This work was supported by awards from the National Institutes of Health, National Heart, Lung and Blood Institute to K.C.V. HL128996, HL113039, and HL116263. This work was also supported by awards from the American Heart Association to K.C.V. CSA2066001, D.L.M POST26630003, and R.M.A. POST25710170.

1. HDL 정제 (~ 5.5 일) <ol><li> 밀도 구배 초 원심 분리 (DGUC, ~ 5 일) <ol><li> 신선한 정맥 혈액에서 분리 된 혈장 9 mL의 100 배 산화 방지제의 90 μL를 추가합니다. </li><li> 단계 1.1.1 (0.0278 g / mL의 KBr을 플라즈마)에서 플라즈마의 9 용액에 0.251 g을 KBr을 추가하여 1.025 g / mL의 1.006 g / ㎖에서 KBr을 가진 플라즈마 밀도를 조정합니다. 모든 소금은 실온에서 용해 및 튜브를 초 원심 분리기 및 모든 거품이 위로 상승하기 위해 전송 될 때까지 플라즈마를 바위. </li><li> 벤드 끝에서 90 ° 1cm로 18 G 바늘의 끝은, 베벨면이 위쪽을 향. 주사기와 18 게이지 바늘을 사용하여, 조심스럽게 플라즈마 (표 1)을 통해 오버레이 솔루션 # 1의 3 mL를 넣습니다. 참고 : 구부러진 바늘이 모든 VLDL / IDL, LDL을 보장하고, HDL 오버레이와 혼합하지 않고 제거됩니다. </li><li> 튜브 및 carefu의 메 니스 커스 위로부터 3mm 공간 -이 떠나는 상단 기포의 대부분을 제거에서야 베드로 SW-40Ti 양동이에 튜브를 배치합니다. </li><li> 균형에 (뚜껑 포함) 각 버킷의 무게를, 정확히 반대 버킷 (버킷 + 모자)와 균형 : # 5, # 3 # 6 # 4, # 2 # 1. 참고 :이 버킷 균형과 항상 일치해야합니다. </li><li> (자료 목록) 초 원심 분리기의 회 전자를 놓습니다. A # 4 중간 브레이크와 4 ° C에서 24 시간 동안 274,400 XG에 원심 분리기. </li><li> 조심스럽게 양동이에서 회 전자에서 양동이와 튜브를 제거합니다. </li><li> 조심스럽게 주사기와 구부러진 바늘을 사용하여 오버레이의 상단 층에서 2 mL를 제거합니다. 이 4 저장 될 수 VLDL / IDL 분획 것 ° C 또는 -80 기음. </li><li> VLDL / IDL의 부분을 제거한 후, 샘플 (플라즈마)의 나머지 7 mL로 수집하고 15 ML 원뿔 튜브에 배치합니다. 오버레이 용액 # 2 (표 1) 9 mL의 샘플 볼륨을 준비한다. </li><li> 1.080 g을 1.025 g / ㎖에서 샘플의 농도를 조정 / KBr을 가진 mL를 사용하여9 mL의 시료 또는 0.0828 g 약 0.746 g을 KBr / 샘플 용액을 KBr. 모든 KBr을 (약 20 분)에 용해시키고 보장 기포가 위로 상승하면서 튜브를 초 원심 분리기에 전송 될 때까지 조심스럽게 샘플을 바위. </li><li> 주사기와 바늘로 조심스럽게 샘플 (표 1)을 통해 오버레이 솔루션 # 3의 3 mL를 넣습니다. 튜브의 상단에 메 니스 커스 (meniscus)에서 3mm 공간 - 2 둡니다. </li><li> 튜브의 상단에 남아있는 거품의 대부분을 제거하고 조심스럽게 SW-40Ti 양동이에 가득 초원 심 분리기 튜브를 배치합니다. </li><li> 균형에 (뚜껑 포함) 각 버킷을 달아 정확히 1.1.5에서와 같이, 반대 버킷 + 모자와 균형. </li><li> 초 원심 분리기의 회 전자를 배치 (재료의 목록 참조). A # 4 중간 브레이크와 4 ° C에서 24 시간 동안 274,400 XG에 원심 분리기. </li><li> 조심스럽게 양동이에서 회 전자에서 양동이와 튜브를 제거합니다. </li><li> 조심스럽게 주사기를 사용하여 오버레이의 상층 (2)로부터 용액을 제거 할NT를 바늘. 이 4 저장 될 수있는 LDL 분획 것 ° C 또는 -80 기음. </li><li> LDL 분획을 제거한 후, 샘플 (플라즈마)의 나머지 대략 7 mL로 수집하고 새로운 15 ML 원뿔 튜브에 배치합니다. 1.080 g / ㎖ 용액 # 4 (표 1)를 9 mL의 최대 샘플 (혈장)의 용적을 가지고. </li><li> 1.30 g에 1.080 g / ㎖에서 샘플의 농도를 조정 / KBr을 샘플의 각 mL를 위해 KBr을을 9 mL의 시료 (플라즈마)에 3.33 g을 KBr을 사용하거나 0.37 g과 용액. 바위 또는 약간의 모든 KBr을 (염)이 용해 될 때까지 샘플을 선동하고 튜브를 초 원심 분리기에 전송합니다. </li><li> 주사기와 바늘로 조심스럽게 샘플 (표 1)을 통해 오버레이 솔루션 # 5의 3 mL를 넣습니다. </li><li> 튜브의 상단에 메 니스 커스 (meniscus)에서 2 3mm 공간을 떠나, 튜브의 상단에 남아있는 거품의 대부분을 제거하고 조심스럽게 SW-40Ti 양동이에 가득 초원 심 분리기 튜브를 배치합니다. </li><li> (각 버킷 무게상기 균형에 모자), 정확히으로 1.1.5에서와 같이, 반대 버킷 + 모자와 균형. </li><li> 초 원심 분리기의 회 전자를 배치 (재료의 목록 참조). A # 4 브레이크와 4 ° C에서 48 시간 동안 274,400 XG에 원심 분리기. </li><li> 조심스럽게 양동이에서 회 전자에서 양동이와 튜브를 제거합니다. </li><li> 조심스럽게 주사기와 구부러진 바늘을 사용하여 오버레이의 상위 계층에서 약 2 mL로 제거합니다. 이것은 4 ℃ 또는 -80 ℃에서 저장 될 수있는 HDL 분획이다. 참고 : DGUC HDL 다음은 높은 염 용액을 제거하기 위해 투석 할 수있다. </li><li> 밀폐 된 투석 슬리브 (10,000 MW 컷오프)에 수집 된 HDL의 비율을 배치하고 1 L 1X PBS에서 하룻밤 투석, 투석합니다. 변경 투석 버퍼 (1X PBS) 24 시간 이상 3 회. 자기 교반 바와 PBS의 부드러운 교란은 투석이 향상됩니다. </li><li> BCA 방법을 사용하여 8-HDL DGUC의 단백질 농도를 결정한다. </li></ol></li><li> 고속 단백질 액체 색도그래피 (FPLC) 또는 크기 배제 크로마토 그래피 (~ 6 시간) <ol><li> 0.22 μm의 마이크로 원심 필터를 통해 500 μL에 DGUC-HDL (총 단백질)의 1.2 mg의 필터 주입 직전에, (재료의 목록 참조). 주 : 0.22 μm의 필터 이전에 0.45 ㎛의 마이크로 필터를 통해 원심 DGUC-HDL 샘플의 추가 필터링 일부 샘플에 요구 될 수있다. </li><li> 필터링 된 DGUC-HDL 샘플을 수집 FPLC (채우기) 주입 주사기를로드하고 주사기에 기포가 FPLC에 주입하기 전에이 없는지 확인. </li><li> 2.6 MPa의 압력에 제한이 0.3 mL / 분으로 FPLC 유량을 설정한다. 주입 전에 샘플 버퍼 0.2 컬럼 부피 (약 15 mL)로 열 평형. FPLC (주입 루프) 악기에 버퍼의 3 mL의 시료를 주입하고 실행을 시작합니다. 72 분획 총 1.5ml의 분획을 수집한다. </li></ol></li></ol> 2. 높은 처리량 작은 RNA시퀀싱 (sRNAseq ~ 구일) <ol><li> RNA 분리 (~ 1 일) <ol><li> 제조자의 지시에 따라서 비색 키트를 사용하여 총 콜레스테롤 수준을 결정함으로써 DGUC-HDL FPLC에 대응하는 분획을 확인한다. DGUC-HDL을 함유하는 분획 7 FPLC -이 FPLC 셋업을 사용하여, 6 찾으려. </li><li> DGUC-HDL FPLC 분획의 모든 볼륨 (약 8 -1 0 mL를 풀 1.45 ML의 부분의 볼륨)를 수집하고 사용하여 집중 10 kDa의 분자량 컷 - 오프 원심 필터 유닛 1 시간 동안 4,000 XG에 4 ° C에서 또는 HDL 농축까지 약 100 μL입니다. </li><li> HDL을 모아서 농축하고 BCA 방법을 사용하여 8 HDL 총 단백질 농도를 정량화. </li><li> 세트의 각 샘플에서 분주 할 수 있습니다 최대 1 mg의 HDL 총 단백질의 높은 농도를 결정합니다. 예를 들어, 각 샘플의 전체 단백질 HDL 동일한 양으로부터 RNA를 분리. </li><li> 사용 RNA 분리를 수행수정 된 프로토콜 (자료 목록 참조). <ol><li> 1 분 동안 페놀 용해 시약 (재료의 목록 참조) 시료와 소용돌이의 10 배 볼륨을 추가합니다. </li><li> 실온에서 5 분간 인큐베이션. </li><li> 클로로포름 (단계 2.1.5.1에서 사용되는 페놀 용해 시약 용적의 20 %)를 첨가하고, 15 초 동안 격렬하게 진탕. </li><li> 3 분 - 2 실온에서 품어. </li><li> 냉장 원심 분리기에서 4 ° C에서 12,000 XG에 15 분 동안 원심 분리기. </li><li> 상간 피하는 새로운 튜브 상부 수성 상을 전송. </li><li> 1 분 동안 수성 상 및 와류에 100 % 에탄올 1.5 부피를 추가한다. </li><li> 적어도 1 시간 또는 하룻밤 -80 ° C에서 보관 샘플. </li><li> 제공된 미니 열을 사용하여 RNA 분리 프로토콜을 계속합니다. </li><li> 30 μL의 RNase없는 H 2 O로 용출 처음 2 분 동안 저속 (2,000 XG)에서 프릿, 스핀에 직접 15 μL H 2 O의 추가다음 1 분 동안 고속 (최대)에 스핀. H 2 O의 추가 15 μL로이 단계를 반복합니다 </li></ol></li><li> 즉시 -80 ° C에서 스르나 라이브러리 생성 또는 저장소에 진행합니다. </li></ol></li><li> 라이브러리 생성 (~ 6의 시간) <ol><li> 아래에 설명 된대로 PCR 증폭 한 수정으로 제조업체의 지침에 따라 같이 스르나 라이브러리 생성 키트 프로토콜을 사용하여 스르나의 cDNA 라이브러리를 준비합니다. <ol><li> 0.5 μL DNase의 /의 RNase없는 H 2 O를 포함하는 얼음에 PCR의 mastermix을 준비, 15 μL PCR 믹스 (PML) 1 μL RNA PCR 프라이머 (RP1) 샘플 당 (오류를 피펫 팅을위한 추가 10 % 포함). </li><li> PCR을 16.5 μL 각 (cDNA를) 시료에 혼합 추가합니다. </li><li> 다중 각 시료에 인덱스 / 바코드 번호를 할당하고 샘플 (해당 번호에) 1 μL PCR 프라이머 색인을 추가합니다. </li><li> 의 microfuge를 사용하여 빠른 스핀을 수행합니다. 참고 : 전체 볼륨해야지금 샘플 당 30 μL합니다. </li><li> 표 2 및 3에 설명 된 바와 같이 PCR 증폭 용 사이클링 조건을 수행한다. </li></ol></li></ol></li><li> 크기 스르나 도서관 어댑터 제거 선택 : 어댑터 (~ 1.5 시간) <ol><li> 대상 : 다음 크기 매개 변수와 제조업체의 지침에 따라 자동 DNA 크기 선택기를 사용하여 라이브러리 크기 선택을 수행하는 156 bp의 시작 : 135 bp의, 끝 : 177 bp의, 범위 신고 : 브로드. </li></ol></li><li> DNA 정리 (~ 0.5 시간) <ol><li> 정리 크기 선택 제조업체의 지침에 따라 스르나의 cDNA. </li><li> 깨끗한 용출 및 2 × 7 μL DNase의 /의 RNase없는 H 2 O와 스르나의 cDNA 집중 </li></ol></li><li> 정량화 및 평가 스르나의 cDNA 라이브러리 수율 및 품질 (~ 1의 시간) <ol><li> manufact의 당 (자재 목록)을 bioanalyzer에 고감도 DNA 칩을 이용 스르나의 cDNA 라이브러리의 품질과 크기를 평가의 urer의 지시. </li><li> 제조자의 지시에 따라, 고감도 DNA 분석 (자재 목록)를 사용하여 개별 스르나 cDNA 라이브러리 농도를 정량화. 주 : 플로우 셀 가능하면 같은 차선에서 실행되는 다른 지수와의 모든 샘플을 가지고하는 것이 좋습니다. 하나 이상의 레인이 필요한 경우, 적절한 경우 및 제어 샘플을 혼합한다. </li></ol></li><li> 높은 처리량 스르나 시퀀싱 (~ 7 일) <ol><li> 풀 개인은 몰 농도에 따라 스르나 라이브러리를 색인. </li><li> 2.5.2 - 화면 bioanalyzer에 고감도 DNA 칩을 이용하여 2.5.1 에서처럼 라이브러리 DNA 농도를 측정 품질 스르나 라이브러리를 풀링. </li><li> 제조업체의 지침 (자료 목록)에 따라 시퀀싱 라이브러리 qPCR에 정량 키트를 사용하여 적절한 순서 깊이를 보장하기 위해 어댑터 콘텐츠 정량 PCR (qPCR에)을 수행합니다. </li><li> 하나의 읽기를 사용하여 순서를 수행, 50 (B)25 M은 제조업체의 지침에 따라, / 샘플을 읽고 - P 프로토콜은 약 20의 깊이에 도달합니다. </li></ol></li></ol> 3. 데이터 분석 (~ 1 일) <ol><li> 역 다중화 된 시료의 전처리 원시 fastq 파일 (자료 목록)에, 사용 설명서의 지시에 따라, bcl2fastq2를 사용합니다. </li><li> 어댑터 9 트림 및 제거 Cutadapt를 사용하여 &lt;읽고 사용자 설명서 지침 (자료 목록)에 따라 길이 16 뉴클레오티드 (국세청). </li><li> 사용자 설명서 지침 (자료 목록)에 따라, NGSPERL 프레임 워크 removeSequenceInFastq 기능을 사용하여 어댑터 이월 (CTACAGTCCGACGATC) : 스톱 솔루션 시퀀스를 포함하는 스르나 라이브러리에 존재하는 오염 시퀀스 (CCACGTTCCCGTGG STP)를 제거합니다. </li><li> 사용자 설명서 지침 (자료 목록)에 따라, FastQC이 양적 과학 센터 (CQS) 도구를 사용하여 품질 관리 측정을 수행합니다. </li><li> &quot;동일&quot;의 비 중복 목록을 생성 (축소 redunda를 읽고NT를 읽기) 기록 사본 번호는 사용 설명서의 지시 재료 (목록)에 따라, CQSTools를 사용하여. </li><li> 사용자 설명서 지침 (자료 목록)에 따라, (-a -m 100 --best --strata -v 1 옵션) 정렬은 Bowtie1.1.2 1 불일치를 허용하여 인간 게놈에 읽습니다. </li><li> 정렬, 계산을 읽을 수행하고 사용자 설명서의 지시에 따라, NGSPERL를 사용하여 요약 작업을 초래한다. </li><li> 스프레드 시트 파일로 내보낼 수 테이블을 변환합니다. </li><li> 당 매핑의 miRNA (RPMM)를 읽으로 그 클래스 (예,의 miRNAs의 총 수 읽기) 및 보고서 신호 판독의 표준화가 총에 특정 클래스 (예를 들어,의 miRNAs)의 읽습니다. (예를 들면, RPMM = (은 miR-X는 / miRNA의 총 # *이 1,000,000) 읽습니다). </li><li> 낮은 수준과 높은 수준의 차동 소프트웨어로 일반 단일 컬러 기술로 입력 정상화 카운트 테이블은 사용자 설명서 지침 (자료 목록)에 따라 분석한다. 참고 : 현재, 아니 잘 특성화 하우스 키핑 유전자가 / SRNHDL-스르나에 관해서. 스파이크의 제어가 사용될 수 있지만, 문제가 될 수있다. 총 단백질 입력 또는 볼륨을 HDL하는 정규화하는 것이 좋습니다. 가장 중요한 것은 실시간 PCR 또는 정량 PCR을 사용하여의 miRNAs와 sRNAs을 정량화하기 위해 다양한 전략 중 하나에 의해 시퀀싱 결과를 확인하는 것이 좋습니다. </li></ol>

<ol>
	<li>Vickers, K. C., Roteta, L. A., Hucheson-Dilks, H., Han, L., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+diverse+small+RNA+species+in+the+deep+transcriptome.">Mining diverse small RNA species in the deep transcriptome.</a> Trends Biochem Sci. 40, 4-7 (2015).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=+MicroRNAs:+genomics,+biogenesis,+mechanism,+and+function."> MicroRNAs: genomics, biogenesis, mechanism, and function.</a> Cell. 116, 281-297 (2004).</li><li>Haussecker, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+tRNA-derived+small+RNAs+in+the+global+regulation+of+RNA+silencing.">Human tRNA-derived small RNAs in the global regulation of RNA silencing.</a> RNA. 16, 673-695 (2010).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extensive+terminal+and+asymmetric+processing+of+small+RNAs+from+rRNAs,+snoRNAs,+snRNAs,+and+tRNAs.">Extensive terminal and asymmetric processing of small RNAs from rRNAs, snoRNAs, snRNAs, and tRNAs.</a> Nucleic Acids Res. 40, 6787-6799 (2012).</li><li>Martens-Uzunova, E. S., Olvedy, M., Jenster, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+microRNA--novel+RNAs+derived+from+small+non-coding+RNA+and+their+implication+in+cancer.">Beyond microRNA--novel RNAs derived from small non-coding RNA and their implication in cancer.</a> Cancer Lett. 340, 201-211 (2013).</li><li>Maute, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tRNA-derived+microRNA+modulates+proliferation+and+the+DNA+damage+response+and+is+down-regulated+in+B+cell+lymphoma.">tRNA-derived microRNA modulates proliferation and the DNA damage response and is down-regulated in B cell lymphoma.</a> Proc Natl Acad Sci U S A. 110, 1404-1409 (2013).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Anal Biochem. 150, 76-85 (1985).</li><li>Chen, C., Khaleel, S. S., Huang, H., Wu, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Software+for+pre-processing+Illumina+next-generation+sequencing+short+read+sequences.">Software for pre-processing Illumina next-generation sequencing short read sequences.</a> Source Code Biol Med. 9, 8 (2014).</li><li>Vickers, K. C., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid-based+carriers+of+microRNAs+and+intercellular+communication.">Lipid-based carriers of microRNAs and intercellular communication.</a> Curr Opin Lipidol. 23, 91-97 (2012).</li><li>Greening, D. W., Xu, R., Ji, H., Tauro, B. J., Simpson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+exosome+isolation+and+characterization:+evaluation+of+ultracentrifugation,+density-gradient+separation,+and+immunoaffinity+capture+methods.">A protocol for exosome isolation and characterization: evaluation of ultracentrifugation, density-gradient separation, and immunoaffinity capture methods.</a> Methods Mol Biol. 1295, 179-209 (2015).</li><li>Sung, B. H., Ketova, T., Hoshino, D., Zijlstra, A., Weaver, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+cell+movement+through+tissues+is+controlled+by+exosome+secretion.">Directional cell movement through tissues is controlled by exosome secretion.</a> Nat Commun. 6, 7164 (2015).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25, 402-408 (2001).</li><li>Jung, R., Lubcke, C., Wagener, C., Neumaier, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reversal+of+RT-PCR+inhibition+observed+in+heparinized+clinical+specimens.">Reversal of RT-PCR inhibition observed in heparinized clinical specimens.</a> Biotechniques. 23, (1997).</li><li>Johnson, M. L., Navanukraw, C., Grazul-Bilska, A. T., Reynolds, L. P., Redmer, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heparinase+treatment+of+RNA+before+quantitative+real-time+RT-PCR.">Heparinase treatment of RNA before quantitative real-time RT-PCR.</a> Biotechniques. 35, 1140-1142 (2003).</li><li>Garcia, M. E., Blanco, J. L., Caballero, J., Gargallo-Viola, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoagulants+interfere+with+PCR+used+to+diagnose+invasive+aspergillosis.">Anticoagulants interfere with PCR used to diagnose invasive aspergillosis.</a> J Clin Microbiol. 40, 1567-1568 (2002).</li><li>Yokota, M., Tatsumi, N., Nathalang, O., Yamada, T., Tsuda, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+heparin+on+polymerase+chain+reaction+for+blood+white+cells.">Effects of heparin on polymerase chain reaction for blood white cells.</a> J Clin Lab Anal. 13, 133-140 (1999).</li><li>Bai, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predictive+value+of+quantitative+PCR-based+viral+burden+analysis+for+eight+human+herpesviruses+in+pediatric+solid+organ+transplant+patients.">Predictive value of quantitative PCR-based viral burden analysis for eight human herpesviruses in pediatric solid organ transplant patients.</a> J Mol Diagn. 2, 191-201 (2000).</li><li>McShine, R. L., Sibinga, S., Brozovic, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differences+between+the+effects+of+EDTA+and+citrate+anticoagulants+on+platelet+count+and+mean+platelet+volume.">Differences between the effects of EDTA and citrate anticoagulants on platelet count and mean platelet volume.</a> Clin Lab Haematol. 12, 277-285 (1990).</li><li>Fichtlscherer, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+in+patients+with+coronary+artery+disease.">Circulating microRNAs in patients with coronary artery disease.</a> Circ Res. 107, 677-684 (2010).</li><li>Pritchard, C. C., Cheng, H. H., Tewari, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling:+approaches+and+considerations.">MicroRNA profiling: approaches and considerations.</a> Nat Rev Genet. 13, 358-369 (2012).</li><li>Kirschner, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haemolysis+during+sample+preparation+alters+microRNA+content+of+plasma.">Haemolysis during sample preparation alters microRNA content of plasma.</a> PLoS One. 6, e24145 (2011).</li><li>Kannan, M., Atreya, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+profiling+of+human+red+blood+cells+during+storage+for+52+selected+microRNAs.">Differential profiling of human red blood cells during storage for 52 selected microRNAs.</a> Transfusion. 50, 1581-1588 (2010).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS One. 3, e2360 (2008).</li><li>Balzano, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miRNA+Stability+in+Frozen+Plasma+Samples.">miRNA Stability in Frozen Plasma Samples.</a> Molecules. 20, 19030-19040 (2015).</li><li>Redgrave, T. G., Roberts, D. C., West, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+plasma+lipoproteins+by+density-gradient+ultracentrifugation.">Separation of plasma lipoproteins by density-gradient ultracentrifugation.</a> Anal Biochem. 65, 42-49 (1975).</li><li>Cheung, M. C., Wolf, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effect+of+ultracentrifugation+on+apolipoprotein+A-I-containing+lipoprotein+subpopulations.">Differential effect of ultracentrifugation on apolipoprotein A-I-containing lipoprotein subpopulations.</a> J Lipid Res. 29, 15-25 (1988).</li><li>Kunitake, S. T., Kane, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+integrity+of+high+density+lipoproteins+in+the+ultracentrifuge.">Factors affecting the integrity of high density lipoproteins in the ultracentrifuge.</a> J Lipid Res. 23, 936-940 (1982).</li><li>Laurent, L. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meeting+report:+discussions+and+preliminary+findings+on+extracellular+RNA+measurement+methods+from+laboratories+in+the+NIH+Extracellular+RNA+Communication+Consortium.">Meeting report: discussions and preliminary findings on extracellular RNA measurement methods from laboratories in the NIH Extracellular RNA Communication Consortium.</a> J Extracell Vesicles. 4, 26533 (2015).</li></ol>

The authors have nothing to disclose.

이 프로토콜은 고순도의 HDL에 높은 처리량 시퀀싱 또는 실시간 PCR에 의해 miRNA가 다른 sRNAs을 정량화하기 위해 설계되었습니다. 어떠한 접근 방식으로, 특별한 고려가 정화 HDL 및 RNA의 처리의 각 단계에 부여하고 sRNAs 정량화한다. 이 프로토콜은 플라즈마의 ≥ 2 mL로 시작하는 프로젝트를 위해 설계되었습니다. 그러나 고품질의 RNA 분석을 성공적으로 친 화성 크로마토 그래피를 이용하여 인간 또는 마우스 혈장 적은 80 μL로부터 정제 HDL 완료 될 수있다 그러나, 큰 시동 플라즈마 볼륨은 여기에 제시된 방법을 이용하여 더 나은 데이터를 생성한다. 샘플 처리 및 추출 방법은 크게 miRNA의 / 스르나의 품질과 수율을 변경할 수 있습니다. 항응고제의 사용은 플라즈마 컬렉션에 필수적인 반면, 하류 추출 가능성에 영향을 미친다. 예를 들어, 헤파린 용이 RNA 추출 14,15 동안 제거되지 않으며, PCR 16-18 이용 하류 효소를 억제 할 수있다. 또한, 제감수 시트르산 나트륨 EDTA가 또한 샘플들로부터의 miRNAs는 시트르산 나트륨 16,19,20 샘플에 비해 발현 프로파일을 개선하기 위해 도시 qPCR의 측정을 방해 할 수 있다는보고가있다. 항응고제를 선택할 때 이들 연구 신중한 검토에 대한 필요성을 보여준다. 또한, 응고 동안 세포 용해에 대한 증가 가능성으로 인해, 혈청 샘플을 인위적으로 지질 단백질과 연결할 수있다 용해 세포의 miRNAs으로 권장되지 않습니다. 마찬가지로, 플라즈마는 이상적으로 용해 백혈구를 포함한 다른 말초 혈액 세포에서 오염을 방지하기 위해 전체 혈액에서 즉시 격리됩니다. 저온 널리 혈소판 활성화에 영향을 미치는 것으로 알려져있는 바와 같이, 전체 혈액 샘플을 실온에서 15 분 동안 3,000 XG에 적혈구, 백혈구 및 혈소판 떨어져 버리고있다. 파열 된 적혈구는 또한 miRNA의 결과 (21, 22)에 영향을 미칠 것으로보고 된대로이 hemol 동안 흘릴 수의 miRNAs을 포함하기 때문에 용혈도 병, 좋습니다이 Analysis 23, 24. 플라즈마는이 4 ℃에서 저장 될 수있다 - 4 주 또는 대안 플라즈마 miRNA의 함량이 단기 및 장기 저장 (최대 4 년) (25) 모두에서 안정하고 실용적이다 -80 ℃에서 냉동 될 수있다. 우리의 현재의 지식으로, 혈장 샘플을 동결하는 것은 HDL-의 miRNAs 및 냉동 혈장 샘플을 분석하기에 적합 해를 끼칠 것으로 예상되지 않습니다. 지단백질 다른 전혈 성분 음식 섭취에 의해 영향을받을 수있는 바와 같이, 공복 채혈이 바람직하다. 전술 한 바와 같이, 혈장 HDL은 DGUC, FPLC 및 apoA-I에 대한 친 화성 크로마토 그래피를 비롯한 표준 방법의 숫자를 통해 분리 될 수있다. . Redgraves 기재된 바와 같이을 KBr을 사용 DGUC 의해 혈장 지질 단백질의 분리는, 등 (26), VLDL 분리 (d = 0.94-1.006 g / ㎖), LDL (d = 1.006-1.063 g / mL) 및 HDL (d = 1.063-1.21 샘플 당 60 ㎖) - g / ㎖) 및 플라즈마 (2 많은 양의 이상적인 방법이다. 제한단독으로이 방법을 사용하여 엑소 좀과 전기 자동차를 포함한 기타의 miRNA는 HDL 유사한 밀도가보고되어 DGUC HDL (도 2a)에 존재할 수 있다는 것이다. 다른 단점이 가능한 구조 버퍼와 강한 초 원심 힘 높은 소금 노출 단백질의 손상뿐만 아니라 HDL 서브 클래스 27, 28의 차동 안정성을 포함한다. 이 플라즈마 (29) 1 ㎖ 당 HDL 단백질의 가까이에 1 mg의 생산, HDL 단백질의 높은 수율 결과로 그럼에도 불구하고, DGUC 일반적으로 사용됩니다. 사이즈 배제 겔 여과법을 포함 FPLC 접근법은 유량 (약 6 시간)에 따라 더 적은 시간이 필요하고, 전기차 포함 이상 (크기)으로 ApoB - 함유 지단백질의 HDL의 분리 정밀도와 그 서브 클래스를 갖는다 HDL보다 훨씬 더 큰하지만 비슷한 밀도를 가질 수. 직경 75 나노 미터하지 않습니다 - 약 220 사이에이 프로토콜에 설명 된 방법, 플라즈마 소포를 사용하여 주목해야한다FPLC로 분리 할 때 검출 지질이나 단백질 서명을 유도. 셋업에 따라, FPLC가 상대적으로 작은 입력을 필요로 0.3 - 쥐 플라즈마와 작은 냉동 분취 액에 유용 1 mL를. 빠른 비색 분석은 콜레스테롤 또는 다른 HDL 지단백질 분획의 분포를 확인하기 위해 다음과 같은 FPLC 중요하다. 분류는 샘플 및 지질 단백질을 희석; 그러나, 샘플을 원심 후, 표준 크기의 필터를 사용하여 농축 될 수있다 (예를 들면은 10 kDa 이상은 컷오프 필터 MW). 마이크로 스핀 컬럼을 사용하여 apoA-I IP에 의해 HDL 분리는 세 가지 방법의 빠른하지만, 낮은 입력에 의해 제한된다 (0.08-1 μL) 볼륨과 낮은 수율 (약 0.1 mg)을 얻었다. apoA-I IP가 힘드는 일 수 있지만,이 방법은 낮은 볼륨 세포 배양 상층 액에 적합합니다. 이들 방법들의 각각은 장단점이 있지만 직렬로 사용하는 경우,이 감소 될 수있다 (예 DGUC는 FPLC를 따랐다). 더 큰 순도 두 직렬의 접근 방법, 결과를 사용하여miRNA의 및 스르나 분석을위한 HDL. 여기서는 FPLC 다음 DGUC의 연동 방법을 이용하여 고순도의 HDL을 분리하는 데 필요한 단계를 상세하고 높은 처리량 시퀀싱 또는 실시간 PCR을 사용하여 HDL-의 miRNAs와 sRNAs를 정량화하기 위해 사용되는 단계를 설명했다. 이 프로토콜은 HDL을 위해 설계되었지만, 그것은 그들의 밀도와 크기에 따라 LDL과 VLDL을 포함한 다른 지질 단백질에 sRNAs을 정량화 큰 적용 가능성을 가지고있다.

세포 외 비 코딩 작은 RNA를 (sRNAs)는 질병 바이오 마커 및 잠재적 인 치료 대상의 새로운 클래스를 나타낼 가능성 세포 간 통신 (1)를 용이하게한다. 스르나의 가장 널리 연구 유형은 대략 길이가 22 국세청하며 더 이상 전구체 형태 및 기본 증명서 2에서 처리되는 마이크로 RNA (miRNA의)입니다. 전사적의 miRNAs는 단백질 - 전기 변환 및 mRNA의 분해 (2)의 유도의 억제를 통해 유전자 발현을 조절하는 것으로 입증되었다. 그럼에도 불구하고,의 miRNAs는 sRNAs 많은 종류의 하나입니다; sRNAs가 부모의 tRNA (tRNA의 유래 sRNAs, TDR), 작은 핵 RNA를 (스르나 유래 sRNAs, sndRNA), 작은 핵소체의 RNA (snoRNA 파생 sRNAs, snRNA), 리보솜 RNA를에서 절단 될 수있는 (sRNAs, RDR을 rRNA의 유래 ) RNA를 Y (yDR) 및 기타 다른 RNA를 1. 이 소설 sRNAs의 몇 가지 예는 miRNA가 유사한 기능을하는 것으로보고되었다; 그러나, 생물학적 쿵푸유전자 조절의 역할 3-6 가능성이 있지만 이러한 sRNAs의 많은 nctions가 결정되어야 남아있다. 가장 흥미로운의 miRNAs 및 기타 sRNAs는 타액, 혈장, 소변, 담즙를 포함하는 세포 외 체액에서 안정적으로 존재한다. 세포 외 sRNAs 가능성이 세포 외 소포 (EV), 지질 단백질, 및 / 또는 세포 외 리보 핵산 단백질 복합체와의 연결을 통해 RNases로부터 보호됩니다. 이전에, 우리는 지질 단백질, 즉 고밀도 지단백질 (HDL), 플라즈마 7 전송의 miRNAs을보고했다. 본 연구에서는 HDL은 순차적 밀도 구배 초 원심 분리 방법 (DGUC), 고속 단백질 액체 크로마토 그래피 (크기 배제 크로마토 그래피 겔 여과, FPLC), 및 친 화성 크로마토 그래피 (안티 - 아포 지단백 AI (apoA-I) 면역를 사용하여 분리 하였다 ) 7. 실시간 PCR 기반 저밀도 어레이 개별 miRNA의 분석 모두 사용하여 miRNA의 레벨은 HDL을 정량 치료에서 분리 된네와 콜레스테롤 혈증 환자 7. 이 방법을 사용하여, 우리는의 miRNAs 프로필 및 고순도 HDL 준비의 특정의 miRNAs를 정량화 할 수 있었다. 2011 년부터, 우리는 친 화성 크로마토 그래피는 HDL의 순도를 향상 있지만, 항체 포화 크게 수율을 제한하고 엄청난 비용이 될 수 있다고 판단했다. 현재, 우리의 프로토콜은 다운 스트림 RNA 분리 및 스르나의 정량화를위한 ​​고품질의 HDL 샘플을 생산 FPLC, 다음 DGUC의 2 단계 연속 탠덤 방법을 권장합니다. 때문에 높은 처리량 예를 들어 sRNAs (sRNAseq),의 miRNAs의 순서 및 기타 비 miRNA의 스르나 클래스의 증가에 대한 인식의 최근 진보, sRNAseq는 현재 최첨단의 miRNA 및 스르나 프로파일입니다. 따라서, 우리의 프로토콜은 정량화의 miRNAs와 sRNAseq를 사용하여 HDL 샘플의 다른 sRNAs을 권장합니다. 그럼에도 불구하고, HDL로부터 분리 된 총 RNA는 또한 개별의 miRNAs 다른 sRNAs 정량화 또는 실시간 PCR A를 사용 sRNAseq 결과를 검증하기 위해 사용될 수있다pproaches. 여기에 우리가 수집, 정제, 정량, 데이터 분석 및 고순도 HDL-sRNAs의 검증을 위해 상세 프로토콜을 설명합니다. 이 논문의 전반적인 목표는 인간 혈장에서 분리 된 고순도의 HDL에 스르나 정량의 타당성과 과정을 설명하는 것입니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:1033px;" width="1033">
	<tbody>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultracentrifuge&#160;</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">A99839</td>
			<td style="width:307px;">Optima XPN-80</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultracentrifuge Rotor</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">331362</td>
			<td>SW-41Ti</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">AKTA Pure FPLC System</td>
			<td style="width:207px;">GE Healthcare</td>
			<td style="width:205px;">29018224</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">3X FPLC Superdex 200 Increase Columns In-line</td>
			<td style="width:207px;">GE Healthcare</td>
			<td style="width:205px;">28990944</td>
			<td>10/300 gl</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">SynergyMx</td>
			<td style="width:207px;">BioTek Instruments</td>
			<td style="width:205px;">7191000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Tabletop centrifuge</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">75004525</td>
			<td>Sorvall ST40R</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Refrigerated centrifuge</td>
			<td style="width:207px;">Eppendorf</td>
			<td style="width:205px;">22629867</td>
			<td>5417R (purchased through USA Scientific)</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Microfuge&#160;</td>
			<td style="width:207px;">USA Scientific</td>
			<td style="width:205px;">2631-0006</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PippenPrep</td>
			<td style="width:207px;">Sage Science</td>
			<td style="width:205px;">PIP0001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">2100 Bioanalyzer&#160;</td>
			<td style="width:207px;">Agilent</td>
			<td>G2938B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">High Sensitivity DNA Assay</td>
			<td style="width:207px;">Agilent</td>
			<td>5067-4626</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Sequencing Library qPCR Quantification Kit</td>
			<td style="width:207px;">Illumina</td>
			<td>SY-930-1010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">ProFlex Thermal Cycler</td>
			<td style="width:207px;">Applied Biosystems</td>
			<td style="width:205px;">4484073</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">QuantStudio 12k Flex</td>
			<td style="width:207px;">Applied Biosystems</td>
			<td style="width:205px;">4471134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">EpMotion Robot</td>
			<td style="width:207px;">Eppendorf</td>
			<td style="width:205px;">960000111</td>
			<td>5070</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultra-clear centrifuge tubes</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">344059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Potassium Bromide</td>
			<td style="width:207px;">Fisher Chemicals</td>
			<td style="width:205px;">P205-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">15 mL conical tube</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">339650</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Micro-centrifugal filters 0.45&#181;m</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:205px;">UFC30HV00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Micro-centrifugal filters 0.22&#181;m</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:205px;">UFC30GV00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">miRNAEasy Total RNA Isolation Kits</td>
			<td style="width:207px;">Qiagen</td>
			<td style="width:205px;">217004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Total Cholesterol colormetric kit</td>
			<td style="width:207px;">Cliniqa (Raichem)</td>
			<td style="width:205px;">R80035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">10,000 m.w. cut-off centrifugation filter</td>
			<td style="width:207px;">Amicon</td>
			<td style="width:205px;">UFC801024</td>
			<td>purchased through Millipore</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PCR strip tubes</td>
			<td style="width:207px;">Axygen</td>
			<td style="width:205px;">PCR-0208-C</td>
			<td>purchased through Fisher</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">microRNA RT kit</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:205px;">4366597</td>
			<td>For 1000 reactions</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PCR master mix</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:205px;">4440041</td>
			<td>50 mL bottle</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Pierce BCA kit</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">23225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Clean and Concentrator Kit</td>
			<td style="width:207px;">Zymo</td>
			<td style="width:205px;">D4014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Dialysis tubing</td>
			<td style="width:207px;">Spectrum Labs</td>
			<td style="width:205px;">132118</td>
			<td>purchased through Fisher</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">bcl2fastq2</td>
			<td style="width:207px;">Illumina</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Cutadapt</td>
			<td>https://github.com/marcelm/cutadapt</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">NGSPERL</td>
			<td>github.com/shengqh/ngsperl</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">CQSTools</td>
			<td>github.com/shengqh/CQS.Tools</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Bowtie 1.1.2&#160;</td>
			<td>http://bowtie-bio.sourceforge.net</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">GeneSpringGX13.1.1</td>
			<td style="width:207px;">Agilent</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
	</tbody>
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
</table>

isolation of high-density lipoproteins for non-coding small rna quantification

작은 비 코딩 RNA를의 다양성 (스르나)는 급속하게 확장되고 유전자 조절을 포함한 생물학적 과정에서 자신의 역할이 부상하고있다. 가장 흥미로운 sRNAs은 세포의 외부 발견하고 안정적으로 모든 생물학적 체액에 존재한다. 따라서, 세포 외 sRNAs 질병 바이오 마커의 새로운 클래스를 나타낼 가능성 세포 신호 및 세포 간 통신 네트워크에 참여하고 있습니다. 바이오 마커로서의 가능성을 평가하기 위해, sRNAs 플라즈마, 소변 및 기타 유체에 정량화 할 수있다. 그럼에도 불구하고, 충분히 내분비 신호로서 세포 sRNAs의 영향을 이해하기 위해서는, 캐리어 수송성 및 세포 및 조직은 세포 외 스르나 풀 기여 생물학적 유체 (예, 플라즈마)에 이들을 보호하고, 세포 수있는 조직 된 결정하는 것이 중요 수용성의 세포 외 스르나를 이용. 이러한 목표를 달성하기 위해, 세포 외 캐리어 고순도의 집단을 분리하는 것이 중요스르나의 프로파일 링 및 정량. 우리는 이전에 지질 단백질, 특히 고밀도 지단백질 (HDL)을, 셀 및 HDL-의 miRNAs 사이의 기능적인 마이크로 RNA (miRNA의) 크게 질병에 변경되는 수송 있음을 증명하고있다. 여기서는 상세히 밀도 구배 초 원심 분리 (DGUC)과 고속 단백질 액체 크로마토 그래피 (FPLC)를 탠덤 HDL 분리를 이용하는 새로운 프로토콜 높은 모두 사용 하류 프로파일과의 miRNAs 포함한 모든 sRNAs의 정량 고순도 HDL을 얻었다 -throughput 시퀀싱 및 실시간 PCR 접근법. 이 프로토콜은 HDL에 sRNAs의 조사를 위해 귀중한 자원이 될 것입니다.

이 프로토콜은 높은 처리량 시퀀싱 또는 실시간 PCR (도 1)에 의해 고순도 HDL에 sRNAs의 정량화를 허용하도록 서로 연결 설정 방법의 연속이다. 가능성이 프로토콜의 영향을 설명하기 위해, HDL은 탠덤 DGUC 및 FPLC 방법으로 인간 혈장에서 정제 하였다. HDL로 (콜레스테롤 분포) 대응 수집 FPLC 분획을 농축하고, 총 RNA는 HDL (총 단백질) 1 mg 내지 분리 하였다. 스르나 라이브러리는 N = 4 건강한 사람을 대상으로 수집 HDL 생성되었다. 모든 인간의 혈액 / 혈장 샘플을 활성 임상 시험 심사위원회 프로토콜 (# 070416)에 따라 수집, 의학의 밴더빌트 대학이 승인 한 사람을 대상으로는 동의에 등록되었다. 준비 스르나 라이브러리는 고급 유전체학 (VANTAGE) DNA 시퀀싱 센터와 데이터 분석을 수행 하였다에 대한 밴더빌트 기술에 순서가되었다내부 파이프 라인을 사용. 데이터 시각화는 소프트웨어를 그래프로 만들어졌습니다. DGUC 후 HDL 분리하기위한 두 번째 방법 (FPLC)를 수행하기위한 중요한 요구 전기차 가능 공동 정제 때문이다. 전기 자동차는 세포 사멸 체 (10)를 포함 multivesicular 기관 (엑소 좀)에서 시작 막 유래 소포, 세포막은 (마이크로 소포를) 신진 및 기타 프로세스의 일반화 된 클래스입니다. 전기차, 즉 엑소 좀이 작아 HDL (도 2A)과 동일한 밀도가보고되어 있고, 따라서, HDL 농도 분획에 존재할 수 - DGUC 11,12 후에 (1.063 1.21 g / ㎖). 전기 자동차 및 기타 지질 단백질 (예, LDL)을 제거하려면 DGUC-HDL에서, FPLC는 크기별로 다른 소포와 입자를 분리 HDL에 사용되었다; HDL (7-12 직경이 나노 미터) 및 전기 자동차 (40 - 직경 220 나노 미터)는 쉽게 그들의 크기 차이 (그림 2A, B)로 분획된다. HDL 비율S 의한 콜레스테롤의 분포 명백이었고, DGUC-HDL FPLC 분획을 모으고, 10 kDa의 컷오프 필터를 원심 분리하여 농축시켰다. 농축 HDL 수집 하류 RNA 분석 (도 2B)을 사용 하였다. 이 점을 설명하기 위해 플라즈마 사전 DGUC는 FPLC 및 인지질의 분포 (포스파티딜콜린, PC)를 사용하여 분획 하였다; 총 콜레스테롤 (TC) 및 단백질 수준의 정량화에 걸쳐 분획 플롯 하였다. PC, TC, 단백질 수준은 세 가지 색채 키트를 사용하여 정량 하였다. 및 VLDL / LDL 분획 (14-18) - 세 가지 매개 변수를 명확하게 HDL 분획 (24 19) 정의. FPLC-분획 플라즈마에서 단백질과 지질 신호가 최소 검출되었다 여부 (오렌지 박스 왼쪽) VLDL (그림 3A)보다 큰 크기의 소포에 해당하는 분수 전혀 감지했습니다. HDL의 DGUC 분리를 설명하기 위해, DGUC-HDL은 FPLC와 PC, TC에 의해 분획 및 단백질 수준은 quantif했다되었다IED (그림 3B). 이 값을 플롯하면 DGUC를 사용 LDL 소량의 공동 분류를 도시하고 고순도 HDL을 분리 탠덤 DGUC-FPLC 방식을 사용할 필요가 강화. 전기 자동차가 DGUC 동안 HDL과 협력 분별 것으로 예상되지만, LDL (그림 3B)보다 큰 크기를 소포에 해당하는 분수의 지질과 단백질에서 발견 없음 거의 있었다. FPLC 분획물 때 예상 크기의 범위에서 EV 지질 단백질 서명은 또한 최소 검출 또는 DGUC-VLDL 및 LDL-DGUC 결석 (데이터는 보이지 않음). RNA 분석을 위해, 총 RNA는 스르나 라이브러리 생성을 위해 직렬로 정제 HDL 1 mg 내지 분리 하였다. 간략하게, 어댑터는 3 &#39;다음 (5&#39;)의 miRNAs와 tDRs (도 4a)를 포함 sRNAs의 말단에 라이 게이션 하였다. 결찰 제품은 역 (RT) 전사하고, PCR은 다우 동안 다중 샘플 용으로 설계된 특정 인덱스를 품고 PCR 프라이머를 사용하여 증폭nstream 염기 서열 반응 (그림 4A). 각 어댑터의 길이는 61 국세청이다 따라서, 결찰 된 miRNA (길이 약 22 NTS)는 길이 (144) NTS의 제품을 생산한다. 많은 비 miRNA의 sRNAs 약간 이상의 miRNAs보다 (예를 들어, 30 - 길이 35 국세청). 따라서, 제품의 우리의 목표 길이의 길이는 156 bps로했다. 길이 177 bps로 수집 하였다 (도 4a) - 증폭 산물의 크기는 선택된 자동 DNA 크기 선택기 (135)는 모든 cDNA의 제품을 사용 하였다. 크기 선택된 라이브러리 자질 bioanalyzer (도 4b)을 이용하여 고감도 DNA 칩에 의해 평가 하였다. 이 크기의 스르나의 cDNA 라이브러리는 분석 기간 동안 효과를 &quot;버블 링&quot;수에 따른 크기가 약간 큰 나타났다. 다중화 시퀀싱, cDNA의 라이브러리 등몰 농도 풀링 세정, 농축하고 bioanalyzer (도 4b)을 이용하여 다시 분석 하였다. 다중화 된 샘플을 sequen했다단일 읽기 50 bp의 프로토콜을 사용 세드릭. (in-house) 데이터 분석 파이프 라인 인덱스에 기초하여 샘플을 역 다중화하는데 사용되었으며, 어댑터 트림 실행 품질 관리 매트릭스는 인간 게놈에 맞추고 주석 sRNAs 계산. 길이 22 국세청, 34 - - HDL (그림 4C)에 길이 35 국세청 정규화의 분포는 sRNAs (20)의 농축을 설명, 읽기 길이&gt; (16) 국세청 (당 만, RPM을 읽습니다). 정렬 4 개의 HDL-스르나 도서관의 계수 분석의 38 %가 인간 게놈 있었다의 miRNAs (그림 5A)의 주석 영역에 정렬 읽기 것을 발견했다. (37 %) 마찬가지로 풍부한 sRNAs 파생 된 tRNA (tDRs)에서 있었다. sRNAs 유래 기타 RNA를 (예를 들어, Y RNA를) rRNAs, smRNAs, snoRNAs, 긴 비 코딩 RNA를 (lincRNAs)에서는 HDL (그림 5A)에도 참석했다. 총 수로 정규화 후에, 각 클래스에 대한 상위 50 가장 풍부한은 miR를 읽고의 NA가 tDRs (당 miRNA의, RPMM,도 5b를 매핑 읽습니다) (당은 tDRs, RPMT,도 5c를 매핑 읽습니다), 및 기타 비 miRNA의 비 TDR sRNAs는 히트 맵에 의해 조직되었다 (당이 스르나, RPMS, 그림 5D를 매핑 읽습니다) . 이러한 데이터는 건강한 피험자 (그림 5B-D)에서 가장 풍부한 HDL-sRNAs의 (예를 들어, HDL-의 miRNAs)와 차이 (예를 들어, tDRs)의 유사성을 설명한다. 이러한 결과는 HDL에 의해 sRNAs의 전송에 현저한 통찰력을 제공하는 이러한 전략 및 프로토콜의 능력을 입증한다. 그럼에도 불구하고, 스르나 순서는 절대 정량에 대한 의존해서는 안됩니다. 관심 sRNAs 실시간 PCR에 의해 검증되어야한다. 마찬가지로, 많은 연구자는 HDL에 개인의 miRNAs의 정량화가 필요할 수 있습니다. 이와 같이, 총 HDL RNA 실시간 PCR을 이용하여 HDL-miRNAs의 상대적인 정량 각 개체로부터 단리 하였다. sRNAseq에 의해 HDL 감지 더 풍부한의 miRNAs의 다섯 것이란 위해 사용되었다1- 시간 PCR 분석은 각 HDL 샘플 (그림 5E)에서 자신의 수준을 결정합니다. RNA를 분리 (13)에 HDL 단백질 입력 1,000 μg의로 - (ΔCtArb RQV = 2) 정규화 상대적인 정량 값은 임의 정돈 32 CT를 사용하여 계산 하였다. 실시간 PCR 연구 결과는이 프로토콜은 또한 HDL-miRNAs의 검출 및 개인 걸쳐 차이를 정량화에 유용한 것으로 증명한다. 집합 적으로 제시 회로도 방법의 중요 내용을 정의하고, 높은 처리량 시퀀싱 및 실시간 PCR 두 접근법의 결과는이 프로토콜의 결과물을 나타낸다. <img alt="그림 1" src="/files/ftp_upload/54488/54488fig1.jpg" /> 의정서의 1. 대표 플로우 차트를 그림. 순수 HDL은 밀도 구배 초 원심 빠른 단백질 액체 chromatog로부터 단리<html> 그래피. 총 HDL RNA는 작은 RNA (스르나) 순서에 이용 될 수있다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54488/54488fig2.jpg" /> HDL 그림 2. 분리. (A) 지질 단백질 및 세포 외 소포 (EV)의 밀도와 직경의 차트입니다. 순차적 인 탠덤 HDL 분리의 (B) 도식, 혈장 분리, 밀도 구배 초 원심 분리 (DGUC), 빠른 단백질을 포함 액체 크로마토 그래피 (FPLC), 여과, 농축. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> PLOAD / 54488 / 54488fig3.jpg &quot;/&gt; . 지방 단백질 EV, 세포 외 소포 그림 3. 고속 단백질 액체 크로마토 그래피 (FPLC) 분리; VLDL 매우 저밀도 지단백질; LDL, 저밀도 지단백질; HDL 고밀도 지단백질; FP, 무료 단백질; PC, 포스파티딜콜린; 및 TC, 총 콜레스테롤. 레드 라인, TC; 블루 라인, 단백질, 블랙 라인, PC. 이전 밀도 구배 초 원심 분리 (DGUC) 및 DGUC 후 (B) HDL 분획에 (A) 인간 혈장에서 지질 단백질의 분리. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/54488/54488fig4.jpg" /> 작은 RNA 라이브러리의 그림 4 세대. 작은 RNA (스르나) 라이브러리 (c)의 (A) 도식onstruction 및 크기 선택. miRNA의, 마이크로 RNA; TDR, sRNAs을의 tRNA는 유래; 스르나 비 miRNA의 비 TDR sRNAs; RT는 전사를 역방향 BP,베이스 쌍 및 cDNA를 클로닝 DNA는. 전과 고감도 DNA 칩을 이용하여 다중화 bioanalyzer 후 HDL-스르나 라이브러리 (B) 분석. HDL-스르나의 (C) 길이 분포 시퀀싱 후 판독한다. RPM은 백만 당 읽습니다; M, 남성 과목; F, 여성 과목; 및 NT, 뉴클레오티드. N = 4. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/54488/54488fig5.jpg" /> HDL-sRNAs 그림 5. 다양성. 스르나 클래스에서 HDL-sRNAs의 (A) 배포. 의 분수는 인간 게놈에 주석 sRNAs에 정렬 읽습니다. (BD) 히트 맵 N은 = 4 HDL-스르나 샘플. <str옹&gt; (B) 50 대 가장 풍부한 HDL-마이크로 RNA (miRNA의). 로그인 2 당 매핑의 miRNA, RPMM. (C) 50 대 가장 풍부한 HDL-tRNA의 유래 sRNAs (tDRs)를 읽습니다. (2) 당은 TDR, RPMT. (D) 50 대 가장 풍부한 HDL-다른 비의 miRNA 및 비 TDR sRNAs (스르나)를 매핑 읽어 로그인합니다. 2 당이 스르나를 매핑 읽어 로그 RPMS. (E) HDL-의 miRNAs의 실시간 PCR 정량. M, 남성 과목; F, 여성 대상. 임의의 가사 코네티컷에 의해 결정 상대 정량 값은 HDL 단백질 입력 (13)의 1,000 μg의 정규화, 32 =. N은 = 4 <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 지단백질 분리 1. 안티 - 산화제 </td><td> 100 배에서 원액을 </td&gt; </tr><tr><td> EDTA </td><td> 에틸렌 디아민 테트라 아세트산 (0.5 M 주) </td></tr><tr><td> AZT </td><td> 3- 아미노 -1,2,4- 트리아 졸 42 ㎎ / ㎖ H 2 O </td></tr><tr><td> BHT </td><td> 디 부틸 히드 록시 톨루엔 : 25 밀리그램 / 100 μL의 EtOH </td></tr><tr><td> 트롤 록스 </td><td> (+) - 6- 히드 록시 - 히드 록시 크로 tetramethylchromane -2- 카르 복실 산 41.7 밀리그램 / 500 μL를 EtOH </td></tr><tr><td> 2. 오버레이 솔루션 </td><td></td></tr><tr><td> 솔루션 # 1 </td><td> 1.019 g / mL의 H 2 O에 </td></tr><tr><td> 솔루션 # 2 </td><td> 1.025 g / ㎖을 KBr은 / H 2 O </td></tr><tr><td> 솔루션 # 3 </td><td> 1.063 g / ㎖을 KBr은 / H 2 O </td></tr><tr><td> 솔루션 # 4 </td><td> 1.080 g / ㎖을 KBr은 / H 2 O </td></tr><tr><td> 솔루션 # 5 </td><td> 1.255 g / ㎖을 KBr은 / H 2 O </td></tr><tr><td> 3. FPLC 버퍼 </td><td></td> &lt;/ TR&gt; <tr><td> 1 L 레시피 </td><td> 50 mL의 3M의 NaCl; 20 ㎖ 0.5 트리스 -HCl, pH가 7.6; 10 % 나트륨 아 지드 2 ㎖; 930 mL의 H 2 O </td></tr></tbody></table> 표 1. 특수 시약. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 단계 </td><td> 온도 (° C) </td><td> 시각 </td><td> 사이클 </td></tr><tr><td> 에이 </td><td> 98 </td><td> 30 초 </td><td> 1 </td></tr><tr><td> 비 </td><td> 98 </td><td> 10 초 </td><td rowspan="3"> (25) </td></tr><tr><td></td><td> (60) </td><td> 30 초 </td></tr><tr><td></td><td> (72) </td><td> 15 초 </td></tr><tr><td> 기음 </td><td> (72) </td><td> 10 분 </td><td> 1 </td></tr></tbody></table> 표 2.라이브러리 생성 증폭 단계. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 뇌관 </td><td> 순서 </td></tr><tr><td> 프라이머 1.1 </td><td> AATGATACGGCGACCACCGAGAT </td></tr><tr><td> 프라이머 2.1 </td><td> CAAGCAGAAGACGGCATACGA </td></tr></tbody></table> 표 3. PCR 프라이머는. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 단계 </td><td> 온도 (° C) </td><td> 시각 </td><td> 사이클 </td></tr><tr><td> 에이 </td><td> (95) </td><td> 10 분 </td><td> 1 </td></tr><tr><td> 비 </td><td> (95) </td><td> 10 초 </td><td rowspan="2"> (40) </td></tr><tr><td></td><td> (60) </td><td&gt; 30 초 </td></tr></tbody></table> 표 4. 라이브러리 정량 증폭 단계.

Watch this Scientific Journal Video about Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification at JoVE.com

Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification

This protocol describes the isolation and quantification of high-density lipoprotein small RNAs.

작은 RNA 정량 비는 코딩을위한 고밀도 지방 단백질의 분리

The diversity of small non-coding RNAs (sRNA) is rapidly expanding and their roles in biological processes, including gene regulation, are emerging. Most ...

isolation-high-density-lipoproteins-for-non-coding-small-rna

Nanyang Technological University

Research

JoVE Journal

Biochemistry

11.2K 조회수.  Vanderbilt University School of Medicine. This protocol describes the isolation and quantification of high-density lipoprotein small RNAs.

비디오: Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

올리고 뉴클레오티드 지시 용출을 사용하여 세포에서 동족 RNA 단백질 단지의 분리

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

연구

생화학

An Efficient Method for the Isolation of Highly Purified RNA from Seeds for Use in Quantitative Transcriptome Analysis

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as industrial materials. Gene expression profiles are powerful tools for investigating metabolic regulation in plant cells. Therefore, detailed, accurate gene expression profiles during seed development are required for crop breeding. Acquiring highly purified RNA is essential for producing these profiles. Efficient methods are needed to isolate highly purified RNA from seeds. Here, we describe a method for isolating RNA from seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method enables highly purified RNA to be obtained from seeds without the use of phenol, chloroform, or additional processes for RNA purification. This method is applicable to Arabidopsis, rapeseed, and soybean seeds. Our method will be useful for monitoring the expression patterns of low level transcripts in developing and mature seeds.

We have succeeded in establishing a method for RNA isolation from plant seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method is suitable for monitoring the expression of genes with low level transcripts in seeds.

양 사체 (Transcriptome) 분석에있는 사용을위한 씨앗에서 매우 정제 된 RNA의 분리를위한 효율적인 방법

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

작은 각 엑스레이 뿌리기를 사용 하 여 솔루션에서 고분자의 구조 연구

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

캡처 클릭 화학 기반 RNA 위하여를 사용 하 여 RNA 의무적인 단백질의 포착 (CARIC) 전략

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Studying RNA Interactors of Protein Kinase RNA-Activated during the Mammalian Cell Cycle

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral RNAs. When bound to viral double-stranded RNAs (dsRNAs), PKR undergoes dimerization and subsequent autophosphorylation. Phosphorylated PKR (pPKR) becomes active and induces phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2&#945;) to suppress global translation. Increasing evidence suggests that PKR can be activated under physiological conditions such as during the cell cycle or under various stress conditions without infection. However, our understanding of the RNA activators of PKR is limited due to the lack of a standardized experimental method to capture and analyze PKR-interacting dsRNAs. Here, we present an experimental protocol to specifically enrich and analyze PKR bound RNAs during the cell cycle using HeLa cells. We utilize the efficient crosslinking activity of formaldehyde to fix PKR-RNA complexes and isolate them via immunoprecipitation. PKR co-immunoprecipitated RNAs can then be further processed to generate a high-throughput sequencing library. One major class of PKR-interacting cellular dsRNAs is mitochondrial RNAs (mtRNAs), which can exist as intermolecular dsRNAs through complementary interaction between the heavy-strand and the light-strand RNAs. To study the strandedness of these duplex mtRNAs, we also present a protocol for strand-specific qRT-PCR. Our protocol is optimized for the analysis of PKR-bound RNAs, but it can be easily modified to study cellular dsRNAs or RNA-interactors of other dsRNA binding proteins.

We present experimental approaches for studying RNA-interactors of double-stranded RNA binding protein kinase RNA-activated (PKR) during the mammalian cell cycle using HeLa cells. This method utilizes formaldehyde to crosslink RNA-PKR complexes and immunoprecipitation to enrich PKR-bound RNAs. These RNAs can be further analyzed through high-throughput sequencing or qRT-PCR.

공부 하는 단백질 키 니 아 제 RNA 포유류 세포 주기 동안 활성의 RNA 인터

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral ...

Translating Ribosome Affinity Purification (TRAP) for RNA Isolation from Endothelial Cells In Vivo

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis of transcriptome and gene expression by qPCR and RNA sequencing. Comprehensive transcriptome and gene expression analysis of specific cell types in complex tissues and organs will be critical to understand cellular and molecular mechanisms by which genes are regulated and their association with tissue homeostasis and organ functions. In this article, we demonstrate the methodology for isolation of ribosome-bound RNA directly in vivo in the vascular endothelia of animal lungs as an example. The specific materials and procedures for tissue processing and RNA purification will be described, including the assessment of RNA quality and yield as well as real time qPCR for arteriogenic gene assays. This approach, known as translating ribosome affinity purification (TRAP) technique, can be utilized for characterization of gene expression and transcriptome analysis of certain cell types directly in vivo in any specific type in complex tissues.

Translating Ribosome Affinity Purification TRAP for RNA Isolation from Endothelial Cells In Vivo

We present an approach to purify ribosome-bound mRNA from vascular endothelial cells (ECs) directly in mouse brain, lung and heart tissues via EC-specific genetic tag of enhanced green fluorescence protein (EGFP)in ribosomes in combination with RNA purification.

생체 내피 세포에서 RNA 격리를 위한 리보솜 친화성 정제(TRAP) 번역

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis ...

RNA Blot Analysis for the Detection and Quantification of Plant MicroRNAs

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and animals. Most miRNAs act as negative switches of gene expression targeting key genes. In plants, primary miRNAs (pri-miRNAs) transcripts are generated by RNA polymerase II, and they form varying lengths of stable stem-loop structures called pre-miRNAs. An endonuclease, Dicer-like1, processes the pre-miRNAs into miRNA-miRNA* duplexes. One of the strands from miRNA-miRNA* duplex is selected and loaded onto Argonaute 1 protein or its homologs to mediate the cleavage of target mRNAs. Although miRNAs are key signaling molecules, their detection is often carried out by less than optimal PCR-based methods instead of a sensitive northern blot analysis. We describe a simple, reliable, and extremely sensitive northern method that is ideal for the quantification of miRNA levels with very high sensitivity, literally from any plant tissue. Additionally, this method can be used to confirm the size, stability and the abundance of miRNAs and their precursors.

This method demonstrates use of the northern hybridization technique to detect miRNAs from total RNA extract.

식물 MicroRNAs의 검출 및 정량화를 위한 RNA 블롯 분석

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and ...

Isolation and Analysis of Plasma Lipoproteins by Ultracentrifugation

Analysis of plasma lipoproteins and apolipoproteins is an essential part for the diagnosis of dyslipidemia and studies of lipid metabolism and atherosclerosis. Although there are several methods for analyzing plasma lipoproteins, ultracentrifugation is still one of the most popular and reliable methods. Because of its intact separation procedure, the lipoprotein fractions isolated by this method can be used for analysis of lipoproteins, apolipoproteins, proteomes, and functional study of lipoproteins with cultured cells in vitro. Here, we provide a detailed protocol to isolate seven lipoprotein fractions including VLDL (d&#60;1.006 g/mL), IDL (d=1.02 g/mL), LDLs (d=1.04 and 1.06 g/mL), HDLs (d=1.08, 1.10, and 1.21 g/mL) from rabbit plasma using sequential floating ultracentrifugation. In addition, we introduce the readers how to analyze apolipoproteins such as apoA-I, apoB, and apoE by SDS-PAGE and Western blotting and show representative results of lipoprotein and apolipoprotein profiles using hyperlipidemic rabbit models. This method can become a standard protocol for both clinicians and basic scientists to analyze lipoprotein functions.

Several methods have been used for analyzing plasma lipoproteins; however, ultracentrifugation is still one of the most popular and reliable methods. Here, we describe a method regarding how to isolate lipoproteins from plasma using sequential density ultracentrifugation and how to analyze the apolipoproteins for both diagnostic and research purposes.