This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

<ol>
	<li>Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+global+map+of+human+brucellosis.">The new global map of human brucellosis.</a> Lancet Infect Dis. 6, 91-99 (2006).</li><li>Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+human+pathogenic+Brucella+species+with+their+hosts.">Interactions of the human pathogenic Brucella species with their hosts.</a> Annu Rev Microbiol. 65, 523-541 (2011).</li><li>Guzman-Verri, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTPases+of+the+Rho+subfamily+are+required+for+Brucella+abortus+internalization+in+nonprofessional+phagocytes:+direct+activation+of+Cdc42.">GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42.</a> J Biol Chem. 276, 44435-44443 (2001).</li><li>Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+intracellular+replication+requires+trafficking+through+the+late+endosomal/lysosomal+compartment.">Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment.</a> Traffic. 9, 678-694 (2008).</li><li>Boschiroli, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brucella+suis+virB+operon+is+induced+intracellularly+in+macrophages.">The Brucella suis virB operon is induced intracellularly in macrophages.</a> Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).</li><li>Celli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+evades+macrophage+killing+via+VirB-dependent+sustained+interactions+with+the+endoplasmic+reticulum.">Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.</a> J Exp Med. 198, 545-556 (2003).</li><li>Porte, F., Liautard, J. P., Kohler, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acidification+of+phagosomes+containing+Brucella+suis+is+essential+for+intracellular+survival+in+murine+macrophages.">Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages.</a> Infect Immun. 67, 4041-4047 (1999).</li><li>Anderson, T. D., Cheville, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+morphometric+analysis+of+Brucella+abortus-infected+trophoblasts+in+experimental+placentitis.+Bacterial+replication+occurs+in+rough+endoplasmic+reticulum.">Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum.</a> Am J Pathol. 124, 226-237 (1986).</li><li>Qin, Q. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screen+of+endoplasmic+reticulum-associated+host+factors+reveals+a+role+for+IRE1alpha+in+supporting+Brucella+replication.">RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication.</a> PLoS Pathog. 4, e1000110 (2008).</li><li>Ramo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+analysis+of+large-scale+RNAi+screens+for+pathogen+entry.">Simultaneous analysis of large-scale RNAi screens for pathogen entry.</a> BMC genomics. 15, 1162 (2014).</li><li>Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+InlC+secretion+to+investigate+cellular+infection+by+the+bacterial+pathogen+Listeria+monocytogenes.">Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes.</a> J Vis Exp. , e51043 (2013).</li><li>Kentner, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shigella+reroutes+host+cell+central+metabolism+to+obtain+high-flux+nutrient+supply+for+vigorous+intracellular+growth.">Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth.</a> Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).</li><li>Celli, J., Salcedo, S. P., Gorvel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+coopts+the+small+GTPase+Sar1+for+intracellular+replication.">Brucella coopts the small GTPase Sar1 for intracellular replication.</a> Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).</li><li>von Bargen, K., Gorvel, J. P., Salcedo, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+affairs:+investigating+the+Brucella+intracellular+lifestyle.">Internal affairs: investigating the Brucella intracellular lifestyle.</a> FEMS microbiology reviews. 36, 533-562 (2012).</li><li>Kamentsky, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+structure,+function+and+compatibility+for+CellProfiler:+modular+high-throughput+image+analysis+software.">Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software.</a> Bioinformatics. 27, 1179-1180 (2011).</li></ol>

The authors declare no conflicts of interest.

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellular homeostasis. A common strategy to identify the host cell factors involved in an infection process on a genome scale is the use of systematic gene depletion for example by siRNAs coupled to a functional readout of infection. Here we present protocols suitable for high-content, high-throughput screening based on detection of fluorescent bacteria.
An important aspect of successful large-scale screening involves a robust automated image analysis and infection scoring. The methods described here rely on the detection of a cell nucleus by DAPI staining which is generally very robust, and the definition of an area of interest where the pathogen signal is measured. The endpoint assay makes use of the detection of proliferating bacteria in the peri-nucleus, nucleus, and Voronoi cell body. This allows reliable identification of the infected cells. Furthermore, it allows defining different thresholds for the individual compartments. While the thresholds can be set relatively low in the nucleus and peri-nucleus, higher thresholds should be employed for the Voronoi cell body. This helps to avoid the detection of GFP signal from neighboring cells which is important since the endpoint assay lasts for five days during which HeLa cells have proliferated and grown to confluency.
The entry assay in contrast only lasts for three days and HeLa cells have thus not grown to confluency. Here, only a Voronoi cell body is chosen as cellular object for three main reasons. First, early during infection some bacteria might not yet have reached the nuclear or peri-nuclear area and may not be detected by measurements within these objects. Second, in contrast to the endpoint assay, bacteria have not started intracellular replication. Thus, using the Voronoi cell body object avoids missing individual bacteria which are located further away from the nucleus. Third, the entry assay makes use of quantification of the bacterial load which makes it desirable to cover as many bacteria as possible, which is more reliably achieved by using a Voronoi cell body compared to a peri-nucleus.
In the entry assay, the dsRed fluorescent marker which is constitutively expressed in all bacteria is not directly used for infection scoring. However, it serves as important quality control. Visual inspection of images gives a good indication whether bacteria that are distant from any nucleus and thus outside cells show no or only very weak GFP signal compared to bacteria in close proximity of a nucleus, indicative of an intracellular location. This is an important control to ensure that induction of GFP by aTc as well as inactivation of extracellular bacteria by Gm was efficient. Here, it has to be considered that in the absence of aTc bacteria express very low levels of GFP. In addition, extracellular bacteria (red signal and no/weak GFP signal) that overlap with a HeLa cell body can provide further information. In this case, bacteria could either be bound to the cell surface or they were internalized but failed to induce the GFP signal, indicative of very rapid killing of bacteria inside a host cell. These hypotheses can then be further tested with alternative assays such as counting of colony forming units (CFU) on TSA plates.
A further advantage of using a tetracycline inducible system over differential antibody staining to visualize intracellular bacteria is its applicability for live cell imaging. Depletion of host factors potentially affects various stages of the infection process which can be resolved by quantifying the dynamics of intracellular stages. To this end, the tetracycline inducible system can be used with live cell imaging to measure the onset of replication or to provide the information of the percentage of intracellular bacteria that initiate replication. 
While the protocol described here is tailored for the use of siRNAs it can be easily adapted to other screening strategies, such as CRISPR-Cas9, small hairpin RNA (shRNAs), and chemical library screening. This would only require basic experimental modifications whereas the image analysis pipeline can be used directly regardless of the screening strategy. Moreover, the assay design is not restricted to Brucella and is readily adapted to other intracellular pathogens10. As such, this protocol is widely applicable for screening host factors involved in pathogen mediated-infection of host cells.

브루셀라 종은 α-프로 테오 박테리아의 클래스에 속하는 그람 음성, 통성 세포 내 병원균이다. 그들은 이러한 풍토 지역에서 심각한 경제적 손실을 초래 소, 염소, 또는 양 등 자연 호스트에서 낙태와 불임의 원인. 브루셀라 병은 전 세계적으로 매년 50 만 새로운 인간 감염 1 위에 일으키는 가장 중요한 인수 공통 질병 중 하나입니다. 인간에 ​​전송 가장 일반적으로 이러한 저온 살균하지 않은 우유로 감염된 동물과 직접 접촉하거나 오염 된 음식의 섭취에 의해 발생합니다. 열성 질환의 증상은 브루셀라 병의 진단에 어려움이 발생하는 불특정입니다. 처리되지 않은 경우, 환자는 관절염, 심내막염, 및 신경 병증이 같은 더 심각한 증상으로 만성 감염을 개발할 수 있습니다. 세포 수준에서 브루셀라 식세포는 비 식세포에 침입 할 수 있으며, 세포 내에서 복제브루셀라 함유 공포 (BCV)라고 함. 박테리아의 내면화는 라 세미,의 Rho와 Cdc42 3의 직접적인 활성화에 의해 액틴 세포 골격의 재 배열이 필요합니다. 진핵 숙주 세포 내부에서 BCV는 세포 내 이입 경로를 따라 트래 피킹과 리소좀과의 상호 작용에도 불구하고, 세균 분해 4 않도록 관리한다. 소낭 ATPase에 의해 BCV의 산성화가 박테리아 타입 IV 분비 시스템 (T4SS) (5)의 발현을 유도 할 필요가있다. 브루셀라는 복제 성 틈새 시장을 확립하기위한 T4SS 분비 세균 이펙터는 세포 내 틈새 시장 (7)의 설립의 결함에 T4SS 6의 삭제 또는 기공을 ATP 아제 리드의 억제 때문에, 필수적인 것으로 생각된다. 박테리아는 그들이 때까지 인신 매매의 단계에서 복제되지 않는다 응급실에서 파생 된 액포 실 (8)에 도달한다. 세포 증식이 발생되면, BCV는 CL에서 발견이러한 calnexin 및 글루코스 -6- 인산 (6)와 같은 ER 마커 OSE 협회. 브루셀라는 ER-같은 구획, 세포를 입력 리소좀 저하를 방지하고, 마지막으로 복제하는 분자 메커니즘은 크게 알려지지 않은 남아있다. 감염의 여러 단계에 관여하는 호스트 요소는 주로 대상으로 접근 또는 초파리 세포 (9)에서 수행되는 작은 규모의 작은 간섭 RNA (siRNA를) 스크린에 의해 확인되었다. 다음은 브루셀라 감염시 개별 호스트 요인의 기여에 광명을 비춰했지만 우리는 전체 과정의 포괄적 인 이해에서 멀리 아직도이다. 여기서, 자동 폭 필드 형광 현미경 및 자동화 된 이미지 분석과 함께 대규모 RNA 간섭 (RNAi의) 검사를 사용하여 인간 숙주 인자의 식별을 허용 프로토콜이 제시된다. HeLa 세포의 뒷면의 siRNA로 형질 describ 수행에드 이전 10, 11 약간의 수정과. 엔드 포인트 분석은 상기 출구와 인접 셀의 감염을 제외한 브루셀라 세포 수명의 많은 부분을 포함한다. 상기 엔드 분석에서 확인 된 히트를 특성화하기 위해, 감염의 초기 단계에 관여하는 인자들을 확인하는 변형 프로토콜이 사용된다. 구조적 GFP를 발현하는 브루셀라 아 보르 투스 균주 박테리아 이틀 동안 세포를 감염시킬 수있는 엔드 포인트 분석에 사용된다. 이 기간 동안, 박테리아는 ER-파생 된 복제 성 틈새 시장 세포, 트래픽을 입력하고 요정 핵 공간에 복제합니다. GFP 신호의 하이 레벨은 안정적으로 복제 박테리아를 포함 개별 셀을 검출 할 수있다. 고 처리량 분석에 브루셀라 항목을 연구하기 위해, 세포 내 및 세포 외 박테리아를 구별 할 수있는 것이 중요하다. 이 방법은 여기 circumv 제시세포 내 및 세포 외 박테리아의 엔트 차 항체 염색. 그것은을 DsRed의 구성 성 발현과 함께 테트라 사이클린 - 유도 GFP를 발현하는 브루셀라 변형에 기초한다. 구성 적을 DsRed 마커의 존재는 샘플에 존재하는 모든 균을 식별 할 수있다. GFP 발현 젠타 의해 동시에 세포 외 박테리아의 불 활성화와 함께 무독성 테트라 사이클린 유사체 anhydrotetracycline (ATC)의 첨가 (GM)에 의해 유도된다. 셀 배리어 성 항생제 GM은 세포 외 박테리아를 죽이고 있지만, ATC는 숙주 세포를 선택하고 박테리아 세포 내에서 선택적으로 GFP 발현을 유도 할 수있다. 이 듀얼 기자는 넓은 필드 현미경을 사용하여 세포 외 박테리아 (만을 DsRed 신호)에서 단일 세포 내 세균 (GFP 및을 DsRed 신호)의 강력한 분리 할 수​​ 있습니다. 세포 브루셀라 의해 검출 GFP 발현에 도달하기 위해 우리는 ATC에 의해 유도 4 시간이 RELI 초래한다는 발견수 신호. 선택적으로 세포 내 세균에 GFP를 표현하는 유사 유도 방식은 세포 내 시겔 (12)을 연구하기 위해 이전에 사용되었습니다.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Agar (TSA)</td>
			<td style="width:71px;">BD</td>
			<td style="width:119px;">236950</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Broth (TSB)</td>
			<td style="width:71px;">Fluka</td>
			<td style="width:119px;">22092</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kanamycin sulfate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">60615</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Skim milk</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">250 ml screw cap bottle</td>
			<td style="width:71px;">Corning</td>
			<td style="width:119px;">8396</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D5796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Calf Serum (FCS)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">10270</td>
			<td style="width:167px;">Heat-inactivated</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.5%)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">15400-054</td>
			<td style="width:167px;">10x stock solution, dilute 1:10 in PBS</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scepte 2.0 Cell Counter</td>
			<td style="width:71px;">Merck Milipore</td>
			<td style="width:119px;">PHCC20060</td>
			<td style="width:167px;">Alternative cell counting devices can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Greiner CELLSTAR 384-well plate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">M2062</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Peelable aluminum foil</td>
			<td style="width:71px;">Costar</td>
			<td style="width:119px;">6570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Reagent dispenser: &#34;Multidrop 384 Reagent Dispenser&#34;</td>
			<td style="width:71px;">Thermo Scientific</td>
			<td style="width:119px;">5840150</td>
			<td style="width:167px;">Alternative reagent dispenser can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Transfection reagent: &#34;Lipofectamine RNAiMAX</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">13778-150</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="252">
			<td height="252" style="height:252px;width:216px;">Automated plate washer: &#34;Plate washer ELx50-16&#34;</td>
			<td style="width:71px;">BioTek</td>
			<td style="width:119px;">ELX5016</td>
			<td style="width:167px;">This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Gentamicin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">G1397</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Anhydrotetracycline hydrochloride</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">37919</td>
			<td style="width:167px;">100 ug/ml solution in 100% ethanol is kept at -20&#176;C protected from light in aluminum-foil</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">20012</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6148</td>
			<td style="width:167px;">Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20&#176;C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3375</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9284</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DAPI</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">10236276001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scrambled siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">D-001810-10</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kif11 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-003317-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ARPC3 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-005284-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Brucella abortus 2308</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:216px;">pJC43 (apHT::GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Celli et al.12</td>
		</tr>
		<tr height="277">
			<td height="277" style="height:277px;width:216px;">pAC042.08 (apht::dsRed, tetO::tetR-GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC090</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC092</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HeLa CCL-2</td>
			<td style="width:71px;">ATCC</td>
			<td style="width:119px;">CCL-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="231">
			<td height="231" style="height:231px;width:216px;">ImageXpress Micro</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">IXM IMAGING MSCOPE</td>
			<td style="width:167px;">Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">High-Speed Laser Auto-Focus</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1037</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFI Super Fluor 10x objective</td>
			<td style="width:71px;">Nikon&#160;</td>
			<td style="width:119px;">MRF00100</td>
			<td style="width:167px;">N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Photometrics CoolSNAP HQ Monochrome CCD Camera</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1060</td>
			<td style="width:167px;">1392 x 1040 imaging pixels, 6.45 x 6.45-&#181;m pixels, 12 bits digitization</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">MetaXpress software</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">9500-0100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">LUI-Spectra-X-7</td>
			<td style="width:71px;">Lumencor</td>
			<td style="width:119px;">SPECTRA X V-XXX-YZ</td>
			<td style="width:167px;">Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-377/50-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-447/60-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF409-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-472/30-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-520/35-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF495-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-562/40-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-624/40-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF593-Di03-25x36</td>
			<td></td>
		</tr>
	</tbody>
</table>

microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells

브루셀라 종은 자연 호스트로 동물을 감염 통성 세포 내 병원균이다. 인간에게 전송은 가장 일반적으로 감염된 동물과 직접 접촉하거나 오염 된 음식의 섭취에 의해 발생되고 심한 만성 감염으로 이어질 수 있습니다. 브루셀라 전문 및 비 전문 식세포의 세포 침입과 소포체 (ER) 유래 액포 내에서 복제 할 수 있습니다. 응급실과 같은 구획 브루셀라 숙주 세포에 진입, 리소좀 분해 회피 및 복제에 필요한 숙주 요인은 거의 알려져 남아있다. 여기에서 우리는 HeLa 세포에서 브루셀라 항목 및 복제에 관련된 호스트 요인을 파악하기 위해이 분석에 대해 설명합니다. 다른 검사 방법을 적용 할 수 있지만 프로토콜은 RNA 간섭의 사용을 설명한다. 분석법은 형광 표지 된 세균의 검출에 사용 자동 형광 표지 된 숙주 세포에 기초와이드 필드 현미경. 형광 이미지는 단일 셀 기반 감염 득점을 허용 CellProfiler에서 표준 이미지 분석 파이프 라인을 이용하여 분석한다. 엔드 분석에서, 세포 내 복제 이틀 감염 후 측정한다. 이 확산 성공적으로 이렇게 강하게 숙주 세포 내에서 증식 할 것이다 세포 내 틈새를 설립 세균 항목입니다. 브루셀라 후 12 시간의 주위에 시작되는 자신의 복제 성 틈새 트래픽에 박테리아를 할 수 있습니다. 세포 내 박테리아가 크게 개별 세포 또는 세포 비 - 복제 성 박테리아를 능가하기 때문에, 구조적으로 GFP를 발현하는 균주를 사용할 수있다. 강한 GFP 신호는 감염된 세포를 식별하기 위해 사용된다. 대조적으로, 엔트리 분석을 위해 세포 내 및 세포 외 박테리아를 구별하는 것이 필수적이다. 여기에서, 테트라 사이클린 - 유도 GFP에 대한 변형 부호화가 사용된다. 유도겐타 마이신에 의한 세포 외 박테리아의 불 활성화와 동시에 GFP의 세포 내 박테리아 GFP를 발현 할 수있는 함께 세포 및 GFP 신호에 기초하여 박테리아 세포의 분화를 가능하게한다. 세포 내 증식이 시작되기 전에이 단일 세포 내 박테리아의 강력한 탐지 할 수 있습니다.

도 1a는 자동으로 엔드 분석에서 감염된 세포를 식별하는 데 사용되는 이미지 분석의 일례를 나타낸다. DAPI 염색 HeLa 세포의 핵이 확인되었고, 25 픽셀 핵 연장하여 핵 주위 8 화소의 폭 조갑 핵 및 보로 노이 셀 바디를 산출 하였다. 박테리아가 주로 조갑 핵 공간 확산 때문에, 셀이 영역에서 강도 GFP 감염 및 비감염 세포를 구별 할 수있는 가장 강력한 측정이다. 일부 경우에 세균이 핵으로 큰 정도에 조갑 핵 또는 오버레이 외부 증식 발견된다. 따라서, 두 개의 추가 오브젝트는 감염된 세포의 식별을 고려 하였다. 분할뿐만 아니라 GFP 강도 측정은 화상 해석 소프트웨어 CellProfiler이 수행되었다. 브루셀라 <str옹&gt; 숙주 세포 3의 성공적인 침략을위한 굴지의 재 배열이 필요합니다. 따라서, 굴지 리모델링 구성 요소의 고​​갈 siRNA의 검사에 적합한 양성 대조군이다. 우리는 액틴의 중합에 관여하는 Arp2 / 3 복잡한 구성 요소의 siRNA를 매개 고갈이 강하게 HeLa 세포의 브루셀라 감염 (게시되지 않은 데이터)를 억제하는 것으로 나타났습니다. 따라서 ARPC3의 최저는 양성 대조군으로 사용 하였다. 도 1b에 도시 된 바와 같이, ARPC3 고갈은 박테리아 감염 후 이틀 보여 증식 세포 수를 감소시켰다. 이러한 이미지에 자동 이미지 분석 파이프 라인을 적용하는 것은 관찰 된 효과 (그림 1C)의 정량을 허용했다. 여기에 도시 된 데이터는 게놈 전체의 siRNA 화면 대조군 웰에서 발생. Z 점수는 플레이트에 플레이트 변동을 고려하기 위해 적용 하였다. 도 2a는 I를 도시마법사 분석은 감염된 세포를 식별하고, 엔트리 분석에서 세포 내 세균 부하를 측정하기 위해 사용된다. 엔드 분석과는 대조적으로, 엔트리 분석은 박테리아 세포 분할 및 객체로서 보로 노이 셀 체를 사용한다. 브루셀라 만 세포의 GFP 신호는 세그먼트 이미지 분석 파이프 라인 병원균을 사용 하였다. 세포 내 박테리아는 2 픽셀의 최소 크기 및 세포 외 박테리아의 희미 GFP 배경 강도를 초과하는 GFP 강도로 정의 하였다. 적어도 하나의 세포 내 박테리아의 객체가 보로 노이 셀 체와 중첩하는 경우 셀 감염된 여겨졌다. 또한, 세균 부하는 세포 내 세균에 의해 덮여 감염된 세포의 평균 면적을 계산에 의해 추정 하였다. 종점 분석법으로서, ARPC3 고갈은 콘으로 처리 된 세포와 비교하여, 엔트리의 분석 브루셀라 감염의 감소를 보였다트롤의 siRNA (그림 2B). 감염률 정량 감염된 세포 (도 2C)과 감염된 세포 (도 2D)에 세포 내 균수의 수가 고갈 ARPC3 감소되었음을 확인 하였다. <img alt="그림 1" src="/files/ftp_upload/54263/54263fig1.jpg" /> 도 1 : HeLa 세포 분석 B. 감염 엔드 분석에서 GFP 발현 보르 투스 (a)는 엔드 포인트 분석 :. 형광 이미지 (DAPI 스케일 바 = 50㎛의 염색 GFP 블루 = 핵 발현 보르 투스 녹색 = B.) 엔드 포인트 분석의 일례를 도시. GFP B. 표현 보르 투스는 GM의에 의해 세포 외 박테리아 죽이는 다음 4 시간 동안 헬라 세포를 입력하는 것이 허용되었다. 40 시간 허용 박테리아 또한 배양는 HeLa 세포 내에서 복제합니다. 자동 이미지 analysi<html> S가하십시오 CellProfiler 파이프 라인은 조갑 핵 계산 하였다 세그먼트 DAPI 염색 핵으로 사용되었다 (비 중첩 (8) 핵을 둘러싸는 픽셀 링) 및 보로 노이 셀 본체 (겹치지 25 픽셀 핵의 직경 확장) 모두 빨간색으로 표시. 적어도 하나의 세포 구획 (핵, 조갑 핵 보로 노이 셀 본체)에 통합 GFP 강도가 해당 임계 값을 초과하는 경우 전지 감염된 여겨졌다. (B) (B)에 감염된 HeLa 세포의 대표적인 이미지 보르 투스는 감염 후 GFP 44 시간을 표현. 세포 하나 스크램블 (비 대상) siRNA를 제어 또는 ARPC3을 대상으로 siRNA를 형질 감염시켰다. 스케일 바는 50 μm의 =. ARPC3 고갈 HeLa 세포의 감염 (C) 부량. 데이터는 막대 그래프로 표시됩니다 (Z는 정규화 점수, 평균의 오차 막대를 = 표준 오차, 바 = 평균 *** p &lt;0.001, 맨 - 휘트니 시험, N = 7).에스 / ftp_upload / 54263 / 54263fig1large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 2" src="/files/ftp_upload/54263/54263fig2.jpg" /> 그림 2 : B.에 의해 헬라 세포의 감염의 정량 . 아 보르 투스 항목 분석에 TetR-GFP를 표현 (A) 항목 분석 : 형광 영상을 DsRed 신호를 보여주는 아 보르 투스을 DsRed와 GFP 신호, 빨간색 = 세포 외 B를 보여주는 아 보르 투스 항목 분석의 예 (= 노란색 세포 내 B를 보여주는, 파란색 = 핵 DAPI, 스케일 바 = 50 μm의)로 염색. B.를 을 DsRed 그리고 TetR-GFP를 발현 보르 투스는 세포 외 박테리아 및 4 시간 동안 ATC와 세포 내 박테리아 GFP 동시에 유도 죽인 다음 4 시간 동안 HeLa 세포에 들어갈 수 있었다 자동화 이미지 분석 :. CellProfiler 파이프 라인은 DAPI를 검출하기 위해 사용 된25 픽셀 핵의 직경 확장하여 보로 노이 셀 몸체의 계산 하였다 핵 염색 (화이트 표시). 세균은 GFP 신호에 기초하여 분할 하였다. 그 보로 노이 셀 본체 충분한 크기 및 GFP 강도 중 적어도 하나의 세그먼트 세균 객체 중첩 경우 셀 감염된 여겨졌다. 감염된 세포에서 세균 부하는 보로 노이 셀 본체 모든 세그먼트 세균 오브젝트의 영역의 적분에 의해 설명된다 (단위 = 픽셀; NaN이 더 수가 비감염 세포에서 산출되지 =). (B) 실시 예 이미지 세포 (B)의 저하를 나타내는 siRNA를 표적 ARPC3 형질 세포 (노란색 균수로 표시) 보르 투스 스크램블 siRNA를 처리 한 세포를 대조군에 비해. 감염된 세포의 수뿐만 아니라 감염된 세포의 세포 내 박테리아의 평균 개수가 노크 ARPC3 따라 감소된다. 헬라 세포에 감염 속도 (C) 정량은 고갈ARPC3합니다. 데이터는 막대 그래프로 표시됩니다 (; 모의에 정상화, 오차 막대 = 평균의 표준 오차, 바 = 평균 * P &lt;0.05, 맨 - 휘트니 시험, N = 4). ARPC3에 대한 고갈에 감염된 HeLa 세포의 세균 부하의 (D) 부량. 데이터는 막대 그래프로 표시됩니다 (; 정상화 모의에, 오차 막대 = 평균의 표준 오차 * P &lt;0.05, 맨 - 휘트니 시험, 바 = 평균 N = 4). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54263/54263fig2large.jpg" target="_blank">이의 더 큰 버전을 보려면 여기를 클릭하십시오 그림.</a> 추가 파일 1 :. CP2 파이프 라인 - 음영 보정 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54263/CP2_pipeline-shading_correction.cppipe" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 보조 파일 2 : CP2 파이프 라인- 엔드 포인트 분석. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54263/CP2_pipeline-Endpoint_assay.cppipe" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 기업 파일 3 :. CP2 파이프 라인 - 항목 분석 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54263/CP2_pipeline-Entry_assay.cppipe" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 기업 파일 4. 모듈의 설명 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54263/Description_of_Modules.docx" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

에 참여 호스트 요인의 높은 처리량 검사에 대한 현미경 기반 분석 실험<em&gt; 브루셀라</em&gt; HeLa 세포의 감염

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

microscopy-based-assays-for-high-throughput-screening-host-factors

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

8.2K 조회수.  University of Basel. Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

비디오: Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

에 관련된 호스트 요인에 대한 RNAi 심사 우두</em사용하기> 바이러스 감염 Drosophila 전지

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

연구

면역학 및 감염병학

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

	In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.

유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

고처리량/고함량 스크리닝에 적용된 세포내 진균의 정량화를 위한 현미경 표티픽 분석

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA 바이러스의 넓은 스펙트럼 화학 억제를위한 높은 처리량 검사

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or cellular processes. With the advancement of biotechnologies and the high translational potential of small molecules, a number of innovative approaches in drug discovery have evolved, which explains the resurgent interest in the use of HTS. The oncology field is currently the most active research area for drug screening, with no major breakthrough made for the identification of new immunomodulatory compounds targeting transplantation-related complications or autoimmune ailments. Here, we present a novel in vitro murine fluorescent-based lymphocyte assay easily adapted for the identification of new immunomodulatory compounds. This assay uses T or B cells derived from a transgenic mouse, in which the Nur77 promoter drives GFP expression upon T- or B-cell receptor stimulation. As the GFP intensity reflects the activation/transcriptional activity of the target cell, our assay defines a novel tool to study the effect of given compound(s) on cellular/biological responses. For instance, a primary screening was performed using 4,398 compounds in the absence of a &#34;target hypothesis&#34;, which led to the identification of 160 potential hits displaying immunomodulatory activities. Thus, the use of this assay is suitable for drug discovery programs exploring large chemical libraries prior to further in vitro/in vivo validation studies.

We present in the current study a novel fluorescence-based assay using lymphocytes derived from a transgenic mouse. This assay is suitable for high-throughput screening (HTS) of small molecules endowed with the capacity of either inhibiting or promoting lymphocyte activation.

작은 분자의 높은 처리량 스크리닝 적합한 형광 계 분석 림프구

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.

심사 분석 실험 소설 내 피 레 귤 레이 터 염증 반응에 관여 하

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

살 모 넬 라 종의 심사에 대 한 높은 처리 플랫폼 /Shigella 종

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

포유류 세포에서 효율 Resealing 원형질 막의 높은 처리량 측정

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

High Throughput Co-culture Assays for the Investigation of Microbial Interactions

The study of interactions between microorganisms has led to numerous discoveries, from novel antimicrobials to insights in microbial ecology. Many approaches used for the study of microbial interactions require specialized equipment and are expensive and time intensive. This paper presents a protocol for co-culture interaction assays that are inexpensive, scalable to large sample numbers, and easily adaptable to numerous experimental designs. Microorganisms are cultured together, with each well representing one pairwise combination of microorganisms. A test organism is cultured on one side of each well and first incubated in monoculture. Subsequently, target organisms are simultaneously inoculated onto the opposite side of each well using a 3D-printed inoculation stamp. After co-culture, the completed assays are scored for visual phenotypes, such as growth or inhibition. These assays can be used to confirm phenotypes or identify patterns among isolates of interest. Using this simple and effective method, users can analyze combinations of microorganisms rapidly and efficiently. This co-culture approach is applicable to antibiotic discovery as well as culture-based microbiome research and has already been successfully applied to both applications.

The co-culture interaction assays presented in this protocol are inexpensive, high throughput, and simple. These assays can be used to observe microbial interactions in co-culture, identify interaction patterns, and characterize the inhibitory potential of a microbial strain of interest against human and environmental pathogens.