This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

모든 실험은 실험 동물 (16)의 관리 및 사용을위한 건강 가이드의 국립 연구소의 기관 동물 관리 및 사용위원회 (IACUC)에 따라 수행 하였다. 참고 : 달리 명시되지 않는 한 얼음에 보관 된 사용 낮은 결합 원심 분리기 튜브 아래의 모든 단계. 조직 컬렉션 전에 1. 준비 <ol><li> 4 O C.에 원심 분리기를 설정 </li><li> 화재 폴란드어 감소 약 1.3의 직경, 0.8, 각 샘플에 대한 0.4 mm와 3 개의 유리 파스퇴르 피펫 세트. </li><li> 감기 버퍼 1 ml에 포함 된 표시 1.7 ml의 튜브를 준비하고 얼음에 튜브를 유지. </li><li> 매트릭스, 주걱과 절개를 수행 할 유리판 (또는 반전 유리 페트리 접시)를 슬라이스 뇌를 포함하는 얼음 트레이를 준비합니다. t을 눌러 모든 악기를 건조 유리 접시와 사용 조직 종이에 사전 진정 두 개 이상의 면도날발행물. </li><li> 조직 수집 전에, 30 분 동안 실온 (RT)에서의 효소 용액을 해동. </li></ol> 2. 조직 수집 및 해부 <ol><li> 조직 수집하기 전에 행동이나 약물 치료 90 분을 시작합니다. 참고 : 여기에 표시된 결과를 위해, 새로운 환경 (테스트 조건)과 순진한 쥐 쥐 5 ㎎ / ㎏ 메스 암페타민의 급성 복강 내 주사는 자신의 홈 케이지 (제어 조건)에 보관을 시행 하였다. </li><li> 포화 이소 플루 란과 유리 데시 케이 터 항아리에 배치하여 쥐를 마취와 쥐 (30) 목을 벨 - 60 초 후에 단두대를 사용. 머리의 피부와 근육을 제거하고 두개골을 노출 가위를 사용합니다. 두개골을 잘라 난원 매그넘을 열고 두개골의 뒤쪽 부분을 제거하는 rongeurs을 사용합니다. 뇌를 노출 두개골의 상단 가장자리를 따라 잘라 rongeurs을 사용합니다. 뇌 손상되지 않도록주의하십시오. 부드럽게 언더 퍼 위해 작은 주걱을 사용하여뇌를 상승 거라고. 뇌를 올리고 뇌가 17 될 때까지 신경을 잘라. </li><li> 면도날을 사용하여 조직의 해부. 참고 : 다음 방법 중 하나를 사용하여 조직 샘플을 얻습니다 (2.3.1) 갓 해부 조직을; 절개 후 (2.3.2) 냉동 조직; 또는 (2.3.3) 냉동 조직을 냉동 전체 뇌 해부. 해부를 통해 뇌 슬라이스 매트릭스, 면도날과 유리 접시를 건조하게 유지하고 응축 물과 같은 프로세스를 닦지하는 것은 세포의 저장성 용균 될 수 있습니다. 정확한 해부을 보장하기 위해 돋보기 안경을 사용합니다. <ol><li> 갓 해부 조직의 경우, 얼음에 냉각 된 뇌 슬라이스 매트릭스 (1mm 간격으로 면도날 슬롯이있는 쥐의 뇌 모양의 금형)에 갓 추출 된 뇌를 놓습니다. 관심있는 뇌 영역 (들)을 포함 코로나 조각을 잘라 슬롯에 두 개 이상의 사전 냉장 면도날을 삽입합니다. 냉장 유리 접시에 잘라 슬라이스를 놓습니다. 참고 : 뇌 레지오을 해부하다냉장 유리 접시에 관심 NS. </li><li> 절개 후 동결 조직 들어 2.3.1에서 상술 된 것과 유사한 새롭게 추출 뇌 조각에서 관심있는 뇌 영역 (들)을 해부. 마이크로 튜브로 해부 조직을 놓고 빠른 속도로 20 초 동안 -40 ºC의 이소 펜탄에서 마이크로 튜브를 침지하여 조직을 동결. 추가 처리까지 -80 ºC의 냉장고에 항상 냉동 해부 조직을 유지합니다. </li><li> 냉동 조직의 경우, 즉시 최대 6 개월 -80 ºC에서 밀폐 된 가방 -40 ºC의 이소 펜탄 및 저장소에 갓 추출 된 두뇌를 동결. <ol><li> 해부의 날, 약 설정 저온 유지 장치에 고정 된 뇌를 배치 -20 ºC (더 따뜻한 -18보다 ºC)를 약 2 시간 동안 온도를 평형. 참고 훨씬 낮은 온도 안전하게 절단 뇌 너무 취성 만드는 동안 뇌는이 온도에서 용이하게 절단 할 수있다. </li><li> 의 2mm 관상 조각 - 1을 잘라 면도날을 사용하여그라 이오 스탯에 얼어 붙은 두뇌. 동결 조건이 조각에서 티슈 펀치를 얻기 위해 평활화 12 16 게이지 바늘을 사용한다. 추가 처리 할 때까지 항상 냉동 해부 조직을 유지합니다. </li></ol></li></ol></li><li> 닦지 전에 해부 조직을 충당하기 위해 버퍼 (A)의 2 방울 - 1을 추가합니다. 분쇄 공정의 나머지 동안 뉴런의 손실을 방지하기 위해 두 개의 면도날을 사용하여 조직으로부터 백색 물질의 대부분을 제거한다. 냉동 된 조직으로 시작하는 경우, 조직의 버퍼에게 솔루션을 적용하기 전에 더 이상 1 분 동안 차가운 유리판 위에 해동 할 수있다. </li><li> 냉장 유리 접시에 면도날로 조직 각 직교 방향으로 100 번을 말하다. 닦지 때 유리판에 수직 면도날 잡아. 주 : 철저한 닦지 모든 프로토콜 단계에 중요합니다. </li><li> Ke에 5 회 - 튜브 3을 전환 냉 버퍼 A. 1 ㎖를 함유하는 마이크로 원심 튜브에 다진 조직을 전송 면도날을 사용하여용액 모든 다진 조직 EP. </li></ol> 3. 세포 해리 참고 : 다음 단계의 모든 혼합 끝 이상을 사용하여 부드러운 끝. 볼텍스 혼합기를 사용하여 세포 손상의 원인이 기포를 방지하지 않는다. <ol><li> 4 ºC에서 2 분 동안 110 XG에서 샘플 튜브를 원심 분리기. 폐기 뜨는. 천천히 마이크로 튜브의 내벽 다운 냉간 신선하게 해동 된 효소 용액 (단백질 분해 효소의 조합을 포함) 1 ㎖를 추가한다. 즉시 다진 조직 펠렛을 분산 적당히 큰 팁 직경 피펫 만 4 번을 피펫과 아래로 부드럽게 전체 펠렛을 빨아합니다. </li><li> 바닥에 달라 붙는 펠렛을 방지하고 4 오 ℃에서 30 분 동안 엔드 오버 엔드 혼합과 샘플을 부화 즉시 마이크로 튜브를 반전 </li><li> 효소 조직 소화 한 후, 원심 분리기 4 ºC에서 2 분 동안 960 XG에 튜브. 상층 액을 제거하고 차가운 버퍼 A. Immediatel 0.6 ml에 추가Y 버퍼를 추가 한 후, 아래로 5 회 전체 펠릿을 흡입하여 펠렛을 분산하기 위해 동일한 피펫 팁을 사용하여 부드럽게 피펫합니다. </li><li> 기계적 소화 조직을 씹다하고 다음 단계를 사용하여 15 ml의 튜브에 수집합니다. 각 샘플에 대해, 라텍스 전구에 부착 약 1.3, 0.8 및 0.4 mm의 직경을 내림차순로 3 화재 - 광택 유리 파스퇴르 피펫의 별도의 세트를 사용합니다. <ol><li> 조심스럽게 각 시료를 1.3 mm의 유리 피펫 10 번 씹다. 샘플 (바닥에 정착 할 파편과 해리되지 않은 세포) 얼음에 2 분 동안 정착하자. 15 ml의 원추형 튜브에 상청 (~ 0.6 ml) 및 전송 부담 (튜브 # 1). </li><li> 나머지 펠릿에 대한 해결책 버퍼 ㎖로 0.6를 추가합니다. 샘플을 0.8 mm의 유리 피펫 10 번 씹다. 샘플을 얼음에 2 분 동안 정착하자. 동일한 15 ml의 상층 액 (~ 0.6 ml) 및 전사 수집 원뿔 튜브 # 1. </li><li> 나머지 PELLE에 대한 해결책 버퍼 ㎖로 0.6 추가티. 샘플을 0.4 mm의 유리 피펫 10 번 씹다. 샘플을 얼음에 2 분 동안 정착하자. (비 - 해리 세포 펠렛을 건드리지 않고 ~ 0.6 ㎖)과 같은 15 ML 원뿔 튜브 # 1로 전송 뜨는를 수집합니다. 참고 : 다음 분쇄 단계의 튜브 # 1에서 0.4 mm 직경의 피펫을 유지합니다. </li><li> 단계를 반복 3.4.3 별도의 15 ML 원뿔 튜브에 3 개의 작은 유리 피펫 (~ 0.4 mm 직경)를 사용하여 시간 및 상층 액을 수집 (튜브 # 2). </li><li> 0.4 mm 유리 피펫을 사용하여 10 회 이상에 대한 튜브 # 1과 # 2의 수집 세포 현탁액을 씹다과 얼음에 보관하십시오. </li></ol></li></ol> 4. 셀 고정 및 Permeabilization <ol><li> 100 % 차가운 에탄올 800 μl를 추가하여 (튜브 # 2에서 셀 관 # 1에서 셀이 모세관과 2 개) 샘플 당 4 모세관을 준비 각각의 튜브에 (사용 전에 -20 ℃로 저장) 및 얼음에 보관하십시오 . 참고 : 최종 에탄올농도가 50 % 일 것이다. </li><li> 피펫 ~ 800 냉 에탄올을 함유하는 튜브를 4 각으로 (튜브 # 1, # 2 튜브)에서 세포 현탁액 μL와 샘플을 혼합하여 튜브를 반전한다. </li><li> 튜브를 5 분마다 반전하면서 15 분 동안 얼음에서 인큐베이션 튜브. </li><li> 고정 / permeabilization 후, 4 ºC에서 4 분 동안 1,700 XG에서 튜브를 원심 분리하고 상층 액을 버린다. 세포의 손실을 방지하기 위해 용액 50 μl를 떠난다. 참고 :이 단계에서 펠렛은 흰색이며, permeabilization 이전보다 튜브의 벽에 덜 스틱. 그러므로, 펠릿이없는 곳 마이크로 튜브의 벽을 터치하여 조심스럽게 상층 액을 제거하고 천천히 마이크로 피펫을 이용하여 상층 액을 그립니다. </li></ol> 5. 셀 여과 <ol><li> 다음과 같이 차가운 PBS와 단계 4.4에서 펠렛을 다시 일시 : <ol><li> 튜브 # 1에서 나오는 두 개의 모세관 중 하나에 차가운 PBS 550 μl를 추가하고, 적당히 큰 직경의 파이를 사용pette 팁은 부드럽게 세포 현탁액의 상하 5 회 피펫합니다. 하나의 마이크로 튜브는 튜브 # 2에서 오는 동일한를 반복합니다. </li><li> 동일한 피펫을 사용하여 튜브 # 1 셀, 제 2 펠릿 제 세포 현탁액을 전송. 부드럽게 결합 된 세포 현탁액의 상하 5 회 피펫 팅하여 두 번째 펠렛을 재현 탁. </li><li> 튜브 2로부터 셀, 재현 탁 및 5.1.2에 기술 된 바와 같이 펠렛 (즉, 세 번째와 네 번째 모세관)를 결합한다. </li></ol></li><li> 별도로 셀 스트레이너의 두 개의 서로 다른 쌍 (100 μm의 40 μm의 기공 크기) 다음을 사용하여 단계 5.1.2과 5.1.3에서 두 세포 현탁액을 필터링 : <ol><li> 스트레이너의 내부에 PBS를 첨가하여 예비 습윤 각 셀 스트레이너. 스트레이너의 외부에서 과량의 PBS를 제거하기 위해 피펫을 사용합니다. </li><li> 균일하게 100 μm의 세공 크기를 갖는 제 1 셀 스트레이너로 단계 5.1.2에서 세포 현탁액을 피펫. 얼음에 50 ㎖ 튜브에 관류 수집. 파이를 사용하여셀 스트레이너의 외측 저면에 부착 통해 pette는 플로우 기반을 수집한다. </li><li> 40 μm의 셀 스트레이너로 100 μm의 셀 스트레이너에서 관류를 전송하는 동일한 피펫을 사용한다. 얼음 다른 50 ML 튜브에서이 흐름을 통해 수집합니다. 40 μm의 셀 스트레이너에서를 통해 흐름을 전송하는 경우, 100 μm의 셀 스트레이너에서 오염을 방지하기 위해 새로운 피펫 팁을 변경합니다. </li><li> 필터의 새로운 세트를 사용하여 단계 5.1.3에서 세포 현탁액에 대해 이러한 단계를 반복합니다. </li></ol></li><li> 샘플 당 약 1 ml의 최종 용적은 각 시료로부터 두 관류 수확기. </li></ol> 항체 6. 배양 참고 : 이전에 주요 샘플을 실행에 설정 사이토 적절한 흐름을 설정하기위한 다수의 제어 샘플을 준비하는 뇌 세포 현탁액의 작은 분취 량을 사용합니다. 각 항체에 표지의 경우, 항체 만 자체를 포함하지 대조 시료를 준비다음 condary 항체 (또는 다른 형광 라벨), 두 일차 및 이차 항체 (또는 다른 형광 표지). 유동 세포 계수기의 비특이적 라벨링 대 특정 분리 문을 설정하는 이러한 컨트롤을 사용합니다. 가능하면 보상을 필요로하지 않는 형광 색소를 사용합니다. 이전에 일차 항체를 추가로 PBS를 첨가하여 700 ㎕의 최종 부피로 게이팅 대조 시료의 최종 부피를 증가시킨다. <ol><li> 1.7 ml의 마이크로 튜브로 여과 셀 100 μL 샘플을 전송함으로써 광산란 및 DAPI 제어 샘플을 준비한다. 핵 염색 1 μg의 / ㎖ DAPI와 차가운 PBS 600 μl를 추가합니다. 엔드 오버 엔드 혼합 10 분 동안 품어하고 (단계 6.4.5에 6.4.2에 표시된대로) 흐름 cytometer를 통과하기 전에 세척. 참고 :이 샘플 만 FACS 기계에 남아있는 세포를 정렬하기 전에 셀 / 핵 게이트를 설정하는 데 사용됩니다. </li><li> 100 &amp; #을 전송하여 하나의 immunolabeled 제어 샘플을 준비(181), 1.7 ml의 마이크로 튜브에 필터링 된 세포의 리터. (예를 들어, NeuN 항체) 한 항체와 차가운 PBS 600 μl를 추가합니다. 다른 항체 (예를 들어,에 Fos 항체)와 마이크로 튜브에 차가운 PBS 600 μl를 추가합니다. 이 직접 접합 된 일차 항체가 아닌 경우, 해당 이차 항체를 추가한다. 주 : 이들 샘플은 적절한 광전자 증 배관 (PMT) 전압을 결정하고, 필요하다면 두 개의 형광 신호의 중첩을 평가하기 위해 사용된다. 항체 농도는 모든 채널에서 최고의 신호 - 대 - 잡음 비율을 달성하기 위해 적정한다. 중복 형광 신호는 사이토 플로우 내의 상이한 형광 채널 내부 캘리브레이션에 의해 보상 될 수있다. </li><li> 1.7 ml의 마이크로 튜브에 필터링 된 세포를 100 μl를 전송하여 이중 형광 표지 된 음성 대조군 샘플을 준비합니다. 혼자 차 항체 IgG를 직접 복합 일차 항체와 차가운 PBS 600 μl를 추가합니다. 참고 : 티S 컨트롤 샘플은 각 형광의 배경 형광을 결정하기 전에 정렬 될 때마다 사용될 수있다. </li><li> 주요 샘플을 준비하는 분류합니다. <ol><li> 1.7 ml의 마이크로 튜브로 필터링 된 세포를 700 μl를 전송합니다. 주 NeuN 항체의 피코 에리 트린 (안티 NeuN-PE)에 직접 결합 : 알렉사 플 루어 647 (항에 Fos-AF647) 1.4 μL (500 1)에 직접 결합 차에 Fos 항체 : 7 μL (100 일)를 추가합니다. 엔드 오버 엔드 혼합 4 ºC에서 30 분 동안 튜브를 품어. </li><li> 인큐베이션의 끝에, 메인 시료 및 대조 시료를 포함하여 각 마이크로 튜브에 차가운 PBS 800 μl를 추가하고, 반전하여 혼합한다. </li><li> 원심 분리기 모세관 4 ºC에서 3 분 동안 1,300 XG에. 세포 손실을 방지하기 위해 50 μl의 상층 액을 떠나, 상층 액을 버린다. </li><li> 적당히 큰 팁 직경과 피펫을 사용하여 펠렛과에 resuspend 세포에 차가운 PBS 1 ML을 추가합니다. </li><li> 4 ºC에서 3 분 동안 1,300 XG에 원심 분리기. 디뜨는을 iscard. </li><li> 다시 정지 500 μL의 펠렛 차가운 PBS를 (최종 부피 펠렛의 크기를 따라 조정). </li><li> 전송 및 셀 스트레이너 캡 (40 μm의)와 함께 둥근 바닥 FACS 샘플 튜브에 현탁액을 필터링 할 수 있습니다. 얼음에 immunolabeled 세포를 유지하고 즉시 FACS를 수행합니다. 참고 : 필터링의 경우, 스트레이너 캡에 수직으로 피펫 팁을 터치하고 그것을 통해 세포 현탁액을 누릅니다. </li></ol></li><li> 제어 샘플을 사용하여 게이트 사이토 설정 흐름. <ol><li> 전체 이벤트 및 세포 파편에서 신경 세포 인구를 식별하기 위해 광산란 및 DAPI 제어 샘플을 사용합니다. 참고 : - 총 이벤트 (나머지는 파편과 깨진 세포 과정이다)의 2 %이 준비 세포 기관은 1입니다. DAPI 형광 신호 (표시 핵) 및 전달 산란 (셀의 크기)에 근거은 뒤로 앞으로 및 측면에 따라 세포 기관 및 게이트를 찾을 수의 속성을 광 산란셀 (도 1 A, B 참조). </li><li> PMT를 전압 설정을 확인하고, 다른 필터 / 채널 (예를 들어, 알렉사 플 루어 488 / FITC 또는 Phycoerythrine)에 하나의 특정 형광 색소에서 배출의 유출을 분석 한 immunolabeled 제어 샘플을 사용합니다. 형광 신호가 겹치는 경우에는 수동으로 보정 레벨을 조정하여 중첩을 수정한다. </li><li> 긍정적 인 인구에 대한 임계 값을 설정하는 이중 형광 표지 된 음성 대조군을 사용합니다. 주 :이 샘플에서 나오는 신호는 양성으로 간주 될 수있는 자동 형광이 임계 값 위에있는 주요 시료의 세포에 의한 것으로 생각된다. 일반적으로, 정렬을위한 임계 파라미터는 더 엄격한 약 음성 대조군 상기 표지 셀의 상부 2/3 실제로 분류되어있다. </li></ol></li><li> 1.7 ML의 마이크로 튜브에 FACS에 의해 메인 샘플에서 정렬 뉴런. RNA의 50 μL로 세포를 수집추출 버퍼입니다. 정렬 와류 원심 분리 튜브 및 상기 튜브의 벽에 모든 정렬 균체를 회수 아래로 10 번을 피펫 팅에 의해 현탁 혼합 후. </li><li> 모든 세포가 RNA 추출 이전에 용해되어 있는지 확인하고 4 ºC에서 2 분 동안 2,800 XG에 원심 분리기 30 분 동안 42 ºC에서 정렬 된 세포 현탁액을 품어. </li><li> 13-15 앞서 설명한 바와 같이, RNA 분리, cDNA 합성, 표적 유전자 사전 증폭 qPCR에 대한 샘플을 처리 즉시 -80 ºC 장기 보존 용의 RNase가없는 튜브로 상청액을 전송하거나. </li></ol>

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

The authors declare that they have no competing financial interests.

FACS는 어느 신선하거나 냉동 성인 뇌 조직의 신경 세포 및 다른 세포 유형을 정렬하기 위해 사용될 수있다. 서론에서 언급 한 바와 같이, 냉동 조직을 사용하는 능력은 중독 연구에 자기 관리 및 재발 연구 등 복잡하고 연장 된 행동 절차를받은 동물에서 샘플의 최적 활용을 할 수 있습니다. 2 시간 이상, 모든 동물이 필요합니다 - 이러한 행동 절차는 보통 1 소요됩니다 - 같은 날 13,18 테스트 할 (10 ~ 20 총). 그것은 뇌 해부, 세포 분리, permeabilization 및 immunolabeling를 포함 4 갓 해부 뇌 조직 샘플을 처리하기 위해 ~ 4 시간이 걸립니다. 30 분 - 처리 후, FACS에 의해 각각의 샘플을 분류하면 (20) 사이에 걸립니다. 용해 버퍼에 정렬 된 셀을 가열하고 최종 단계는 추가로 30 분을 필요로한다. 총 ~ 7 시간은 최종 RNA 함유 세포 용해 액 단계로 뇌 해부에서 필요합니다. 그러나, 전체 꼰 로프를 고정 할 수있게되었습니다NS 또는 갓 즉시 테스트 후 뇌 영역을 해부하고 나중에 처리합니다. 이것은 크게 테스트를 단순화하고 다른 날에 정렬 여러 뇌 영역을 허용합니다. 이전 FACS에 조직을 동결하면 결과를 향상시킬 수 있습니다. 더 NeuN 양성 신경 세포는 냉동 조직 샘플에서 얻을 수 있습니다. 이는 같은 NeuN과에 Fos 같은 세포 내 단백질에 대한 항체 액세스를 증가 동결 이후의 해동시 세포 세포막의 파괴, 증가 NeuN - 라벨에 의해 부분적으로 설명 될 수 있습니다. 동일한 효과 섬유 아세포, 상피 세포 및 HeLa 세포 (19)이 관찰되었다. 세포 및 신경 세포의 수율은 다음 단계를 사용하여 최대화 될 수있다. 조직의 절개 동안 (각각 등쪽 선조체 및 핵 중격 의지에 대한 뇌량 및 전방 접합면) 흰색 물질의 대부분을 제거합니다. 이는 후속 인트의 플라스틱 팁 유리 피펫에 부착되는 조직을 방지추신. 사용 버퍼 A는 덮여 해부 조직을 유지하기 위해 (재료 및 시약의 표 사양 참조). 이는 면도날 (스텝 2.5)과 조직의 닦지 동안 셀의 품질을 향상시킨다. 셀 스트레이너 (단계 5)의 제 2 세트를 가진 작은 유리 피펫 (단계 3.9) 및 후속 필터링 세 분쇄 단계의 추가적인 세트는 세포 및 신경 세포의 수율을 배가. 셀 스트레이너를 재사용하면 필터 및 낮은 세포 수율을 방해 할 것입니다. 펠렛 및 분쇄 과정을 재현 탁 때 세포와 부드러운합니다. 이 단계 동안 적당히 큰 피펫 팁을 사용하면 전단 응력에 의한 세포 손상을 감소시킬 것이다. 에탄올 (단계 4.4)와 permeabilization 후 상층 액을 제거 할 때 조심스럽게 펠렛을보세요. 펠렛을 덜 조밀하고 microcentrifuge 관의 벽을 따라 분배 될 수있다. 거친 계산에 Fos 양성 신경 세포의 수율이 해부 선조체 조직 샘플에서 시작 번호의 약 10 %는 것이 좋습니다. </P&gt; 현재의 프로토콜이 다른 실험 목적에 맞게 변경 될 수있다. 에 Fos 발현에 Fos 발현 뉴런의 효율적인 정렬을 위해 매우 중요하다이 시간에 최대 수준에 도달하기 때문에 현재 프로토콜에서, 조직은 필로폰 주사 후 90 분을 수집 하였다. 그러나, 조직을 실험의 특정 목적에 따라 FACS위한 임의의 시점에서 회수 할 수있다. 초기 조직 샘플의 저장을 위해, 우리는 성공적 갓 해부 조직을 절개 한 후 냉동 조직, 또는 유전자 발현의 qPCR 분석 하였다 FACS를 FOS를 발현하는 신경 세포를 분리 냉동 전뇌 해부 냉동 조직을 사용 하였다. 이 프로토콜 (15 분 4 ° C)에 고정 및 permeabilization, 시간과 온도 모두 세포질과 핵 막을 Permeabilize 하시려면 할뿐만 아니라 조직을 해결하기 위해 최적화되었다. 시간 및 / 또는 온도의 변화는 최종 결과를 변경할 수있다. 이러한 paraformald 같은 다른 고정 솔루션ehyde 및 배아 및 산후 뉴런 20 일한 같은 사포닌과 같은 ​​비이 온성 세제는 성인 뇌에서 뉴런을 위해 작동 할 수 있습니다. 뇌 조직 (21)에 대해 최근 FACS 나타내는 바와 같이 또한, 수초 제거 비드 현재 프로토콜의 변형 예로서 사용할 수있다. 현재의 프로토콜은 고려해야 할 두 가지 중요한 제한이 있습니다. 우선,이 프로토콜은 이들 세포 과정이 분쇄 및 분리 단계 중에 균체로부터 제거되기 때문에 시냅스에서 주로 발현 (예, 도파민 또는 글루타메이트 수용체)되는 세포 표현형 마커를 검출하기 적합하지 않다. 두번째 가능한 제한 FACS 분류 된 세포에서 얻은 RNA 길이는 모든 RNA 분석 방법에 충분하지 않을 수 있다는 것이다. FACS에서 얻은 RNA를위한 RNA 무결성 번호 (RIN)는 세포가 짧은 평균 RNA의 길이에 해당하는 2.5 3.5 사이에 정렬. 여기서, 짧은 RNA 크기에 의해 보상 된이전에 13 ~ 15 설명 된 바와 같이, 100 bp의 - 80의 비교적 짧은 qPCR에의 증폭을 사용. 우리는 또한 마이크로 어레이 분석 (11)에 대해 성공적으로 짧은 길이의 RNA를 사용했다. 그럼에도 불구하고, 얻어진 짧은 RNA의 길이는 모든 RNA 분석 방법에 적합하지 않을 수 있습니다. 구체적으로 대상 엑손 - 엑​​손 접합부가 세포질에만 완전히 접합의 mRNA에서 발견 PCR 프라이머가 사용 된 점을 강조해야한다. 이 프라이머는 핵에서 인트론 함유 RNA를 검출하지 않습니다. 또한, 우리는 이전에 세포막 (10)의 세포질과 D1 도파민 수용체에서 티로신 수산화을 검출하는 항체와 신선한 뇌 조직이 프로토콜을 사용하고 있습니다. 이 세포질 막과 세포 마커의 검출은 분리 과정이 크게 손상 세포를 생성하고, 단순히 핵없는 것으로 나타났다. 전반적으로, 냉동 샘플에서 신경 세포의 FACS 격리는 다른 응용 프로그램을 엽니 다. 정렬 또는 유전자 expre에서 차이가 없습니다샘플 -80에서 3 일 3 주 저장 될 때 ssion는 (데이터가 도시하지 않음)가 관찰되었다 ºC. (- 40 샘플 20)과 유전자 발현에 대한 RNA를 분리 3 주 특정 실험에서 모든 샘플을 정렬 할 수있는 적당한 시간입니다. 유용한 RNA는 -80 ºC (데이터는 여기에 도시되지 않음)에서 6 개월 보관 뇌 조직으로부터 얻어진다. 따라서,이 프로토콜은 몇 달 또는 몇 년 동안 저장 한 사후 냉동 인간의 뇌 샘플의 FACS 분리에 유용 할 수 있습니다.

학습하는 동안, 동물은 매우 구체적인 자극의 복잡한 세트 사이의 연결을 형성한다. 이것은 고해상도 정보 신경 앙상블이라 띄엄 띄엄 분산 된 뉴런의 특정 패턴 내의 변화에​​ 의해 인코딩 될 것으로 생각된다. 신경 앙상블은 최근 강하게 행동이나 큐 노출시 활성화 된 예에 Fos, 아크 및 Zif268 및 신경 세포에서의 단백질 제품으로 즉시 초기 유전자 (IEGs)의 유도에 의해 확인되었다. 특히 상황과 큐 - 특정 배운 행동 1-4에 인과 역할을하는 것으로 나타났다 신경을 FOS는 발현. 따라서, 이러한 활성화에 Fos 발현하는 신경 세포 내에서 고유 분자 neuroadaptations은 중독과 외상 후 스트레스 장애 (PTSD) 5 정상적으로 학습과 이상 학습 장애 동안 형성된 협회를 알게 인코딩 신경 메커니즘에 대한 상위 후보입니다. Fluore에서 scence 활성화 된 셀 정렬 (FACS)는 최근에 Fos 발현하는 신경 세포 내에서 고유 분자 neuroadaptations의 분석을 허용했다. 유세포 셀은 광 산란 특성에 따라 면역 세포를 특성화하고 분리 1960 -6,7- 개발되었다 정렬 및 긴 면역학 및 암 연구에 사용되었다. 그러나 유동 세포 계측법 및 FACS는 성인 뇌 조직에서 얻기 어려운 해리 하나의 세포가 필요합니다. FACS는 제 8,9 항체 표지가 필요하지 않은 트랜스 제닉 마우스로부터의 선조체 뉴런 발현 분리하고 (GFP)에 녹색 형광 단백질을 분석하는데 사용 하였다. 우리는 분리 및 야생형 동물 11-15에서 약물 및 / 또는 단서에 의해 활성화 된 뉴런에 Fos가 발현 분자 변화를 평가하는 항체 기반 FACS 방법 (10)을 개발했다. 강하게 신경 세포를 활성화하는 동안이 방법에서는, 신경 세포는 일반적으로 신경 세포 마커 NeuN에 대한 항체로 표시되어 있습니다에 Fos에 대한 항체로 표시되어 있습니다. 우리의 초기 방법은 신선한 조직 샘플 당 최대 10 쥐의 풀링을 요구하지만, 프로토콜의 이후의 변경은 단일 쥐 13-15에서 분리 된 뇌 영역에 Fos 발현 뉴런과 정량적 중합 효소 연쇄 반응을 (qPCR에) 분석 FACS 분리 허용 . 전반적으로, 독특한 분자 변경은 중독 연구 12,14,15의적인 상황과 큐 활성화 행동의 다양한 동안 활성화 뉴런에 Fos가 발현에서 발견되었다. 신선한 조직에 FACS를 수행와 주요 물류 문제는 FACS에 의해 조직 및 프로세스를 해리 하나 하루 종일 걸리는 것입니다. 또한, 약 4 개의 샘플은 하루에 처리 될 수있다. 이것은 일반적으로 하나의 뇌 영역마다 뇌에서 평가 될 수 있고, 나머지 뇌 영역을 폐기해야하는 것을 의미한다. 이것은 자기 관리 및 멸종 TRAI 낮은 처리량 행동 절차에 대한 주요 문제수술과 집중적 인 훈련의 많은 주를 필요로 닝. 또, 시험 당일에 길고 복잡한 행동 절차 어려운 당일 FACS를 수행 할 수있다. 이것은 중요한 이점을 즉시 행동 시험 후 동물로부터 뇌를 고정 할 수있을하고 조사자 선택한 다른 시간에 하나 이상의 뇌 영역 FOS를 발현하는 신경 세포를 분리한다. 여기서 우리는 FACS 프로토콜 신선한 냉동 모두 뇌 조직 FOS를 발현하는 신경 세포 (및 다른 유형의 세포)를 분리하기 위해 사용될 수 있음을 보여준다. 예를 들어, 우리는 급성 필로폰 주사 후 주사 (제어 조건)없이 순진한 쥐에서 쥐 선조체의 신경 세포에 Fos가 발현입니다. 그러나이 프로토콜은 FACS 어떤 행동 또는 약물 치료 다음 사용될 수있다. 우리의 샘플의 후속의 qPCR 분석은 이들 세포 타입에서 유전자의 발현이 미으로 평가 될 수 있다고 지적신선한 냉동 모두 조직에서 LAR 효율.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

신경 가소성 및 학습 행동의 분자 변화의 연구는 협회를 알게을 중재 신경 앙상블라고 띄엄 띄엄 분산 활성화 된 뉴런의 특정 세트의 연구에 전체 뇌 영역의 연구로 전환된다. (FACS)을 정렬 형광 활성 세포는 최근 성인 쥐의 뇌 조직에 최적화 신경 마커 NeuN과에 Fos 단백질, 강력하게 활성화 된 신경 세포의 마커에 대한 항체를 사용하여 활성화 된 뉴런의 분리를 허용하고있다. 지금까지에 Fos 발현하는 신경 세포와 다른 세포 유형은 긴 처리 일 길고 복잡한 행동 절차 후 평가하기 위해 뇌 샘플을 허용 매우 제한된 숫자를 수반 신선한 조직에서 분리 하였다. 이십일일 - 여기에서 우리는 등쪽 선조체의 신경과에 Fos mRNA의 별점이 발현의 수익률이 3 -80 ºC에서 동결 갓 해부 조직과 조직 사이의 유사한 것으로 나타났다. 또, 표현형 확인냉동 조직은 또한의 FACS 분리에 사용할 수 있음을 나타냅니다 신경의 평가 유전자 발현 (NeuN), 성상 세포 (GFAP), oligodendrocytic (Oligo2) 및 microgial (Iba1) 마커에 의한 NeuN 양성 및 NeuN 음성 분류 세포의 아교 세포 유형. 전반적으로, 이는 수집 해부 복수 FACS 세션을위한 뇌 조직을 고정 할 수있다. 이것은 종종 길고 복잡한 행동 절차를 거친 유용한 동물 대상에서 획득 된 데이터의 양을 최대화한다.

급성 필로폰 주사 후 한 쥐에서 신선한 냉동 등쪽 선조체 조직 FOS를 양성과에 Fos 음이 신경 세포를 정렬. 위에서 설명한 프로토콜은 필로폰 (5 ㎎ / ㎏)의 복강 내 주사 후 한 쥐의 등쪽 선조체 90 분 FOS를 양성과에 Fos 음이 신경 세포를 정렬하기 위해 사용되었다. 자신의 홈 케이지에서 순진한 쥐를 대조군으로 사용 하였다. 지느러미 선조체 조직이 처리 된 중 즉시 모음 (신선한 조직) 또는 냉동 및 1, 7, 21 일 -80 ºC에 저장 후 처리 후. 이러한 동결 시점의 결과는 서로 차이가 없었다 때문에 데이터 모았다. 악기에 정렬 조건을 설정하려면, 하나 홈 케이지 제어 또는 methampheta에서 (전술) 제어 샘플내 주입 그룹이 사용되었다. 이러한 샘플의 각 입자 또는 이벤트가 사이토의 플로우 셀을 통과 할 때, 이들은 이벤트의 광 산란 및 형광 특성과 연관 스프레드 시트에 기록 된 ID 번호를 부여한다. 이 시트의 이벤트는 이러한 특징 (그림 1)에 대한 scattergrams 또는 밀도 플롯 구성 할 수 있습니다. 유사한 특성을 가진 이벤트는 그룹화 또는 그 함유하는 세포, 신경 세포, 또는에 Fos 양성 신경 세포로 문을 결정하는 특성의 다른 쌍에 의해 &#39;게이트&#39;할 수 있습니다. 게이트는 전술 한 대조 시료를 이용하여 결정되면, 메인 샘플이 게이트에 따른 흐름 cytometer 주입과 정렬된다. 셀 인구는 그들의 앞으로 빛의 산란을 기반으로 모든 이벤트 (세포 파편)에서 게이트되었다 (FSC, 입자의 크기 표시) 및 측면 광 산란 (SSC를, 입자의 g의 표시를ranularity). 금감위 SSC 대 도트 플롯에 도시 된 (도 1A 및 1B) 모든 이벤트의 밀도 플롯 큰 이종 집단에 부가하여, 유사한 크기 및 입도 (granularity)와 작은 균질 한 집단을 보여준다 같이 (도 1a 및도 1b). 세포 기관을 포함하는 작은 균일 한 인구는 식별 및 이전의 연구 11,13-15와 DAPI와 라벨에서 FSC와 SSC 특성에 따라 &quot;셀&quot;로 문이되었다. 세포의 약간 높은 비율 신선한 조직 (1.9 %)보다는 냉동 조직 (2.6 %)에서 얻었다. 큰 이기종 인구는 아마도 수지상 및 축삭 과정에서, 대부분 파편이다. 다음으로, &quot;셀&quot;게이트로부터 하나의 셀이 X 축상의 각각의 이벤트에 대한 FSC 신호의 폭에 의해 지시 된 크기에 기초하여 동정 하였다. 하나의 세포보다 더 컸다 이벤트 세포 집합체로 간주되었다<html> 과에서 제외 &quot;단일 세포 게이트. 이후의 분석 단계의 모든이 안에 실시했다&quot;단일 셀 &quot;게이트 (그림 1C 및 1D).이 단일 세포 인구의 대부분 (&gt; 92 %)는 (데이터 DAPI 염색에 양성이 아니었다 참조). 먼저, 뉴런 NeuN - 면역 (도 1E 및 1F)에 표시된 그들의 PE 형광 강도를 기초로 확인되었다. 뉴런은 신선한 조직 및 냉동 조직에 대한 38 %의 &quot;단일 셀&quot;게이트에서 모든 사건의 약 24 %를 차지. 거의 모든이 &quot;신경&quot;게이트 사건 (신선한 조직의 98 % 및 냉동 조직의 99 %)의 세포 핵 (그림 1G 및 1H)에서 DNA의 DAPI 염색에 양성이었다. 그림 3 qPCR에 의해 확인 된 단일 세포 게이트의 나머지 DAPI 표지 이벤트는, NeuN - 음과 아교 세포, 희소 돌기 아교 세포 및 미세 아교 세포를 포함한다. 1 &quot;&gt; 다음 신경 세포가 자신의 알렉사 플 루어 647 형광 신호 FOS (-면역)에 따라 신경 세포에 Fos 양성 또는에 Fos 음성으로 분류 된 세포 형 마커는 달리,에 Fos.&quot;유지 - together.within 페이지 = FO &quot;ove_content 때문에 신경 활동 시간 코스의 수준을 다른 점차 신경 세포의 증가 발현 수준. 따라서,에 Fos 음성 뉴런 대에 Fos 양성 사이에 명확한 한계가있을 수 없습니다. 첫 번째 단계에서는 (오프 라인으로 분석에만 사용 ) 뉴런에 Fos 양성의 비율을 계산, 우리는 순진 홈 케이지 제어 쥐에서 NeuN 음성 인구 FOS를 최대 알렉사-647 형광 (을 기반에 Fos 양성 신경 세포)에 대한 임계 값을 정의했다.에 Fos 양성 신경 세포가 표시됩니다 그림 2에서 다른 실험 조건에서 파란색 사각형 모두 신선한 냉동 조직에 메스 암페타민 주입 쥐에서 비율에 Fos 양성 신경 세포는. (1.9-2.2 %가, 그림 2C 및 2D)이 공동으로 두 번했다(- 0.8 %, 그림 2A와 2B 0.7) 홈 케이지 쥐에 mpared. 표적 유전자 전 증폭 및 RT-PCR을 사용하여 FACS 분류 된 세포의 확인 세포 형 특정 유전자. 두 번째 단계에서, 후속의 mRNA의 주요 시료에서만에 Fos 양성 뉴런의 정렬되도록 분석에 Fos 음성 세포의 포함을 감소 렉-647 형광 액이 승온되도록 FOS를 단지 상부 2/3 파란색 사각형 양성 이벤트를 분류하고 수집 하였다. 이 임계 값이 적어도 10 배 샘플에서에 Fos 양성 신경 세포의 비율을 계산하기 위해 위에서 사용 된 임계 값보다 높은 형광 (셀 당 더 높은에 Fos 발현을). 세포의 네 집단이 NeuN 음성 +에 Fos 음 (~ 5000 건), NeuN 음성 +에 Fos 양성을 포함하는 하나의 조직 샘플에서 분류 (25 원거리 - 83 이벤트), NeuN 양성 +에 Fos-음수극상 (~ 5000 이벤트)와 NeuN 양성 +에 Fos 양성 (- 홈 그룹 (133) 이벤트 (185) - 메스 암페타민 그룹 (450) 이벤트 (44)였다). 첫째, (모두에 Fos 양성과에 Fos 음성 포함) 및 NeuN 음 인구 FOS (양성과에 Fos 음성 모두 포함) NeuN 양성 세포 형 특정 유전자의 발현이 확인되었다 (그림 3). GAPDH이었다 이전의 연구 (13)로부터의 결과에 기초하여, 기준 / 하우스 키핑 유전자로 사용된다. 상기 증폭 된 PCR 반응에서 cDNA를 시료에서 RNA의 상이한 레벨을 제어하기 위해, 이중 qPCR의 반응은 표적 유전자 및 GAPDH cDNA를 모두에 대한 프라이머를 사용하여 수행 하였다. GAPDH 하우스 키핑 유전자에 대한 CT 값은 정확한 측정을 위해 15, 31 사이를 유지했다. 모두 신선한 냉동 조직의 경우, NeuN mRNA 수준은 NeuN 음성 인구 (P &lt;0.05보다 NeuN 양성 인구 (약 8 배) 훨씬 더 컸다도 3A </stroNG&gt;; 가정 및 필로폰 그룹에서 결합 된 데이터). 반대로, 모두 신선한 냉동 조직 들면 GFAP (아교 세포 마커;도 3b) 및 Oligo2 (희소 돌기 아교 세포 마커도 3C) mRNA 수준이 NeuN 양성 인구 (p보다 NeuN 음성 인구 컸다 &lt;0.05 ). 높은 Iba1 유사한 경향 (소교 세포 마커도 3D) mRNA 수준은 NeuN 음성 인구 관찰하지만, 이것은 통계적으로 유의하지 않았다 하였다. 정확하게 특정 세포 유형에서 측정 할 수없는 특정의 mRNA의 매우 낮은 수준에 포함 된 일부 샘플 (예를 들어, NeuN 표지 된 신경 세포에서 GFAP의 mRNA). 코네티컷 최대 값을 정확하게 검출하기에 너무 낮았다 값을 제거 (35)로 정의 하였다. 코네티컷 높은 값은 우리의 qPCR 분석의 신뢰도 한계를 초과했다. FOS mRNA 발현이었다(그림 4) 메스 암페타민의 단일 주입받은 쥐에서 NeuN 양성 신경 세포의 인구 조사 하였다. 모두 신선한 냉동 조직의 경우,에 Fos의 mRNA 수준 (P &lt;0.05) FOS에 음성 뉴런보다 FOS에 양성 신경 세포에 큰했다. 또한, 동안 신선한 조직 FOS를 양성 신경 세포에 Fos의 mRNA의 3 배 증가, 냉동 조직 FOS를 양성 신경 세포에 Fos의 mRNA의 11 배 증가 검출되었다가 있었다. 함께 찍은, 이러한 mRNA의 결과는 FOS에 양성 신경 세포의 신원, 모두 신선한 냉동 조직 FOS를 음성 신경 세포와 비 신경 세포의 인구를 확인합니다. 또한, 세포 유형 특정 유전자와 관심의 다른 유전자도 신선한 냉동 조건 모두에서 분류 세포에서 분석 할 수 있습니다. <img alt="그림 1" src="/files/ftp_upload/54358/54358fig1.jpg" /> 지 그림 1. 게이팅신선하고 냉동 쥐 등쪽 선조체에서 sociated 및 레이블 세포. &#39;셀&#39;게이트 전방 및 측면 산란 특성 (AD)에 의해 결정 핵 DAPI 염색 (GH)와 긍정적 인 표시에 의해 확인되었다. &#39;세포&#39;인구 내에서 &#39;뉴런&#39;게이트 NeuN (; EF PE)에 대한 형광에 의해 결정되었다. (A - B) 세포 게이트 : 자신의 앞으로 산란 (X 축, 셀 크기) 및 측면 산란 (Y 축 단위)를 기반으로 모든 이벤트의 선형 플롯. (C - D) 단셀 게이트 : AB에 나타내는 셀 게이트 내의 전방 산란 높이 (Y 축) 및 폭 (X 축)의 선형 ​​플롯. (E는 - F) 신경 게이트 : CD에 도시 된 단일 세포 게이트 내의 PE 표지 NeuN (Y 축)에 대한 면역의 대수 플롯은 낮은 클러스터의 이벤트 및 비 신경 세포의 상단 클러스터의 뉴런을 보여준다. (G </stroNG&gt; - H) 핵 염색 : 신경 세포 게이트 내에서 DAPI 표지 핵 (Y 축)에 대한 형광의 대수 플롯. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54358/54358fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54358/54358fig2.jpg" /> 그림 2. NeuN과에 Fos에 대해 두 번 라벨을 바탕으로 신선하고 냉동 쥐 등쪽 선조체에서에 Fos 양성과에 Fos 음이 신경 세포의 게이팅. 한 후 자신의 홈 케이지 또는 90 분에서 직접 촬영 한 쥐에서 신선한 냉동 등쪽 선조체 ( 필로폰의 복강 내 주사)는 해리와 NeuN과에 Fos에 대한 직접 결합 항체로 표지와 FACS 기계를 사용하여 분류 하였다. 피코 에리 트린 (PE)에 따라 NeuN의 면역 형광 (X 축)와 알렉사 647 표지에 Fos의 immunofluo - 표지 된 정렬rescence (Y 축). FOS 양성 (블루 도트) 및 FOS 음 (레드 도트) 뉴런은 각각 상부 및 하부 우측 사분면에 위치 하였다. 도트 플롯 NeuN 양성 세포 (뉴런)와 NeuN 음성 세포 (회색 점) 표시; 파란색 사각형 위의 임계 값에 Fos 식 뉴런을 나타냅니다. (A - B) 홈 그룹 : 홈 케이지에서 직접 찍은 순진한 쥐. (C - D) 메스 암페타민 그룹 : 필로폰의 단일 주사를받은 쥐. 에 Fos 양성 뉴런의 임계 값은 단지 647-알렉사 형광 FOS (-IR)의 홈 케이지 대조군 NeuN 음성 세포 관찰 최대 위가되도록 선택 하였다. 모든 뉴런의 0.8 % 홈 그룹에 Fos 양성, 1.9 - - 0.7 있지만 모든 뉴런의 2.2 %가 필로폰 그룹에 Fos 양성이다. <img alt="그림 3" src="/files/ftp_upload/54358/54358fig3.jpg" /> 그림 3. </FOS (양성과에 Fos 음성) 강한&gt; 셀 타입의 특정 유전자 발현 신선한 및 냉동 쥐 등쪽 선조체의 세포를 FACS는 정렬 된. NeuN 양성 신경 세포를 FOS (양성과에 Fos 음성)와 NeuN 음성 세포를 분류했다 셀의 정렬을 확인하는 데 사용 된 바와 프로토콜 및 세포 형 특정 유전자의 mRNA 발현 수준을 사용. (A) NeuN는 신경 세포 마커이다. (B) GFAP는 아교 세포 마커이다. (C) Oligo2 마커 인 희소 돌기 아교 세포의 세포. (D) Iba1은 소교 세포 마커입니다. NeuN의 mRNA를 들어, 데이터는 SEM ± 신선한 조직에서 NeuN 음성 세포에서 발현 수준에 비해 배 값 (- 14 N = 9)의 평균으로 표시하고 있습니다. , Oligo2 (N = 9-11) - GFAP (12 N = 6)과 Iba1 (N = 5 - 8) mRNA의 데이터는 배 값의 ± SEM은 노이에서 발현 수준에 상대적으로 의미되게됩니다신선한 조직에서 N 양성 세포. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54358/54358fig3large.jpg" target="_blank">이 ​​그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/54358/54358fig4.jpg" /> 위의 프로토콜에 설명 FOS를 mRNA 수준이 확인되면서 메스 암페타민 주입.에 Fos 양성과에 Fos 음성 뉴런 후 신선한 또는 냉동 쥐 등쪽 선조체에서 FACS 정렬 된 뉴런의 그림 4에 Fos mRNA의 수준은 분류 하였다. 데이터는 신선한 조직 FOS를 음이 신경 세포에서 발현 수준에 비해 배 값 (- 4 N = 3)의 SEM ± 평균으로 표시하고 있습니다.

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

여기에서 우리는 신선한 냉동 모두 뇌 조직에서 신경 앙상블 별점이 발현 분자 변화를 연구하는 형광 활성화 된 셀 정렬 (FACS) 프로토콜을 제안한다. 동결 조직의 사용은 유용한 동물 피험자의 사용을 최대화하기 위해 다수의 세션을 통해 많은 뇌 영역의 FACS 분리 할 수​​있다.

형광 활성화 된 셀 정렬 (FACS)와 신선한 및 냉동 쥐 뇌 조직 FOS를 발현하는 신경 세포의 유전자 발현 분석

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

fluorescence-activated-cell-sorting-facs-gene-expression-analysis-fos

Nanyang Technological University

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

29.1K 조회수.  NIDA, NIH, DHHS.  여기에서 우리는 신선한 냉동 모두 뇌 조직에서 신경 앙상블 별점이 발현 분자 변화를 연구하는 형광 활성화 된 셀 정렬 (FACS) 프로토콜을 제안한다. 동결 조직의 사용은 유용한 동물 피험자의 사용을 최대화하기 위해 다수의 세션을 통해 많은 뇌 영역의 FACS 분리 할 수​​있다. 

비디오: Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh frozen brain sections. Our group has successfully used this approach to study gene co-regulation. More specifically, we have used this dFISH method to explore the anatomical organization, neurochemical properties, and the impact of sensory experience in central sensory circuits, at single cell resolution. This protocol has been validated in brain tissue from mice, rats and songbirds but is expected to be easily adaptable to other vertebrate species, as well as to an array of non-neural tissues. In this film we provide a detailed demonstration of the main steps of this procedure.

Double Fluorescence in situ Hybridization in Fresh Brain Sections

This protocol involves a non-radioactive in-situ hybridization procedure that enables the simultaneous identification of two transcript species, at a single cell resolution, in thin sections of the vertebrate brain.

더블 형광 현장에서</em신선한 두뇌 섹션> 하이브 리다이 제이션

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

연구

신경과학

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to the display of physiological and behavioural phenotypes. Such environmental programming is likely to increase the susceptibility to metabolic, cardiovascular and mental diseases 3,4.
DNA methylation and histone modifications are considered key processes in the mediation of the gene-environment dialogue and appear also to underlay environmental programming 5. In mammals, DNA methylation typically comprises the covalent addition of a methyl group at the 5-position of cytosine within the context of CpG dinucleotides.
CpG methylation occurs in a highly tissue- and cell-specific manner making it a challenge to study discrete, small regions of the brain where cellular heterogeneity is high and tissue quantity limited. Moreover, because gene expression and methylation are closely linked events, increased value can be gained by comparing both parameters in the same sample.
Here, a step-by-step protocol (Figure 1) for the investigation of epigenetic programming in the brain is presented using the 'maternal separation' paradigm of early life adversity for illustrative purposes. The protocol describes the preparation of micropunches from differentially-aged mouse brains from which DNA and RNA can be simultaneously isolated, thus allowing DNA methylation and gene expression analyses in the same sample.

A streamlined workflow to study DNA methylation and gene expression changes upon early-life stress is shown. Starting from maternal separation of newborn mice and isolation of discrete brain tissues, we represent a protocol to simultaneously isolate DNA and RNA from brain tissue punches for subsequent bisulfite sequencing and RT-PCR analysis.

뇌의 작은, 해부학적인 몸의 구조 정의 분야의 DNA Methylation과 유전자 발현의 최적화 분석

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the intestine and lower urinary tract. Both during development and in mature tissues these cells are often widely dispersed throughout tissues so that isolation of discrete populations using methods like laser capture micro-dissection is difficult. They can however be directly visualized by expression of fluorescent reporters driven from regulatory regions of neuron-specific genes like Tyrosine hydroxylase (TH). We describe a method optimized for high yields of viable TH+ neuronal progenitors from fetal mouse visceral tissues, including intestine and lower urogenital tract (LUT), based on dissociation and fluorescence-activated cell sorting (FACS). 
The Th gene encodes the rate-limiting enzyme for production of catecholamines. Enteric neuronal progenitors begin to express TH during their migration in the fetal intestine1 and TH is also present in a subset of adult pelvic ganglia neurons2-4 . The first appearance of this lineage and the distribution of these neurons in other aspects of the LUT, and their isolation has not been described. Neuronal progenitors expressing TH can be readily visualized by expression of EGFP in mice carrying the transgene construct Tg(Th-EGFP)DJ76Gsat/Mmnc1. We imaged expression of this transgene in fetal mice to document the distribution of TH+ cells in the developing LUT at 15.5 days post coitus (dpc), designating the morning of plug detection as 0.5 dpc, and observed that a subset of neuronal progenitors in the coalescing pelvic ganglia express EGFP. 
To isolate LUT TH+ neuronal progenitors, we optimized methods that were initially used to purify neural crest stem cells from fetal mouse intestine2-6. Prior efforts to isolate NC-derived populations relied upon digestion with a cocktail of collagenase and trypsin to obtain cell suspensions for flow cytometry. In our hands these methods produced cell suspensions from the LUT with relatively low viability. Given the already low incidence of neuronal progenitors in fetal LUT tissues, we set out to optimize dissociation methods such that cell survival in the final dissociates would be increased. We determined that gentle dissociation in Accumax (Innovative Cell Technologies, Inc), manual filtering, and flow sorting at low pressures allowed us to achieve consistently greater survival (&gt;70% of total cells) with subsequent yields of neuronal progenitors sufficient for downstream analysis. The method we describe can be broadly applied to isolate a variety of neuronal populations from either fetal or adult murine tissues.

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An optimized procedure to purify neural crest-derived neuronal progenitors from fetal mouse tissues is described. This method takes advantage of expression from fluorescent reporter alleles to isolate discrete populations by fluorescence-activated cell sorting (FACS). The technique can be applied to isolate neuronal subpopulations throughout development or from adult tissues.

태아 쥐의 내장 장기에서 자율 신경 Progenitors의 형광 - 활성 셀 정렬 (FACS) 절연을위한 최적화된 절차

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that is critical for learning, memory and executive function.1,2 Hence our studies focus on gene expression analysis of specific neuronal populations in distinct subregions of the hippocampus. The technique of laser capture microdissection (LCM), introduced in 1996 by Emmert-Buck, et al.,3 has allowed for significant advances in gene expression analysis of single cells and enriched populations of cells from heterogeneous tissues such as the mammalian brain that contains thousands of functional cell types.4 We use LCM and a well established rat model of traumatic brain injury (TBI) to investigate the molecular mechanisms that underlie the pathogenesis of TBI. Following fluid-percussion TBI, brains are removed at pre-determined times post-injury, immediately frozen on dry ice, and prepared for sectioning in a cryostat. The rat brains can be embedded in OCT and sectioned immediately, or stored several months at -80 &deg;C before sectioning for laser capture microdissection. Additionally, we use LCM to study the effects of TBI on circadian rhythms. For this, we capture neurons from the suprachiasmatic nuclei that contain the master clock of the mammalian brain. Here, we demonstrate the use of LCM to obtain single identified neurons (injured and degenerating, Fluoro-Jade-positive, or uninjured, Fluoro-Jade-negative) and enriched populations of hippocampal neurons for subsequent gene expression analysis by real time PCR and/or whole-genome microarrays. These LCM-enabled studies have revealed that the selective vulnerability of anatomically distinct regions of the rat hippocampus are reflected in the different gene expression profiles of different populations of neurons obtained by LCM from these distinct regions. The results from our single-cell studies, where we compare the transcriptional profiles of dying and adjacent surviving hippocampal neurons, suggest the existence of a cell survival rheostat that regulates cell death and survival after TBI.

We describe how to use laser capture microdissection (LCM) to obtain enriched populations of hippocampal neurons or single neurons from frozen sections of the injured rat brain for subsequent gene expression analysis using quantitative real time PCR and/or whole-genome microarrays.

외상성 뇌 손상 후 뉴런 또는 유전자 발현 분석을위한 단일 뉴런의 강화 인구의 레이저 캡처 Microdissection

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome wide analysis of differentially expressed transcripts after such an experimental manipulation has the potential to uncover an almost complete picture of the downstream effects caused by the transfected construct. This work describes a simple method for comparing transcriptomes from samples of transfected embryonic spinal cords comprising all steps between electroporation and identification of differentially expressed transcripts. The first stage consists of guidelines for electroporation and instructions for dissection of transfected spinal cord halves from HH23 embryos in ribonuclease-free environment and extraction of high-quality RNA samples suitable for transcriptome sequencing. The next stage is that of bioinformatic analysis with general guidelines for filtering and comparison of RNA-Seq datasets in the Galaxy public server, which eliminates the need of a local computational structure for small to medium scale experiments. The representative results show that the dissection methods generate high quality RNA samples and that the transcriptomes obtained from two control samples are essentially the same, an important requirement for detection of differential expression genes in experimental samples. Furthermore, one example is provided where experimental overexpression of a DNA construct can be visually verified after comparison with control samples. The application of this method may be a powerful tool to facilitate new discoveries on the function of neural factors involved in spinal cord early development.

This video shows the basic steps for performing whole transcriptome analysis on dissected chick embryonic spinal cord samples after transfection with in ovo electroporation.

electroporation하여 병아리 배아 척수에서 차동 유전자 발현의 RNA-SEQ 분석

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective treatment for several movement disorders that have failed to respond to medication. Recent progress in the field of DBS surgery has begun to extend the application of this surgical technique to other conditions as diverse as morbid obesity, depression and obsessive compulsive disorder. Despite these expanding indications, little is known about the underlying physiological mechanisms that facilitate the beneficial effects of DBS surgery. One approach to this question is to perform gene expression analysis in neurons that receive the electrical stimulation. Previous studies have shown that neurogenesis in the rat dentate gyrus is elicited in DBS targeting of the anterior nucleus of the thalamus1. DBS surgery targeting the ATN is used widely for treatment refractory epilepsy. It is thus of much interest for us to explore the transcriptional changes induced by electrically stimulating the ATN. In this manuscript, we describe our methodologies for stereotactically-guided DBS surgery targeting the ATN in adult male Wistar rats. We also discuss the subsequent steps for tissue dissection, RNA isolation, cDNA preparation and quantitative RT-PCR for measuring gene expression changes. This method could be applied and modified for stimulating the basal ganglia and other regions of the brain commonly clinically targeted. The gene expression study described here assumes a candidate target gene approach for discovering molecular players that could be directing the mechanism for DBS.

The mechanism underlying the therapeutic effects of Deep Brain Stimulation (DBS) surgery needs investigation. The methods presented in this manuscript describe an experimental approach to examine the cellular events triggered by DBS by analyzing the gene expression profile of candidate genes that can facilitate neurogenesis post DBS surgery.

전방 시상 핵의 깊은 뇌 자극 후 쥐 해마의 유전자 발현 변화 분석

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant cell type in the brain, neurons are the most widely studied of these cell types given their direct role in impacting behaviors. Other cell types in the brain also impact neuronal function and behavior via the signaling molecules they produce. Neuroscientists must understand the interactions between the cell types in the brain to better understand how these interactions impact neural function and disease. To date, the most common method of analyzing protein or gene expression utilizes the homogenization of whole tissue samples, usually with blood, and without regard for cell type. This approach is an informative approach for examining general changes in gene or protein expression that may influence neural function and behavior; however, this method of analysis does not lend itself to a greater understanding of cell-type-specific gene expression and the effect of cell-to-cell communication on neural function. Analysis of behavioral epigenetics has been an area of growing focus which examines how modifications of the deoxyribonucleic acid (DNA) structure impact long-term gene expression and behavior; however, this information may only be relevant if analyzed in a cell-type-specific manner given the differential lineage and thus epigenetic markers that may be present on certain genes of individual neural cell types. The Fluorescence Activated Cell Sorting (FACS) technique described below provides a simple and effective way to isolate individual neural cells for the subsequent analysis of gene expression, protein expression, or epigenetic modifications of DNA. This technique can also be modified to isolate more specific neural cell types in the brain for subsequent cell-type-specific analysis.

The goal of this protocol is to use the fluorescence activated cell sorting (FACS) technique to sort specific types of neural cells for subsequent analysis of cell-type-specific gene expression, epigenetic markers, and or protein expression.

쥐 뇌 조직 검사 정렬 형광 활성 셀을 사용하여 셀 타입 별 유전자 발현

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic strategies that hold the promise to enhance brain drug delivery, improve brain protection, and treat brain disorders. However, studying the human blood-brain barrier function is challenging. Thus, there is a critical need for appropriate models. In this regard, brain capillaries isolated from human brain tissue represent a unique tool to study barrier function as close to the human in vivo situation as possible. Here, we describe an optimized protocol to isolate capillaries from human brain tissue at a high yield and with consistent quality and purity. Capillaries are isolated from fresh human brain tissue using mechanical homogenization, density-gradient centrifugation, and filtration. After the isolation, the human brain capillaries can be used for various applications including leakage assays, live cell imaging, and immune-based assays to study protein expression and function, enzyme activity, or intracellular signaling. Isolated human brain capillaries are a unique model to elucidate the regulation of the human blood-brain barrier function. This model can provide insights into central nervous system (CNS) pathogenesis, which will help the development of therapeutic strategies for treating CNS disorders.

Isolated brain capillaries from human brain tissue can be used as a preclinical model to study barrier function under physiological and pathophysiological conditions. Here, we present an optimized protocol to isolate brain capillaries from fresh human brain tissue.

신선한 인간의 뇌 조직에서 뇌 모세 혈관의 절연

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

신선한 냉동 인간 조직에서 장의 중추의 격리에 대 한 레이저 캡처 서의 최적화

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Primary Cell Culture of Purified GABAergic or Glutamatergic Neurons Established through Fluorescence-activated Cell Sorting

The overall goal of this protocol is to generate purified neuronal cultures derived from either GABAergic or glutamatergic neurons. Purified neurons can be cultured in defined media for 16 days in vitro and are amenable to any analyses typically performed on dissociated cultures, including electrophysiological, morphological and survival analyses. The major advantage of these cultures is that specific cell types can be selectively studied in the absence of complex external influences, such as those arising from glial cells or other neuron types. When planning experiments with purified cells, however, it is important to note that neurons strongly depend on glia-conditioned media for their growth and survival. In addition, glutamatergic neurons further depend on glia-secreted factors for the establishment of synaptic transmission. We therefore also describe a method for co-culturing neurons and glial cells in a non-contact arrangement. Using these methods, we have identified major differences between the development of GABAergic and glutamatergic neuronal networks. Thus, studying cultures of purified neurons has great potential for furthering our understanding of how the nervous system develops and functions. Moreover, purified cultures may be useful for investigating the direct action of pharmacological agents, growth factors or for exploring the consequences of genetic manipulations on specific cell types. As more and more transgenic animals become available, labeling additional specific cell types of interest, we expect that the protocols described here will grow in their applicability and potential.

This protocol describes a cell sorting based method for the purification and culture of fluorescent GABAergic or glutamatergic neurons from the neocortex and hippocampus of postnatal mice or rats.

형광 활성 세포 선별을 통해 확립 된 정제 GABAergic 또는 Glutamatergic 뉴런의 일차 세포 배양

The overall goal of this protocol is to generate purified neuronal cultures derived from either GABAergic or glutamatergic neurons. Purified neurons can ...