리하고 30 분 동안 4 ° C. 조심스럽게 펠렛을 방해하지 않고 뜨는을 제거합니다. </li><li> 16,000 XG에서 펠렛 원심 분리기 80 % 에탄올 (얼음처럼 차가운) 500 μL를 추가하고 10 분 동안 4 ° C. RT에서 DNA 펠렛을 공기 - 건조하고 철저하게 클레아없는 물 50 μL에 재현 탁. -20 ° C에서 DNA 샘플을 저장합니다. </li></ol> 정량화 PIC 활동 6. PCR 분석 실험 <ol><li> 통합 된 HIV-1 DNA의 접합을 증폭 (각각 LTR 및 phiX174 프라이머) 바이러스 LTR과 phiX174 DNA를 대상으로 프라이머를 사용하여 1 라운드 기존의 PCR을 수행합니다. <ol><li> 표 3에 기재된 바와 같이 1 라운드 PCR 혼합물을 조립한다. 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립, 별도의 PCR 튜브에 45 μL 씩 분배하고, 템플릿 DNA 또는 클레아없는 물 (제어)의 5 μL를 추가합니다. </li><li> 표 4에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다. </li></ol></li><li> 상기 제 1 로로부터 집적 vDNA 서열을 증폭 바이러스 LTR (LTR-R 및 LTR-U 프라이머)의 짧은 영역의 측면에 프라이머를 사용하여 두 번째 라운드 qPCR을 수행싶게 PCR 제품. 통합 vDNA 숫자를 복사 확인하려면 알려진 사본 번호의 10 배 연속 희석을 사용하여 표준 곡선을 생성 (예를 들어, 10 0-10 8) HIV-1 분자 클론의. <ol><li> 표 5에 기재된 바와 같이 2 라운드 qPCR의 혼합물을 조립한다. 96 웰 PCR 반응 플레이트에 웰의 적절한 수에 25 μL 씩 분배주의, 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립 한 후 정제되지 않은 1 라운드의 PCR 제품이나 클레아없는 물을 5 μL를 추가 (제어). 세중의 모든 qPCR에 반응을 수행합니다. </li><li> 실시간 PCR 장비로 PCR 플레이트를 넣고 표 6에 추천 사이클링 조건을 사용하여 qPCR을 수행합니다. </li><li> 적합한 소프트웨어를 사용하여 데이터를 분석한다. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

저자는 더 경쟁 재무 및 비재무 이익을 선언합니다.

레트로 바이러스 PICS는의 생화학 적 분석은 레트로 바이러스 DNA 통합의 메커니즘에 중요한 통찰력을 제공하고 있습니다. 레트로 바이러스 찍어 통합 활성 측정은 플라크 형성 분석법, 서던 블롯 분석, 및 중첩 qPCR에 의해 달성 될 수있다. 플라크 분석의 실험적 전략은 힘든이고 통합 6, 7, 18를 측정하는 간접 방법을 이용한다. 남부 오점 기반 분석 측정 통합은 직접하지만 PICS는 6, 7, 18의 비교적 높은 금액을 필요로한다. 이 보고서는 시험관 내에서 HIV-1 PIC 관련된 통합 활동을 측정하기위한 중첩 qPCR의 전략 사항. 가장 큰 장점이 방법의 의미는 반응 4 당 PIC 준비의 상대적으로 낮은 양의 요구 사항입니다5, 19. 이 방법의 가장 중요한 단계는 감염에 대한 높은 역가의 바이러스의 생성 및 PIC의 준비 처리이다. PCR의 첫 번째 라운드가 통합 접합부의 지수 적 증폭을 포함하는 것이 주목되어야한다. 따라서, 두 번째 라운드 qPCR에 결정된 통합 vDNA의 카피 수는, 따라서, PIC 관련 vDNA 복사본의 측정치를 제공하지 않는 한 제한 반 정량적이고. DNA가 LTR 특이 적 프라이머로 찍어로부터 정제의 그러나, PIC 관련 vDNA는 qPCR에 의해 결정될 수있다. 통합 vDNA의 비율은 시험 관내 통합 반응 통합 효율성에 대한 정보를 제공 할 수있는 대응 PIC 관련 vDNA에 번호를 복사한다. 이 방법은 두 방향에서의 통합을 검출하기 위해 선택하고, 다른 프라이머의 다른 이종의 타겟 DNA를 도입함으로써 변형 될 수있다. 요약하면, 방법여기에 설명 된 정량적 HIV-1 찍어 통합 활성을 측정하고, 레트로 바이러스 통합 생화학 상세한 이해를 개발 연구를 위해 채택 될 수있다.

초기와 후기 이벤트 : 표적 세포에서 HIV-1 복제는 크게 두 단계로 구분 여러 단계를 포함한다. HIV-1을 순차적으로 표적 세포 표면 수용체 CD4 및 두 개의 공동 수용체 (CCR5 또는 CXCR4 1) 중 하나에 결합 할 때 초기 이벤트는 시작한다. 따라서, 바이러스 세포막 퓨즈 및 바이러스 캡시드는 (CA) 코어는이 세포질로 방출된다. 칼슘 코어는 바이러스와 기원 세포 모두 바이러스 게놈의 단일 가닥 RNA (ssRNA) 및 여러 가지 단백질을 포함하고 있습니다. 칼슘 - 관련 바이러스 성 단백질은 역전사 효소 (RT) 및 인테그라 (IN), 바이러스 복제의 초기 발생시 중요한 단계를 매개이 효소를 포함한다. 역전사 및 핵 단백질 복합체, 즉 역전사 착체 (RTC) 및 사전 통합 복합체 (PIC)는 각각 3, 4, 5의 문맥 함수 IN &lt;SUP&gt; 6. &quot;(말 3에서) (끝 U3 바이러스 ssRNA 게놈 항구 터미널 반복 (R) 5시) &#39;고유 시퀀스 U5에 인접 요소의 끝. RTC는 이중 가닥 (DS) DNA 사본 (vDNA)에 바이러스 ssRNA 게놈 변환합니다. 이 역전사 과정은 따라서 vDNA (7, 8)의 양단의 긴 말단 반복 (LTR)을 생성하는 U5 및 U3 서열의 중복을 초래한다. 이어서, PIC 관련 IN 호스트 염색체 9, 10, 11로 vDNA의 통합을 가능하게 두 개의 연속 생화학 적 반응을 촉매한다. 우선, 세포질, 다량 모두의 LTR (12)와 결합 및 3&#39;- 말단의 각각으로부터 뉴클레오티드를 절단. 이것은 3&#39;- 말단 처리가 각 3&#39;- 단부 vDNA의 (CA OH)에 수산기를 생성한다.IN은 지그재그 방식으로 염색체 DNA의 두 가닥을 절단하는 친핵체로서 오 vDNA CA를 사용하는 것을 특징이어서, PIC는 핵 트래 피킹. 동시에, IN은 배위 염색체 DNA의 반대쪽 가닥에 생성 된 포스 포디 에스테르 결합에 vDNA의 양 단부를 접합한다. 이 스트랜드 전사 공정 후, 숙주 세포 기계 통합 사이트의 교차점에서 5 &#39;를 vDNA의 단부 및 수리 계속되는 본쇄 갭의 2 개의 비 결합 (unpaired) 뉴클레오타이드를 제거한다. 초기 이벤트는 따라서 HIV-1 게놈의 통합 DNA 사본 (프로 바이러스)의 설립과 함께 절정에 달하다. 프로 바이러스는 바이러스 - 인 코드 된 단백질의 발현을 포함하여 이후의 이벤트를 시작 효율적인 바이러스 유전자 발현에 적합한 환경을 제공하고; 미성숙 바이러스의 조립; 감염성 비리 (13)에 신진, 릴리스 및 성숙. 정제 된 재조합 레트로 바이러스의 IN은에 능력이시험관 내에서, 수행, 모두 3&#39;- 말단 처리 및 가닥 전송 활동에 외생 적 LTR 같은 기판 DNA 제공. 이러한 정제 된 재조합의 IN을 사용하여 생화학 연구 vDNA 통합 14, 15, 16, 17의 중요한 측면을 계시했다. 그러나, 자연 감염과는 달리,이 시험 관내 생화학 적 반응은 표적 DNA에 기판 DNA의 양 단부의 공동의 통합을 지원하지 않는다. 대조적으로, 심하게 감염된 세포로부터 단리 레트로 찍어 concertedly 이종 대상 DNA로 내인성 vDNA의 양단을 통합한다. 이것은 고립 된 원시 사진을 사용하여 널리 채택 및 I n은 체외 통합 (IVI) 분석의 후속 개선되었다. 처음에 레트로 바이러스 IVI 분석, 재조합 쥐에 감염된 세포로부터 세포질 추출물을보고그 LTR의 대장균 supF 유전자 형질 백혈병 바이러스 (MLV)는 IN 활성 소스 및 용균 성장 결함이 외생 대상 DNA로 공급 하였다 돌연변이 람다 파지 DNA 역임. 재조합 MLV DNA의 성공적인 통합은 파지 DNA에 복사하고 supF 다음의 표현은 재조합 파지의 플라크 형성 능력의 복원되었다. 그러나이 실험 전략은 간접적 인 방식으로 힘들고 조치 통합이다. 이러한주의 사항을 해결하기 위하여, 외인성 선형 박테리오 phiX174 DNA에 통합 내인성 vDNA의 척도로서 PIC 관련 IVI 활성을 정량화 서던 블롯 기반 간접 단부 라벨링 분석은, 18 (7), (6)을 개발 하였다. 이 방법은 통합 이벤트의 직접적인 측정을 제공하지만, PIC 제제의 상대적으로 높은 양의 기술적 도전 유지하는 필요노력. 이 문제를 회피하기 위해, PICS는의 적당한 양을 필요로하는 중첩 된 PCR 기반의 분석은, 19 (5), 4 개발되었다. 이 보고서에서 우리는의 업데이트 된 버전을 설명 중첩 된 자연 감염시 발생하는 HIV-1 PIC 매개 통합 활동을 요점을 되풀이하기 위해 고안 체외 방법에서 PCR 기반. 이 방법은 실시간 정량 중합 효소 연쇄 반응 (qPCR에)로 측정 PIC 내인성 활성 소스로서 HIV-1 감염 표적 세포의 세포질 추출물을 사용한다. 자신의 통합 활동을 사진을 분리하고 측정하기위한 절차는 Engelman 실험실 (20)에 의해 출판 프로토콜에서, 수정과, 적응하고 있습니다. 이 방법에서, PIC 관련된 통합 활동 외인성 선형 표적 DNA (21)로부터 생성 된 DNA의 제품을 제공함으로써 개시된다이러한 통합 반응으로 정제 이후 PCR 기반 정량 용 원료로서 사용된다. 제 1 라운드 PCR 통상적으로, 바이러스 표적 DNA 접합은 적절한 프라이머를 사용하여 증폭된다. 두 번째 라운드에서 qPCR에가, LTR 특정 프라이머는 특히 1 라운드 PCR 제품에서 vDNA 인구를 풍부하게하는 데 사용됩니다. 이 방법에 대한 자세한 설명을위한 프로토콜 섹션을 참조하십시오. 레트로 바이러스 찍어와 시험관 연구에서 레트로 바이러스 DNA 통합의 메커니즘에 대한 우리의 이해와 IN 억제제의 개발에 상당한 발전을 주도하고있다. HIV-1 통합 바이러스 및 호스트 요인의 역할을 결정하고, 약물 내성 퇴치를 향해 새로운 항 바이러스 약물을 개발, 매핑 HIV-1 통합 사이트에서 최근 증가 초점을 바탕으로, 우리는 IVI 분석의 증가 된 관심과 광범위한 사용을 직시 이 보고서에 설명 된 것과 같은. 이 차례로 이어질 것상기 방법은 향후 개선함으로써, 그 응용 범위를 다양.

<table><tbody><tr><td>&lt;p&gt;Fetal Bovine Serum (FBS)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10437-028&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Heat-inactivated Fetal Bovine Serum (Hi-FBS)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10438-026&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Dulbecco&amp;rsquo;s modified Eagle&amp;rsquo;s medium (DMEM)&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;11995-065&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Roswell Park Memorial Institute (RPMI) 1640 medium&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;11875-093&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Phosphate-buffered Saline (PBS) (1x)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;20012-027&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Trypsin-EDTA (0.25%)&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;25200-056&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Penicillin-Streptomycin solution (100x)&lt;/p&gt; </td><td> &lt;p&gt;Cellgro/Mediatech&lt;/p&gt; </td><td> &lt;p&gt;30-002-CI&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;HEK293T cells (293T)&lt;/p&gt; </td><td> &lt;p&gt;American Type Culture Collection (ATCC)&lt;/p&gt; </td><td> &lt;p&gt;CRL-3216&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;HIV-1 proviral molecular clone pNL4-3&lt;/p&gt; </td><td> &lt;p&gt;NIH AIDS Research and Reference Reagent Program&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;114&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;PolyFect transfection reagent&lt;/p&gt; </td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;301107&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;DNase 1&lt;/p&gt; &lt;p&gt;&lt;/p&gt;</td><td> &lt;p&gt;Calbiochem/Merckmillipore&lt;/p&gt; </td><td> &lt;p&gt;260913&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sup-T1 cells&lt;/p&gt;</td><td> &lt;p&gt;American Type Culture Collection (ATCC)&lt;/p&gt; </td><td> &lt;p&gt;CRL-1942&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;HEPES pH 7.2 - 7.5&lt;/p&gt; &lt;p&gt;(ready-to-use solution)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;15630-080&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Potassium chloride (KCl) solution&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;60142&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Magnesium chloride (MgCl&lt;sub&gt;2&lt;/sub&gt;) solution&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;M1028&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Dithiothreitol (DTT)&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;43815&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Aprotinin&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;A6106&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Digitonin&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;D141&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;RNase A&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;12091-021&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Sucrose&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;S0389&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;phiX174 Replicative Form 1 DNA&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;D1531&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;&lt;u&gt;PhiX174-F primer:&lt;/u&gt;&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CGCTTCCATGACGCAGAAGTT-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;u&gt;PhiX174-R primer:&lt;/u&gt;&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CACTGACCCTCAGCAATCTTA-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;dNTP mix&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;U1515&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Go Taq DNA Polymerase&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;M3005&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Qiaquick gel extraction kit&lt;/p&gt; </td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;28706&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Ultrapure distilled water&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10977-015&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Tris-EDTA (TE) buffer (100x)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;T9285&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sodium Dodecyl Sulphate (SDS)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;L3771&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;E7889&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Proteinase K (20 mg/mL ready-to-use solution)&lt;/p&gt;</td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;19131&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Phenol (equilibrated with 10&amp;nbsp;mM Tris HCl, pH&amp;nbsp;8.0 and 1&amp;nbsp;mM EDTA)&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;P4557&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Chloroform&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;288306&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Glycogen (5 mg/mL solution)&lt;/p&gt;</td><td> &lt;p&gt;Ambion/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;AM9510&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sodium acetate (3 M, pH 5.2)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td>&lt;p&gt;S7899&lt;/p&gt;</td><td></td></tr><tr><td> &lt;p&gt;Ethanol&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;E7023&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;&lt;u&gt;First round LTR primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-GTGCGCGCTTCAGCAAG-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;u&gt;First round phiX174 primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CACTGACCCTCAGCAATCTTA-3&amp;rsquo;&lt;/p&gt;</td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;---&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;&lt;u&gt;Second round LTR-R primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-TCTGGCTAACTAGGGAACCCA-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;u&gt;Second round LTR-U primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CTGACTAAAAGGGTCTGAGG-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;u&gt;Second round Taqman probe&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;&amp;nbsp;5&amp;rsquo;-6- FAM/TTAAGCCTCAATAAAGCTTGC&lt;/p&gt; &lt;p&gt;CTTGAGTGC/6-TAMRA/-3&amp;rsquo;&lt;/p&gt;</td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;---&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;iQ Supermix&lt;/p&gt; </td><td> &lt;p&gt;Bio-Rad&lt;/p&gt; </td><td> &lt;p&gt;170-8862&lt;/p&gt; </td><td></td></tr></tbody></table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1 외피 단백질은 세포질로의 바이러스 캡시드 (CA) 코어의 박리 하였다 바이러스 세포 막 융합을 유도하는 표적 세포의 표면에 동족 수용체 결합. 이어서, 바이러스 성 역전사 효소 (RT)를하는 딴 핵 단백질 복합체의 일부로서 복합 역전사 (RTC)를 이중 - 가닥 DNA 카피 (vDNA)에 바이러스의 단일 가닥 RNA 게놈을 변환 불린다. 이것은 다른 핵 단백질 복합체의 생물 발생에 이르게 상기 vDNA과 관련된 바이러스 단백질, 숙주 인자 이루어지는 사전 통합 복합체 (PIC)를 불린다. PIC는 관련 바이러스 인테그라 제 (IN)은 시간적 및 공간적으로 조절 두 단계에서 호스트 염색체 DNA 내로 vDNA의 통합을 조정한다. 우선, IN은 PIC의 핵 트래 피킹 후에는 염색체 DNA 내로 통합 처리 vDNA을 매개, 둘째, 세포질에서 vDNA의 3 &#39;말단을 처리하고. 찍어 절연그들이 이종 외생 첨가 타겟 DNA에 관련된 vDNA를 통합하는 능력이 급격 같이 HIV-1 감염 표적 세포에서 시험 관내 기능이다. 이러한 PIC 기반 체외 통합 분석에서 크게 레트로 바이러스 통합의 기계적인 세부 사항을 서술 및 억제제 년에 발견에 기여했다. 이보고에서는 절연 기본 찍어 관내 통합 활동을 측정하기위한 중첩 정량적 실시간 중합 효소 연쇄 반응 (qPCR에) 기반 전략을 채택 업데이트 HIV-1 PIC 분석에 상세히.

HIV-1 PICS는의 분리 급성 감염 섭-T1 세포에서 HIV-1 찍어 분리에 사용되는 프로토콜의 개략도는도 1에 도시되어있다. 이 프로토콜은 Engelman 등에 의해 기술 된 방법에서 파생됩니다. 19, 20. HIV-1 감염 세포 찍어 조립하고 역전사 vDNA 구성되어 핵 단백질 복합체 바이러스 단백질, 및 세포 인자 (19), (20)이다. 이 보고서에 기술 된 방법은 PIC 관련된 통합 활성 소스로서 HIV-1 감염 세포의 세포질 추출물을 사용한다. HIV-1 PICS는의 체외 통합 활동 개략도가도 2에 도시되어있다. 이 방법은 PIC 관련 IVI 활성을 측정하기위한 중첩 qPCR에 기반 전략을 이용하고, 절차는 Engelman 실험실 19, 20, 21 일 발행 프로토콜에서 변형으로 구성된다. 이 방법에서, PIC 관련된 통합 활성 이종 선형 표적 DNA (21)를 제공함으로써 개시되고,이 통합 반응으로부터 생성 된 DNA 제품은 정제 및 후속 PCR 기반 정량 용 원료로서 사용된다. 제 1 라운드 PCR 통상적으로, 바이러스 표적 DNA 접합은 적절한 프라이머를 사용하여 증폭된다. 두 번째 라운드에서 qPCR에가, LTR 특정 프라이머는 특히 1 라운드 PCR 제품에서 vDNA 인구를 풍부하게하는 데 사용됩니다. 프로토콜의을 참조하십시오이 방법에 대한 자세한 설명은 ection. IVI 분석에서 대표 결과는 HIV-1 PICS는이 그림 3에 표시됩니다 사용하여 수행. 한모금-T1 셀 (80 × 106 세포 / 감염)의 DNase 1 처리 된 HIV-1 30 mL로 spinoculated 하였다 (~ P24 당량를 50㎍) (480)의 부재 또는 억제제 Raltegravir IN 1 μM HIV-1의 존재하에 XG 2 시간 동안 25 ° C. 세포는 37 ° C에서 5 시간, 5 % CO 2의 후속 배양 하였다. 프로토콜 절에 설명 된대로 찍어 절연 하였다. IVI 반응은 45 분 동안 37 ℃에서 각각 사용 찍어 200 μL와 타겟 DNA의 600 NG (PCR에 의한 phiX174의 DNA로부터 증폭하여 2kb DNA 단편)을 행 하였다. 반응은 56 ° CO / N에서 SDS 및 EDTA의 존재하에 프로 테이나 제 K 처리에 의해 탈 단백 하였다. 클로로포름 (1 : 1)의 반응 생성물이 일단 페놀, 페놀 회 추출 하였다 혼합하고 일단클로로포름. 이어서, DNA를 에탄올 침전 염과 공동 침전물 글리코겐의 존재는이고, DNA 펠렛을 80 % 에탄올로 한 번 세척 하였다. 정제 된 DNA는 뉴 클레아 제 무 물 50 μL에 재현 탁시켰다. 중첩 qPCR의 전략은 phiX174 DNA에 통합 vDNA의 수를 결정하는 데 사용되었다. 제 1 라운드 종래의 PCR에서, phiX174 타겟 DNA와 바이러스 LTR 영역의 서열에 상보적인 프라이머는 통합 반응 DNA 제품의 5 μL로 통합 바이러스 표적 DNA 접합을 증폭하는데 사용되었다. 두 번째 라운드에서 qPCR에가, LTR-에 걸쳐 프라이머가 독점적으로 1 라운드 앰플 리콘 제품의 5 μL로부터의 HIV-특정 DNA 서열을 증폭하는 데 사용 된 알려진 사본 번호의 연속 희석을 10 배 (10 8 -10 0) 에이즈-1 분자 클론 (표준). 모든 qPCR의 반응을 3 중으로 수행 하였다 데이터 WERE는 상용 소프트웨어를 이용하여 분석 하였다. 기준으로부터 유도 된 값은 통합 vDNA 숫자 보간이 복사되는 표준 곡선을 생성하는 플롯 하였다. 오차 막대는 표준 편차를 나타냅니다. 그림 3에 도시 된 바와 같이, HIV-1 찍어 견고 표적 DNA (레인 5)에 연결된 vDNA 통합. 중요한 것은, 사진을 IVI의 효율을 크게 IN 억제제 Raltegravir (레인 6)으로 보충 반응이 감소 하였다. 이것은 강력한 HIV-1 IN이 분석에서 측정 통합 활동 속성. 또한, 감염되지 않은 세포로부터 세포질 분해물을 포함하는 제어 반응 (레인 1) 단독으로 찍어 (레인 2)는 단독으로 DNA (레인 3)를 대상으로하고, 임의의 적분 활성을 나타내지 않았다 단독 (레인 4) 버퍼. 또한, 첫번째 라운드 PCR의 Taq 중합 효소를 제외한 제어 (레인 7)를 통합 제품을 증폭하지 않았다. 특히, PICS는 형 제어 (레인 2)의 데이터가 표시 그 중첩 된 qPCR에 전략보고 특정으로는 통합 vDNA 아닌 PIC 관련 vDNA을 측정합니다. 종합적으로, 이들 데이터는 PIC 관련된 통합 활동의 측정 값을 보여준다. <img alt="그림 1" src="/files/ftp_upload/54581/54581fig1.jpg" /> 그림 1 : HIV-1 PICS는의 준비를위한 프로토콜의 도식 표현. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 사진을 포함하는 세포질 추출물은 HIV-1에 감염된 먹어 볼래요-T1 세포로부터 격리됩니다. 이러한 찍어은 통합 시험 관내 분석에서의 통합 활동의 소스로서 사용된다. <img alt="그림 2" src="/files/ftp_upload/54581/54581fig2.jpg" /> 그림 2 : 시험관의 개략도 </e<html> m&gt; HIV-1 PICS는 통합 분석. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 통합 분석은 HIV-1 사진과 이종 phiX174 타겟 DNA를 이용하여 시험 관내에서 수행 하였다. 집적 HIV-1 DNA는 1 차 PCR은 종래 vDNA 특정 서열을 우선적으로 2 라운드 qPCR에 증폭되어 이로부터 통합 접합을 증폭하여 상기 중첩 PCR 전략에 의해 측정 하였다. <img alt="그림 3" src="/files/ftp_upload/54581/54581fig3.jpg" /> 그림 3 : HIV-1 vDNA 통합 활동을 PIC 관련. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> &quot;fo를하기 : 유지-together.within 페이지를 =&quot;1 &quot;&gt; 통합 vDNA가의 10 배 연속 희석을 사용하여 생성 된 표준 곡선에서 파생 된 값을 플롯에 의해 결정되었다 번호를 복사 HIV-1 PIC 관련 통합 활동 분석의 대표 결과. HIV-1 분자 클론의 복사본 공지 번호. 모든 반응은 삼중으로 수행하고, 데이터는 상용 소프트웨어를 이용하여 분석 하였다. 오차 막대는 표준 편차를 나타낸다. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 구성 요소 </td><td> 스톡 </td><td> 50 μL 반응에 대한 최종 부피 </td></tr><tr><td> phiX174 플라스미드 DNA </td><td> 10 NG / μL </td><td> 5.0 μL </td></tr><tr><td> GoTaq 반응 버퍼 </td><td> 5 배 </td><td> 10.0 μL </td></tr><tr><td> 염기의 dNTP 믹스 </td><td> 10 mM의 각 </td&gt; <td> 1.0 μL </td></tr><tr><td> phiX174-F 프라이머 </td><td> 10 μM </td><td> 2.5 μL </td></tr><tr><td> phiX174-R 프라이머 </td><td> 10 μM </td><td> 2.5 μL </td></tr><tr><td> GoTaq DNA 중합 효소 </td><td> (5 U / μL) </td><td> 0.25 μL </td></tr><tr><td> 클레아없는 증류수 </td><td> - </td><td> 28.75 μL </td></tr></tbody></table> 1 번 테이블. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> = 2 분 95 ° C </td></tr><tr><td> 사이클 34 반복 : 95 ° C (30)들 = 53 ° C (30)들 = = 2 분, 72 ° C </td></tr><tr><td> 72 ℃에서 10 분 = </td></tr><tr><td> 4 ° C = 보류 </td></tr></tbody></table> 표 2. <tab제작 : FO : 유지-together.within 페이지 = &quot;1&quot;fo를 : 유지 -에 - next.within 페이지 = &quot;항상&quot;&gt; <tbody><tr><td> 구성 요소 </td><td> 스톡 </td><td> 50 μL 반응에 대한 최종 부피 </td></tr><tr><td> IVI 반응 DNA 제품 </td><td> - </td><td> 5.0 μL </td></tr><tr><td> GoTaq 반응 버퍼 </td><td> 5 배 </td><td> 10.0 μL </td></tr><tr><td> 염기의 dNTP 믹스 </td><td> 10 mM의 각 </td><td> 1.0 μL </td></tr><tr><td> LTR 프라이머 </td><td> 10 μM </td><td> 2.5 μL </td></tr><tr><td> phiX174 프라이머 </td><td> 10 μM </td><td> 2.5 μL </td></tr><tr><td> GoTaq DNA 중합 효소 </td><td> (5 U / μL) </td><td> 0.25 μL </td></tr><tr><td> 클레아없는 증류수 </td><td> - </td><td> 28.75 μL </td></tr></tbody></table> 표 3. <table fo:kEEP-together.within 페이지 = &quot;1&quot;FO : 유지 -에 - next.within 페이지 = &quot;항상&quot;&gt; <tbody><tr><td> = 5 분 95 ° C </td></tr><tr><td> 사이클 23 반복 : 94 ° C (30)들 = 55 ° C (30)들 = = 4 분 72 ° C </td></tr><tr><td> 72 ℃에서 10 분 = </td></tr><tr><td> 4 ° C = 보류 </td></tr></tbody></table> 표 4. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 구성 요소 </td><td> 스톡 </td><td> 30 μL 반응에 대한 최종 부피 </td></tr><tr><td> 1 차 라운드 PCR 제품 </td><td> - </td><td> 5.0 μL </td></tr><tr><td> LTR-R 프라이머 </td><td> 10 μM </td><td> 0.9 μL </td></tr><tr><td> LTR-U 프라이머 </td><td> 10 μM </td><td> 0.9 μL </td></tr><tr> &lt;TD&gt;의 TaqMan 프로브 </td><td> 10 μM </td><td> 0.3 μL </td></tr><tr><td> 지능 지수 수퍼 믹스 </td><td> 배 </td><td> 15.0 μL </td></tr><tr><td> 클레아없는 증류수 </td><td> - </td><td> 7.9 μL </td></tr></tbody></table> 표 5. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> = 3 분 95 ° C </td></tr><tr><td> 사이클 39 반복 : 94 ° C (15)들 = 58 ° C (30)들 = 72 ° C (30)들 = 플레이트 읽기 </td></tr></tbody></table> 표 6.

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

측정<em&gt; 체외</em&gt; HIV-1 사전 통합 단지의 통합 활동

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K 조회수.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

비디오: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

양방향 레트로 바이러스 통합 사이트 PCR 방법론 및 정량적 데이터 분석 워크 플로

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

연구

유전학

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV - 1 코어의 시험 관내 Uncoating에서

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

면역학 및 감염병학

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

시험 관내 분석에서 HIV 특정 CD4 T 세포의 이펙터 기능에 면역 경로의 영향을 평가하기

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

제한 효소 기반의 복제 방법을 평가하기 위해<em&gt; 시험관</em&gt; HIV-1 서브 타입 C 개그 - MJ4 키메라 바이러스의 복제 능력

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

인간 면역 결핍 바이러스의 복제 피트니스를 결정하기위한 인접 쌍 성장 경쟁 분석

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

유전자 또는 약물 치료에 사용하기 위해 HIV-1 생산을 표적 RNA를의 효능 및 독성 평가

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Assembly and Purification of Prototype Foamy Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

조립 및 프로토 타입 거품 바이러스 Intasomes의 정화

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

A High-throughput Cre-Lox Activated Viral Membrane Fusion Assay to Identify Inhibitors of HIV-1 Viral Membrane Fusion

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or fluorescence microscopy. An HIV-1 reporter virus (HIV-1 Gag-iCre) is generated by inserting Cre recombinase into the HIV-1 genome between the matrix and the capsid proteins of the Gag polyprotein. This results in a packaging of Cre recombinase into virus particles, which is then released into a target cell line stably expressing a Cre recombinase-activated red fluorescent protein (RFP) to GFP switch cassette. In the basal state, this cassette expresses RFP only. Following the delivery of Cre recombinase into the target cell, the RFP, flanked by loxP sites, excises, resulting in GFP expression. This assay can be used to test any inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems and has been used to identify a class of purinergic receptor antagonists as novel inhibitors of HIV-1 viral membrane fusion.

We describe a cell-based assay to report on HIV-1 fusion via the expression of green fluorescent protein detectable by flow cytometry or fluorescence microscopy. It can be used to test inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems.

높은 처리량 Cre Lox 활성화 에이즈-1 바이러스 막 융해의 억제제를 식별 하기 위해 바이러스 막 융합 분석 결과

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or ...

Detection of Low Copy Number Integrated Viral DNA Formed by In Vitro Hepatitis B Infection

Hepatitis B Virus (HBV) is a common blood-borne pathogen causing liver cancer and liver cirrhosis resulting from chronic infection. The virus generally replicates through an episomal DNA intermediate; however, integration of HBV DNA fragments into the host genome has been observed, even though this form is not necessary for viral replication. The exact purpose, timing, and mechanism(s) by which HBV DNA integration occurs is not yet clear, but recent data show that it occurs very early after infection. Here, the in vitro generation and detection of HBV DNA integrations are described in detail. Our protocol specifically amplifies single copies of virus-cell DNA integrations and allows both absolute quantification and single-base pair resolution of the junction sequence. This technique has been applied to various HBV-susceptible cell types (including primary human hepatocytes), to various HBV mutants, and in conjunction with various drug exposures. We foresee this technique becoming a key assay to determine the underlying molecular mechanisms of this clinically relevant phenomenon.

Detection of Low Copy Number Integrated Viral DNA Formed by In Vitro Hepatitis B Infection

We describe here the in vitro generation of HBV DNA via a Hepatitis B virus infection system and the highly sensitive detection of its (1&#8211;2 copies) integration using inverse nested PCR.

낮은 복사의 번호 통합된 바이러스 성 DNA 생체 외에서 B 형 간염 감염에 의해 형성 된

Hepatitis B Virus (HBV) is a common blood-borne pathogen causing liver cancer and liver cirrhosis resulting from chronic infection. The virus generally ...

<meta charset="utf8"></head><body>T 세포에서 HIV-1 감염 중 ER 스트레스 및 UPR 활성화 연구

Measuring Endoplasmic Reticulum Stress and Unfolded Protein Response in HIV-1 Infected T-Cells and Analyzing its Role in HIV-1 Replication

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses have developed strategies to manipulate the host UPR, but there is a lack of detailed understanding of UPR modulation and its functional significance during HIV-1 infection in the literature. In this context, the current article describes the protocols used in our laboratory to measure ER stress levels and UPR during HIV-1 infection in T-cells and the effect of UPR on viral replication and infectivity. 
Thioflavin T (ThT) staining is a relatively new method used to detect ER stress in the cells by detecting protein aggregates. Here, we have illustrated the protocol for ThT staining in HIV-1 infected cells to detect and quantify ER stress. Moreover, ER stress was also detected indirectly by measuring the levels of UPR markers such as BiP, phosphorylated IRE1, PERK, and eIF2&#945;, splicing of XBP1, cleavage of ATF6, ATF4, CHOP, and GADD34 in HIV-1 infected cells, using conventional immunoblotting and quantitative reverse transcription polymerase chain reaction (RT-PCR). We have found that the ThT-fluorescence correlates with the indicators of UPR activation. This article also demonstrates the protocols to analyze the impact of ER stress and UPR modulation on HIV-1 replication by knockdown experiments as well as the use of pharmacological molecules. The effect of UPR on HIV-1 gene expression/replication and virus production was analyzed by Luciferase reporter assays and p24 antigen capture ELISA, respectively, whereas the effect on virion infectivity was analyzed by staining of infected reporter cells. Collectively, this set of methods provides a comprehensive understanding of the Unfolded Protein Response pathways during HIV-1 infection, revealing its intricate dynamics.

<meta charset="utf8"></head><body>저자 스포트라이트: HIV-1 복제 및 감염성에서 풀린 단백질 반응의 역할 탐구

Here, we describe some established methods to determine endoplasmic reticulum (ER) stress and unfolded protein response (UPR) activation, with particular emphasis on HIV-1 infection. This article also describes a set of protocols to investigate the effect of ER stress/UPR on HIV-1 replication and virion infectivity.

HIV-1에 감염된 T 세포에서 소포체 스트레스 및 풀린 단백질 반응을 측정하고 HIV-1 복제에서 그 역할을 분석합니다.

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses ...

측정

요약

더 많은 비디오 탐색

이 비디오의 챕터