Gli autori desiderano ringraziare Gráinne Tierney per assistenza editoriale.

Il protocollo segue le linee guida del Comitato di etica IRST umana ricerca.
Nota: Questa procedura è specificamente progettata per il rilevamento di un basso numero di molecole di cDNA in tessuti umani fresco-congelato. Le sezioni di tessuto sono state tagliate il ghiaccio secco, mentre ancora congelato, da tumore gastrico paziente-derivato precedentemente convalidato o campioni di tessuto normale.
1. RNA isolamento e purificazione
<ol><li>
Estrazione del RNA Nota: Isolamento del RNA viene eseguita sotto il cofano usando un prodotto specifico (Vedi Tabella materiali). Tuttavia, una varietà di kit di isolamento sono disponibili in commercio.<ol>
<li>Omogeneizzare 50-100 mg di campione di tessuto fresco congelato tagliato finemente in una provetta da 1,5 mL con 1 mL di reagente di isolamento del RNA e vortice vigorosamente per 15 s. Incubare le provette a-80 ° C durante la notte.</li>
		<li>Incubare la provetta contenente il campione a temperatura ambiente per 5 minuti e mescolare nel Vortex per 15 s.</li>
		<li>Tenere il tubo sul ghiaccio, aggiungere 200 µ l di cloroformio e agitare vigorosamente per 15 s.</li>
		<li>Incubare le provette a temperatura ambiente per 60 s e centrifugare a 12.000 x g per 15 min a 4 ° C.</li>
		<li>Trasferire la fase acquosa in una provetta da 1,5 mL e aggiungere 20 µ g di glicogeno. Nota: È importante evitare accuratamente di trasferire qualsiasi interfase o strato organico al fine di ridurre la contaminazione.</li>
		<li>Aggiungere 500 µ l di isopropanolo, invertendo il tubo per miscelare e incubare in ghiaccio per 10 min.</li>
		<li>Centrifugare la provetta a 12.000 x g per 15 min a 4 ° C per precipitare il RNA. Nota: RNA sarà presente un simil-gel a pellet sul lato e sul fondo della provetta, spesso invisibile dopo la centrifugazione.</li>
		<li>Rimuovere il sopranatante senza disturbare il precipitato e lavare con 1 mL di etanolo al 75% di pipettaggio.</li>
		<li>Centrifugare la provetta a 7.500 x g per 5 min a 4 ° C e rimuovere il sopranatante senza disturbare il pellet.</li>
		<li>Lasciate che il pellet a secco fino a quando il precipitato diventa trasparente e scioglierla in 50 µ l di acqua RNAsi-libera.</li>
		<li>Congelare i campioni a-80 ° C almeno una notte prima di quantificazione.</li>
	</ol>
</li>
	<li>
Eliminazione del DNA genomico e purificazione di RNA Nota: Una fase di digestione DNasi, seguita da una purificazione di RNA basata su colonne, è consigliabile per le analisi degli obiettivi di basso-abbondanza per digerire DNA contaminante.<ol>
<li>Sciogliere il liofilizzato dnasi I (1.500 unità Kunitz) nel 550 µ l di RNAsi-libera dell'acqua utilizzando una siringa, mix delicatamente capovolgendo il flacone e dividere la soluzione ricostituita di stock in aliquote.</li>
		<li>Trasferire in una provetta da 1,5 mL il volume calcolato del campione con 15 µ g di RNA, 10 µ l di dnasi digestione dal kit (elencati in Tabella materiali), 2,5 µ l di dnasi I stock soluzione tampone e RNAsi-libera di acqua a 100 µ l. Incubare a temperatura ambiente per 10 min.</li>
		<li>Aggiungere 350 µ l di tampone di lisi del tessuto (da kit, Vedi Tabella materiali) e Miscelare pipettando.</li>
		<li>Aggiungere 250 µ l di etanolo al 100% e mescolare pipettando.</li>
		<li>Trasferire l'intero volume (700 µ l) in una nuova colonna di spin e centrifugare a 12.000 x g per 15 s.</li>
		<li>Il filtro di trasferimento in una nuova provetta di raccolta, aggiungere 500 µ l di etanolo di 80% per la colonna e centrifugare a 12.000 x g per 2 min.</li>
		<li>Aprire il coperchio della centrifuga colonna e centrifugare a 12.000 x g per 5 min con un nuovo tubo di raccolta per asciugare il filtro; quindi trasferire il filtro in una provetta da 1,5 mL.</li>
		<li>Aggiungere 14 µ l di acqua RNAsi-libera direttamente alla colonna filtro e centrifugare a 12.000 x g per 1 min.</li>
		<li>Mantenere i campioni su ghiaccio e procedere alla quantificazione utilizzando 2 µ l del campione su un spettrofotometro da banco o memorizzare il RNA a-80 ° C fino all'utilizzo.</li>
	</ol>
</li>
</ol>2. sintesi del cDNA
<ol><li>Posto 1.000 ng di RNA, 4 µ l di master mix, 1 µ l di trascrittasi inversa e RNAsi-libera di acqua ad un volume finale di 20 µ l in una provetta sterile da PCR. Mescolare delicatamente e rotazione verso il basso.</li>
	<li>Incubare il mix di reazione in un termociclatore, applicando le seguenti condizioni: 5 min a 25 ° C, 30 min a 42 ° C, 5 min a 85 ° C.</li>
	<li>Centrifugare brevemente le provette e procedere all'analisi dPCR o conservare a-20 ° C fino a quando necessario.</li>
</ol>3. reazione di PCR digitale impostato
<ol><li>
reazione di dPCR mescolare e preparazione dei campioni
	<ol>
<li>Scongelare il mix master e test a temperatura ambiente per almeno 20 min.</li>
		<li>Diluire i campioni di cDNA a una concentrazione di 300 ng in 6 µ l di acqua.</li>
		<li>Delicatamente vortice il master mix e preparare la miscela in una provetta sterile con 8,7 µ l di master mix, 0,87 µ l di primer personalizzato progettato saggio CDH1a e 1,83 µ l di acqua priva di nucleasi per un volume finale di 11,4 µ l. Nota: Per CDH1a personalizzato progettato saggio primer dettagli vedere la Tabella dei materiali.</li>
		<li>Trasferire il campione di cDNA diluito 11,4 µ l della miscela preparata, mescolare delicatamente e centrifugare brevemente. Nota: I volumi comprendono l'eccesso del 20% per compensare la perdita di volume da pipettaggio. Preparare la miscela per tutti i campioni e un controllo privo di templato (NTC).</li>
	</ol>
</li>
	<li>
Preparazione chip Nota: Per risultati ottimali caricare i chip più presto possibile.<ol>
<li>Collegare il caricatore di chip e attendere finché l'indicatore luminoso diventa verde.</li>
		<li>Rimuovere il cappuccio della siringa fluido immersione delicatamente tirando indietro lo stantuffo 1-2 mm e rilasciarlo per facilitare questo passaggio e sostituirlo con una punta.</li>
		<li>Prendere un nuovo chip e prendere nota del codice scritto sul coperchio per associarlo con il campione.</li>
		<li>Tenere il coperchio con attenzione dal suo lato, togliere la pellicola protettiva e posizionare il coperchio con il viso appiccicoso fino con l'orientamento corretto.</li>
		<li>Attentamente pick up un chip, avendo cura di non per toccare la parte interna e caricarlo sul nido di chip nella posizione corretta premendo verso il basso la leva per aprire il morsetto.</li>
		<li>Caricare una nuova pala di caricamento sul caricatore e spingerlo delicatamente per garantire che sia saldamente in posizione.</li>
		<li>Trasferire 14.5 µ l della miscela di reazione dPCR sulla lama caricamento senza fare bolle d'aria o deviare la lama, dopo che stampa il nero carico pulsante per distribuire il volume sul chip.</li>
		<li>Utilizzare la siringa del liquido di immersione per trasferire circa 20 gocce sulla superficie del chip facendo attenzione a non per toccare la superficie con la punta. Nota: È importante coprire l'intera superficie senza versare il liquido sopra i bordi.</li>
		<li>Ruotare il braccio caricatore per fare il coperchio venga a contatto con il chip e premere verso il basso per 15 s.</li>
		<li>Premere l'apposito pulsante per rilasciare il chip e riportare il braccio in posizione.</li>
		<li>Tenere il chip montato a un angolo di 45° e attentamente erogare il liquido di immersione con la siringa attraverso la porta di riempimento, ruotare il chip leggermente per assicurarsi che ci siano bolle d'aria e rimuovere il liquido in eccesso con un panno sterile.</li>
		<li>Sigillare il caso di chip da staccando delicatamente l'etichetta in cima al coperchio di chip e premere sopra la porta di riempimento per almeno 5 s.</li>
		<li>Conservare il chip al buio fino al momento di caricare nel termociclatore. Nota: Chip preparato deve essere utilizzato entro 2 h.</li>
	</ol>
</li>
	<li>
reazione di dPCR
	<ol>
<li>Aprire il coperchio e installare gli adattatori per entrambi i blocchi, anche quando viene utilizzato un unico blocco.</li>
		<li>Posizionare la fiches sul blocco campione nella posizione corretta. Nota: La porta di riempimento deve essere orientata verso la parte anteriore del termociclatore in una posizione elevata per consentire eventuali bolle d'aria a galleggiante verso l'alto senza disturbare la finestra del chip. Utilizzare chip vuoto per bilanciare i due blocchi.</li>
		<li>Posare il pad termico sul blocco campione per coprire completamente i chip.</li>
		<li>Chiudere il coperchio e iniziare la PCR esegue, applicando le seguenti condizioni: tenere a 96 ° C per 10 min; 45 cicli di 60 ° C per 2 min e 98 ° C per 30 s; tenere a 60 ° C per 2 min; tenere a 4 ° C. Spegnere il termociclatore e scongelare i chip a temperatura ambiente per almeno 10 min. Nota: Analisi di Chip devono essere eseguito entro un'ora.</li>
	</ol>
</li>
	<li>
Analisi di chip
	<ol>
<li>Aprire il coperchio dello strumento e rimuovere i thermal pad, quindi rimuovere i chip dalle schede. Nota: Conservare i chip in un luogo scuro, pulito fino all'analisi.</li>
		<li>Pulire la superficie del chip con isopropanolo e un panno sterile. Nota: Ispezionare ogni chip per perdite o problemi potenziali.</li>
		<li>Inserire il cavo USB nel sistema rivelatore per salvare i dati.</li>
		<li>Aprire il vassoio del sistema rivelatore, caricare il chip a faccia in su nella posizione corretta e quindi chiudere il vassoio.</li>
		<li>Aspettare 30 s per l'elaborazione, quindi rimuovere il chip e inserire quello successivo.</li>
		<li>Attendere l'analisi essere completato per tutti i chip trasformati quindi inserire il cavo USB in un computer per trasferire i file. Nota: Il tempo totale per l'analisi è di circa 2 a 3 min/chip.</li>
	</ol>
</li>
</ol>4. dati analisi e interpretazione
<ol><li>Connettersi alla piattaforma cloud-based del software necessario per svolgere tutte le analisi a valle.</li>
	<li>Creare un progetto e importare tutti i file di dati dei chip di interesse.</li>
	<li>Immettere il nome del campione; Selezionare la tintura e il dosaggio utilizzato nella scheda "Definire Chips".</li>
	<li>Determinare se il chip è accettabile da visualizzarlo direttamente nella scheda "Modifica dati", il controllo come accuratamente il campione è stato caricato sul chip e quanti punti dati sono valutabili. Nota: Rifiutare chip con meno di 13.000 punti dati valutabili.</li>
	<li>Passare alla dispersione del chip selezionato sul lato destro dello schermo; applica una soglia di 6.000 per i segnali di colorante reporter di fluorescina amidite (FAM) (asse y) a tutte le chips. Nota: Impostata la soglia può variare sulla base di analisi utilizzate.</li>
	<li>Rimuovi qualsiasi dubbie segnali positivi per evitare risultati falsi positivi selezionando il relativo posto lo scatter plot usando lo strumento lazo e premendo su "indeterminato". Tutti i rimanenti punti positivi indicano la presenza di copie del cDNA della rara destinazione analizzati.</li>
</ol>

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

Gli autori non segnalano conflitti di interesse per questo lavoro.

dPCR è stato originariamente sviluppato per DNA molecolare misure10,11,12,13 e nel tempo che questa tecnologia è stata adattata per la quantificazione dei microRNA e RNA trascrizioni5, 14,15. In questo protocollo abbiamo esteso l'elenco delle applicazioni per includere il rilevamento delle rare tras...

Il gene CDH1 codifica per E-caderina, un fattore chiave coinvolti nel mantenimento dell'epitelio gastrico normale attraverso il regolamento di adesione, sopravvivenza, proliferazione e migrazione delle cellule1. Perdita della proteina di E-caderina a seguito di germline deleteri o alterazioni somatiche del CDH1 sono state associate con lo sviluppo di GC2,3. Trascritti non canonici derivanti da introne 2 del gene inoltre sono stati supposti per svolgere un ruolo nella carcinogenesi gastrica4,5. In particolare, una tale trascrizione, CDH1a, ha dimostrato di essere espressi in linee cellulari di GC ma è assente dalla stomaco normale4. Abbiamo recentemente rilevato CDH1a nei campioni di tessuto di GC da pazienti di gascromatografia usando basata su chip dPCR5. dPCR è stato utilizzato per valutare, per la prima volta, la presenza della trascrizione del gene CDH1a in GC intestinale e nel tessuto normale.
Il metodo gold standard per determinare l'espressione genica è Real-Time PCR quantitativa (qPCR). Tuttavia, i dati risultanti possono a volte essere variabile e di scarsa qualità, soprattutto quando il livello di destinazione nel campione è basso. Questa variabilità può essere causata da contaminanti, che inibiscono l'attività della polimerasi e primer di ricottura, che conduce a lato competitivo reazioni6e amplificazione aspecifici.
Anche se i principi di base biochimici di dPCR sono simili a quelli di qPCR, dPCR Mostra alcuni vantaggi, consentendo misurazioni molto precise del DNA genomico (gDNA) / complementari molecole di DNA (cDNA). Infatti, dPCR è una reazione di punto finale che si basa sulla compartimentazione calibrato di un campione in migliaia di pozzi, affinché ciascun pozzetto contiene zero o una molecola bersaglio singolo. Amplificazione, quindi, si verifica solo nei pozzetti contenenti una copia del database di destinazione e viene indicato da un segnale fluorescente. Il numero assoluto di molecole bersaglio nel campione originale può quindi essere calcolato determinando il rapporto di positivo per partizioni totali utilizzando binomiale Poisson statistiche7.
Inoltre, la tecnica di dPCR Elimina la necessità per l'esecuzione di una curva standard e, quindi, il bias associato e variabilità, che consente una quantificazione diretta di obiettivi8,9; produce risultati più precisi e riproducibili indipendentemente da contaminanti ed efficienza grazie alla sua elevata tolleranza a inibitori10; esso è più sensibile e specifico rispetto qPCR e così è un metodo affidabile per la rilevazione di un obiettivo raro. Infine, la suddivisione del campione in reazioni multiple riduce la concorrenza con molecole di fondo e migliora il limite di individuazione del bersaglio, rendendo possibile l'amplificazione e facilitando la rilevazione di singole molecole di gDNA/cDNA6 . La rilevazione e la quantificazione degli acidi nucleici da dPCR basata su chip è stato sempre più applicato per copiare numero variazione, frammenti di quantificazione del DNA e mutazione analizza11,12,13, dato il precisione e basso materiale requisito del metodo di input. Inoltre, dPCR recentemente è stato integrato nell'analisi di entrambi i microRNA14 e gene trascrizioni5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, una non-canonica trascrizione del gene CDH1 , è stato trovato per essere espresso in alcune linee cellulari di cancro gastrico (CG), mentre è assente nel mucosa gastrico normale. Recentemente, abbiamo rilevato la variante di trascrizione di CDH1a nei tessuti di fresco-congelato del tumore ottenuti da pazienti con GC. L'approccio PCR (dPCR) digitale basata su chip qui presentata è stata studiata l'espressione di questa variante nei campioni di tessuto. dPCR offre il potenziale per una misurazione accurata, robusto e altamente sensibile degli acidi nucleici ed è sempre più utilizzata per molte applicazioni in diversi campi. dPCR è in grado di rilevare gli obiettivi rari; Inoltre, dPCR offre la possibilità di assoluta e precisa quantificazione degli acidi nucleici senza la necessità di calibratori e curve standard. Infatti, la reazione di partizionamento arricchisce la destinazione dallo sfondo, che migliora l'efficienza di amplificazione e tolleranza agli inibitori. Tali caratteristiche rendono dPCR uno strumento ottimo per la rilevazione della trascrizione rara CDH1a .

Utilizzando la procedura qui presentata, abbiamo controllato per l'espressione della variante rara trascrizione CDH1a in tessuti gastrici fresco-congelato. L'analisi di dPCR è stato effettuato su campioni 21-accoppiato di tessuto normali e tumorali e in 11 campioni tumorali aggiuntive. CDH1a era rilevabile nei tumori 15 su 32 (47%), mentre nessun campioni di tessuto normali hanno mostrato la presenza di questa rara trascrizione5. Nella nostra ana...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Rilevamento di una variante rara trascrizione CDH1 in tessuti di cancro gastrico fresco congelato mediante PCR digitale basata su Chip

Il manoscritto descrive un chip digitale test PCR per rilevare una variante rara di trascrizione CDH1 (CDH1a) nel normale fresco-congelato e tessuti del tumore ottenuti da pazienti con cancro gastrico.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

detection-cdh1-rare-transcript-variant-fresh-frozen-gastric-cancer

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

6.1K Views.  Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS. Il manoscritto descrive un chip digitale test PCR per rilevare una variante rara di trascrizione CDH1 (CDH1a) nel normale fresco-congelato e tessuti del tumore ottenuti da pazienti con cancro gastrico.

Video: Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We developed an in vitro fully human preclinical model of a co-culture of breast cancer cells and monocytes undergoing differentiation towards osteoclasts. We optimized a model of osteoclastogenesis starting from a sample of peripheral blood collected from healthy donors. Peripheral blood mononuclear cells (PBMCs) were first separated by density gradient centrifugation, seeded at a high density and induced to differentiate by adding two growth factors (GFs): receptor activator of nuclear factor-&#954;B ligand (RANKL) and macrophage colony-stimulating factor (MCSF). The cells were left in culture for 14 days and then fixed and analyzed by downstream analysis. In osteolytic bone metastases, one of the effects of cancer cell arrival in bone is the induction of osteoclastogenesis. We thus challenged our model with co-cultures of breast cancer cells to study the differentiation power of cancer cells with respect to GFs. A straightforward way of studying cancer cell-osteoclast interaction is to perform indirect co-cultures based on the use of conditioned medium collected from breast cancer cell cultures and mixed with fresh medium. This mixture is then used to induce osteoclast differentiation. We also optimized a method of direct co-culture in which cancer cells and monocytes undergoing differentiation share the medium and exchange secreted factors. This is a significant improvement over the original indirect co-culture method as researchers can observe the reciprocal interactions of the two cell types and perform downstream analyses for both cancer cells and osteoclasts. This method enables us to study the effect of drugs on the metastatic bone microenvironment and to seed cell lines other than those derived from breast cancer. The model can also be used to study other diseases such as osteoporosis or other bone conditions.

This protocol describes development of an in vitro human preclinical model of osteoclastogenesis from peripheral blood monocytes cultured with breast cancer cell lines to mimic the cancer cell-osteoclast interaction. The model could be used to further our understanding of bone metastasis formation and improve therapeutic options.

Sviluppo di un modello preclinico umano di osteoclastogenesi dai monociti del sangue periferico co-coltivati con linee cellulari di cancro al seno

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Ricerca

Ricerca sul cancro

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. However, the application of this method is challenging due to its low sensitivity in analyzing the trace amount of ctDNA in the blood. Furthermore, the method may generate false positive and negative results from this sequencing and subsequent analysis. To improve the feasibility and reliability of ctDNA detection in the clinic, here we present a technique which enriches rare mutations for sequencing, Enrich Rare Mutation Sequencing (ER-Seq). ER-Seq can distinguish a single mutation out of 1 x 107 wild-type nucleotides, which makes it a promising tool to detect extremely low frequency genetic alterations and thus will be very useful in studying disease heterogenicity. By virtue of the unique sequencing adapter&#39;s ligation, this method enables an efficient recovery of ctDNA molecules, while at the same time correcting for errors bidirectionally (sense and antisense). Our selection of 1021 kb probes enriches the measurement of target regions that cover over 95% of the tumor-related driver mutations in 12 tumors. This cost-effective and universal method enables a uniquely successful accumulation of genetic data. After efficiently filtering out background error, ER-seq can precisely detect rare mutations. Using a case study, we present a detailed protocol demonstrating probe design, library construction, and target DNA capture methodologies, while also including the data analysis workflow. The process to carry out this method typically takes 1-2 days.

This manuscript describes a technique for detecting mutations of low frequency in ctDNA, ER-Seq. This method is differentiated by its unique use of two-directional error correction, a special background filter, and efficient molecular acquirement.

Rilevazione di mutazioni Rare in CtDNA mediante sequenziamento di nuova generazione

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, and prediction of treatment resistance. Starting from the hypothesis that androgen receptor (AR) gene copy number (CN) gain is a frequent event in metastatic castration resistance prostate cancer (mCRPC), we propose to analyze this event in cfDNA as a potential predictive biomarker.
We evaluated AR CN in cfDNA using 2 different real-time PCR assays and 2 reference genes (RNaseP and AGO1). DNA amount of 60 ng was used for each assay combination. AR CN gain was confirmed using Digital PCR as a more accurate method. CN variation analysis has already been demonstrated to be informative for the prediction of treatment resistance in the setting of mCRPC, but it could be useful also for other purposes in different patient settings. CN analysis on cfDNA has several advantages: it is non-invasive, rapid and easy to perform, and it starts from a small volume of serum or plasma material.

This manuscript describes the copy number variation analysis performed in serum or plasma DNA using real-time PCR approach. This method is suitable for the prediction of drug resistance in castration resistant prostate cancer patients, but it could be informative also for other diseases.

Siero e Plasma copia numero rilevazione mediante PCR in tempo reale

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and eosin (H&amp;E) staining but can be visualized through elastic staining. One of the important benefits of elastic staining is that it makes it easy to determine whether tumor cells have invaded beyond the elastic lamina. This helps in examining the extent of peritoneal surface invasion, thereby distinguishing the pT3 and pT4 stages in gastrointestinal cancer. In this study, we present a protocol to identify elastic fibers in the formalin-fixed, paraffin-embedded pT3N0M0 gastric cancer tissue sections. We prepare 5-&#181;m paraffin sections fixed on slides, and then all the slides are deparaffinated and rehydrated during the staining procedure. Subsequently, all the sections are oxidized by potassium permanganate, bleached by oxalic acid, stained by elastic staining, and counterstained by Van Gieson's. Finally, we examine the effect of staining; elastic lamina is stained blue-black and collagen fibers are stained red, while the cancer cells are stained in varying shades of yellow. We also describe in detail the methods used for determining the positional relationship between cancer cells and elastic lamina. This method is simple, low-cost, and widely applicable in the identification of peritoneal surface invasion in gastrointestinal cancer because of its outstanding selectivity for elastic fibers and authentic results.

Here, we present a protocol of elastic staining to identify elastic fibers in pT3N0M0 gastric cancer tissues on formalin-fixed, paraffin-embedded sections. Subsequently, we describe a method to determine whether tumor cells invade beyond the elastic lamina.

Colorazione elastica su vetrini di tessuto gastrico pT3N0M0 gastrico

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image analysis. Digital scanning is a fast way to scan a stack of slides and produce digital images with high quality. It can produce concordant results with conventional light microscopy (CLM) by pathologists. Furthermore, the availability of digital images makes it possible that the same slide can be concurrently observed by multiple people. Moreover, digital images of slides can be stored in a database, which means the long-term deterioration of glass slides is avoided. The limitations of this technique are as follows. First, it needs high-quality prepared tissue and the original immunohistochemistry (IHC) slides without any damage or excess sealant residue. Second, tumor or nontumor areas should be specified by experienced pathologists before the analysis using software, in order to avoid any confusion about the tumor or nontumor areas during scoring. Third, the operator needs to control the color reproduction throughout the digitization process in whole-slide imaging.

ZW10 interacting protein (ZWINT) participates in the mitotic spindle checkpoint and the pathogenesis of carcinoma. Here, we introduce a methodology of the immunostaining of ZWINT in human lung cancer tissues, followed by the digital scanning of whole slides and image analysis. This methodology can provide high-quality digital images and reliable results.

Analisi digitale dell'immunostaining delle proteine che interagiscono con la W10 nei tessuti polmonari umani

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using electrophoresis through a resolving gel embedded with a degradable substrate. This method differs from traditional gel zymography in that a quenched fluorogenic peptide is covalently incorporated into the resolving gel instead of full length proteins, such as gelatin or casein. Use of the fluorogenic peptides enables direct detection of proteolytic activity without additional staining steps. Enzymes within the biological samples cleave the quenched fluorogenic peptide, resulting in an increase in fluorescence. The fluorescent signal in the gels is then imaged with a standard fluorescent gel scanner and quantified using densitometry. The use of peptides as the degradable substrate greatly expands the possible proteases detectable with zymographic techniques.

Here, we present a detailed protocol for a modified zymographic technique in which fluorescent peptides are used as the degradable substrate in place of native proteins. Electrophoresis of biological samples in fluorescent peptide zymograms enables detection of a wider range of proteases than previous zymographic techniques.

Rilevazione di attività di proteasi dallo Zymography Peptide fluorescente

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. Although there are many established gastric cancer cell lines and many conventional transgenic mouse models for preclinical research, the disadvantages of these in vitro and in vivo models limit their applications. Because the characteristics of these models have changed in culture, they no longer model tumor heterogeneity, and their responses have not been able to predict responses in humans. Thus, alternative models that better represent tumor heterogeneity are being developed. Patient-derived xenograft (PDX) models preserve the histologic appearance of cancer cells, retain intratumoral heterogeneity, and better reflect the relevant human components of the tumor microenvironment. However, it usually takes 4-8 months to develop a PDX model, which is longer than the expected survival of many gastric patients. For this reason, establishing primary cancer cell lines may be an effective complementary method for drug response studies. The current protocol describes methods to establish PDX models and primary cancer cell lines from surgical gastric cancer samples. These methods provide a useful tool for drug development and cancer biology research.

The current protocol describes methods to establish patient-derived xenograft (PDX) models and primary cancer cell lines from surgical gastric cancer samples. The methods provide a useful tool for drug development and cancer biology research.

Stabilimento di modelli Xenograft derivati dal paziente derivato dal paziente e linee cellulari primarie

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Rilevamento dell'attività di retrotraposizione di HOT LINE-1s da PCR inverso a lunga distanza

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic alterations in oncogenes such as the KRAS oncogene, which constitutes ~25% of lung cancer cases. The difficulty in therapeutically targeting KRAS-driven lung cancer partly stems from having poor models that can mimic the progression of the disease in the lab. We describe a method that permits the relative quantification of primary KRAS lung tumors in a Cre-inducible LSL-KRAS G12D mouse model via ultrasound imaging. This method relies on brightness (B)-mode acquisition of the lung parenchyma. Tumors that are initially formed in this model are visualized as B-lines and can be quantified by counting the number of B-lines present in the acquired images. These would represent the relative tumor number formed on the surface of the mouse lung. As the formed tumors develop with time, they are perceived as deep clefts within the lung parenchyma. Since the circumference of the formed tumor is well-defined, calculating the relative tumor volume is achieved by measuring the length and width of the tumor and applying them in the formula used for tumor caliper measurements. Ultrasound imaging is a non-invasive, fast and user-friendly technique that is often used for tumor quantifications in mice. Although artifacts may appear when obtaining ultrasound images, it has been shown that this imaging technique is more advantageous for tumor quantifications in mice compared to other imaging techniques such as computed tomography (CT) imaging and bioluminescence imaging (BLI). Researchers can investigate novel therapeutic targets using this technique by comparing lung tumor initiation and progression between different groups of mice.

This protocol describes the steps taken to induce KRAS lung tumors in mice as well as the quantification of formed tumors by ultrasound imaging. Small tumors are visualized in early timepoints as B-lines. At later timepoints, relative tumor volume measurements are achieved by the measurement tool in the ultrasound software.

Rilevamento della progressione del tumore del polmone nei topi mediante Ultrasound Imaging

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Analisi patologica delle metastasi polmonari a seguito di iniezione laterale della vena della coda di cellule tumorali

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...