Vorremmo ringraziare G. Fulda (Microscopia Elettronica Center, Università di Rostock, Germania) per il supporto tecnico ad acquisire immagini TEM di nanoparticelle superparamagnetiche filtrati e nello svolgimento loro analisi ai raggi X. Il lavoro svolto presso la RTC Rostock è stato sostenuto dal Ministero federale dell&#39;Istruzione e della Ricerca Germania (FKZ 0312138A, FKZ 316159 e VIP + 03VP00241) e lo Stato Meclemburgo-Pomerania occidentale con i Fondi strutturali dell&#39;UE (FSE / IV-WM-B34- 0030/10 e FSE / IV-BM-B35-0010 / 12) e dalla DFG (dA 1296-1), l&#39;umidità-Fondazione, e la Heart Foundation tedesco (F / 01/12). Frank Wiekhorst è stato sostenuto dal programma di ricerca dell&#39;UE del 7 ° PQ &quot;NanoMag&quot; FP7-NMP-2013-LARGE-7.

Noi non abbiamo concorrenti interessi finanziari da dichiarare.

La produzione di cellule geneticamente modificate cariche di nanoparticelle superparamagnetiche per la loro guida ulteriormente magneticamente controllato è presentato nel protocollo corrente. L&#39;applicazione di successo di questa strategia consente la risoluzione di alcune difficoltà di terapia cellulare, come la bassa ritenzione e poveri attecchimento nella zona lesa 2, 3, 4, realizzando un prodotto cellulare targeting per il trapianto. Inoltre, l&#39;introduzione simultanea di materiale genetico opportunamente selezionato potrebbe promuovere le proprietà delle cellule e potrebbe quindi aumentare i benefici funzionali 41. Il protocollo attuale è stato sviluppato su HUVECs come modello. Queste cellule sono noti per essere difficili da trasfettare e suscettibile di influenza tossico 18, 19, 20. il DEMlivello onstrated di fluoroforo marcato miR assorbimento oltre il 95% dopo PEI / MNP trasfezione è tipicamente ottenuta con vettori basati PEI e comunemente usato cationici reagenti di transfezione a base lipidica (ad esempio, Lipofectamine) 42. Inoltre, il rapporto ottimale NP di 25 corrisponde con i valori precedentemente pubblicati di 20 - 40 per NP. Tuttavia, l&#39;assorbimento è molto efficace della testata miR fluoroforo-tag non garantisce necessariamente corretta elaborazione e la funzione miR dopo la consegna 43. Questo punto è particolarmente rilevante nel caso di PEI, con la sua condensazione elettrostatica stretto di NA. Pertanto, la capacità funzionale risultante consegnato miR deve essere testato. Qui, un miR funzionale endogeno espresso in HUVEC, miR-92a 31, è stato selezionato, e anti-miR contro di esso è stato consegnato con PEI e PEI / MNP. Come risultato, un atterramento quasi completa del target miR-92a dimostrato il rilascio efficiente del anti-miR fROM i complessi trasfezione. Soprattutto, in lavori precedenti, l&#39;applicazione di successo del vettore PEI / MNP è stata dimostrata per la consegna di DNA plasmidico (pDNA) e miR ad altri tipi di cellule, sia aderente (ad esempio, COS7, mesenchimali staminali 15, 16) ed in sospensione (ad esempio, midollo osseo derivate CD133 + cellule staminali ematopoietiche 44). Tutti questi esperimenti hanno confermato il fatto noto che l&#39;efficienza di trasfezione e la tossicità sono dipendente dal tipo 45 cellule. Pertanto, la selezione del vettore composizione ottimale (cioè, miR quantità, rapporto NP, e la quantità di ferro MNP) deve essere effettuata per ogni particolare tipo di cellula, utilizzando condizioni ottimali prestabilite come punti di riferimento. Inoltre, il carattere transitorio della modificazione genetica conseguita deve essere contabilizzata. Da un lato, it è molto adatto per determinata funzione, come ad esempio la consegna a breve termine dei fattori di crescita. D&#39;altra parte, la durata di espressione non può durare abbastanza a lungo per una varietà di scopi che richiedono l&#39;espressione a lungo termine. Tuttavia, la sicurezza provata del vettore PEI / MNP supporta sua eventuale somministrazione ripetuta una volta che le condizioni sono ulteriormente ottimizzate. PEI e suoi derivati sono comunemente utilizzati a causa della loro elevata efficienza rispetto agli altri veicoli non virali e la loro flessibilità per modifiche 7. Tuttavia, nonostante il successo PEI in vitro e in vivo, la sua applicazione negli studi clinici è molto limitata (cioè, poco fase 1 e 2 studi o pazienti oncologici) 7, 14 a causa della tossicità PEI 7, 13. Come precedenti lavori del nostro gruppo 16, così come questo protocollo, hanno dimostrato, MNPssono in grado di ridurre in modo significativo la tossicità PEI. In particolare, miR / PEI trasfezione ha danneggiato la capacità di cellule HUVEC per formare tubi sul loro matrice, avendo così un principale in vitro test funzionale per queste celle. Al contrario, tubo prestazioni formazione di miR / PEI / MNP-HUVEC era paragonabile a cellule non trattate. In particolare, questa diminuzione di tossicità PEI è stato ottenuto introducendo bassi livelli di componenti come ossido di ferro, che sono biocompatibili e solitamente usata come reagente contrasto in soggetti umani 40. Oltre a mantenere proprietà funzionali, è importante che le cellule modificate sono in grado di stabilire la comunicazione intercellulare, in quanto questa funzione è necessario per la corretta integrazione di terapie cellula post-trapianto 46. Inoltre, le cellule modificate possono essere sfruttate come vettori per la consegna di miR terapeutico per tessuti danneggiati 47. In questo caso, la loro Capacity per lo scambio di molecole con le cellule vicine definisce il loro successo come un veicolo. Poiché PEI / MNP trasfezione permette GJIC in HUVECs modificati, hanno il potenziale di integrazione in vivo e per fornire consegna miR alle zone danneggiate. In particolare, le opere pubblicate in precedenza su di magnetizzazione delle cellule per la successiva il targeting hanno riportato il carico delle cellule di ~ 4 e 30 pg di ferro / cella 48, 49, 50, 51. Questi numeri superano in modo significativo i valori ~ ,16-,7 pg / cellulari, che erano sufficienti per la mira in vitro di NA / PEI / MNP-HUVECs in condizioni dinamiche statiche e simulati. Tali quantità di ferro bassi sono vantaggiosi in termini di sicurezza: un meccanismo comunemente noto di ossido di ferro tossicità delle nanoparticelle-associata (cioè, la produzione di specie reattive dell&#39;ossigeno (ROS)) è conosciuta per essere direttamente associato con la quantità di internalized nanoparticelle 40. Inoltre, diversi studi hanno dimostrato che alti livelli intracellulari di nanoparticelle di ossido di ferro possono portare a dose-dipendente disorganizzazione del citoscheletro e danni 52, 53. È importante sottolineare che la maggior parte casi segnalati di magnetizzazione delle cellule per il targeting non includono la manipolazione delle cellule genetica. Al contrario, il vettore miR / PEI / MNP offre l&#39;opportunità di modificare simultaneamente cellule e di aggiungere proprietà magnetiche. Tuttavia, bassa MNP carico potrebbe non essere sufficiente per il targeting magnetico in un ambiente turbolento con il flusso sanguigno. Per avvicinarsi al difficile in situazione vivo, condizioni dinamiche sono state simulate in vitro: piastre di coltura con magnetizzato miR / PEI / MNP-HUVEC in sospensione sono state collocate sul agitatore rotante 34. Questo esperimento chiaramente non in grado di coprire tutte le interazioni che si verificano invivo. Tuttavia, ha portato ad una migliore comprensione del potenziale target di cellule PEI / MNP modificati. Come risultato, altamente efficiente il targeting delle cellule è stata dimostrata quando anche agitazione attiva del mezzo di coltura non interferiva con il movimento delle cellule verso il magnete 54. A tale scopo, HUVECs miR-modificati sono stati caricati con almeno ~ 0,16 pg di ferro / cellulare. Inoltre, le cellule magneticamente sensibili possono essere ordinati. Una procedura separazione cellulare magnete basata applicata allo studio attuale non ha compromesso la vitalità delle / PEI / MNP cellule MIR. È importante sottolineare che l&#39;applicazione di un campo magnetico statico (vale a dire, il targeting esperimenti che hanno coinvolto l&#39;applicazione di un campo magnetico per 12 - 24 ore) non ha avuto un effetto dannoso sulle cellule bersaglio. Pertanto, la produzione di dimostrata magnetizzate cellule geneticamente modificate costituisce la base per ulteriori studi in vivo affrontare l&#39;efficienza di ritenzione cellulare garantita dalla forza magnetica. In particolare, the di maggior successo in vivo che impiegano il targeting di cellule magnetizzate 51, 54, 55 ritenzione cella utilizzata dopo somministrazione locale invece di guida cella dopo iniezione endovenosa. Pertanto, ritenzione magnete a base al sito di iniezione risulta opportuno per ulteriori applicazioni in vivo di cellule miR / PEI / MNP-modificati.

Terapia genica e cellulare sono strumenti potenti che hanno il potenziale per risolvere le sfide attuali nel trattamento CVD. Nonostante il fatto che entrambi questi approcci sono attualmente in fase di sperimentazione in studi clinici, non sono ancora pronti per una vasta applicazione clinica 1. In particolare, un approccio comune per affrontare le sfide della terapia genica e cellulare è quello di sviluppare vettori di trasferimento dei geni multifunzionali adatte per l&#39;applicazione clinica. La mancanza di sistemi di lancio gene sicuri ed efficienti è la preoccupazione principale della terapia genica. Allo stesso tempo, l&#39;ingegnerizzazione genetica di prodotti cellulari prima del trapianto potrebbe superare le gravi sfide della terapia cellulare, come la bassa efficienza (trapianto di cellule post-staminali per esempio, nel campo cardiaco, solo ~ 5% di miglioramento funzionale si ottiene 1 ) e la scarsa ritenzione / attecchimento presso il sito di lesione (ad esempio, la conservazione delle cellule scende sotto i 5 - 10% in pochi minuti a ore Post-applicazione, indipendentemente dalla via di somministrazione 2, 3, 4). Fino ad oggi, vettori virali superano notevolmente i sistemi non-virali in termini di efficienza, che ha portato nella loro più ampia applicazione negli studi clinici (~ 67%) 5. Tuttavia, i veicoli virali comportano rischi gravi, come immunogenicità (e la successiva risposta infiammatoria, con gravi complicazioni), oncogenesi e limitazioni nella dimensione del materiale genetico condotto 6. A causa di questi problemi di sicurezza e gli elevati costi di produzione vettore virale, l&#39;uso di sistemi non virali è preferibile in alcuni casi 7, 8. È particolarmente adatto per i disturbi che richiedono correzione genetica transitoria, come l&#39;espressione dei fattori di crescita che controllano l&#39;angiogenesi (ad esempio, per il trattamento CVD) o delivery di vaccini. Nel nostro gruppo, un sistema di erogazione creata da combinando ramificato polietilenimmina 25-kDa (PEI) e nanoparticelle di ossido di ferro superparamagnetiche (MNP) legati insieme da interazione biotina-streptavidina 9. Questo vettore è un potenziale strumento per l&#39;ingegneria genetica di cellule, consentendo loro magnetizzazione simultanea prima del trapianto. Quest&#39;ultimo fornisce una base per magnetico orientamento / ritenzione, che è particolarmente promettente al giorno d&#39;oggi, come tecniche avanzate di targeting magnetici si stanno sviluppando con successo 10. Inoltre, le risultanti cellule magneticamente sensibili hanno il potenziale di essere non invasivo monitorato da risonanza magnetica (MRI) o immagini di particelle magnetiche 11, 12. Nel caso del vettore PEI / MNP, poliammina assicura condensazione di acido nucleico e quindi la protezione dal fattore degradanti<html> s, vettore internalizzazione nelle cellule, e endosomali fuga 5. Il MNPs completano le proprietà di PEI, non solo in termini di orientamento magnetico, ma anche riducendo il noto tossicità PEI 7, 13, 14. In precedenza, PEI / MNP proprietà vettoriali sono stati regolati in termini di efficienza di consegna (cioè, pDNA e miRNA) e sicurezza utilizzando fibroblasti e cellule staminali mesenchimali umane 15, 16. In questo manoscritto, un protocollo dettagliato sull&#39;applicazione della PEI / MNPs per la generazione di cellule miRNA-modificata viene descritto 17. Per questo scopo, vengono utilizzate HUVEC e rappresentano un modello stabilito per l&#39;angiogenesi in vitro. Sono impegnativo per trasfettare e sono suscettibili di influenza tossica 18, 19,ass = &quot;xref&quot;&gt; 20. Inoltre, mettiamo a disposizione un algoritmo per valutare tali cellule in vitro, compresa la loro targeting, la comunicazione intercellulare, e la rilevazione risonanza magnetica.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Fino ad oggi, i trattamenti chirurgici e farmacologici disponibili per le malattie cardiovascolari (CVD) sono limitati e spesso palliative. Allo stesso tempo, terapie geniche e cellulari sono approcci alternativi promettenti per il trattamento CVD. Tuttavia, l&#39;ampia applicazione clinica della terapia genica è fortemente limitato dalla mancanza di idonei sistemi di trasferimento genico. Lo sviluppo di adeguate vettori di trasferimento genico in grado di fornire una soluzione alle sfide attuali in terapia cellulare. In particolare, gli svantaggi esistenti, come l&#39;efficienza limitata e ritenzione delle cellule di basso nell&#39;organo danneggiato, potrebbero essere superati mediante l&#39;ingegneria cella appropriata (cioè, genetica) prima del trapianto. Il protocollo presentato descrive la modificazione transitoria efficiente e sicura delle cellule endoteliali mediante una nanoparticella polietilenimmina superparamagnetico magnetico (PEI / MNP) consegna basata su vettore. Inoltre, l&#39;algoritmo e metodi per la caratterizzazione delle cellule sono definite. Il successo intracelluconsegna LAR di microRNA (miR) nella vena ombelicale cellule endoteliali umane (HUVEC) è stato raggiunto senza compromettere la vitalità cellulare, la funzionalità, o comunicazione intercellulare. Inoltre, questo approccio è stato dimostrato di causare un forte effetto funzionale esogeno introdotto miR. È importante sottolineare che l&#39;applicazione di questo vettore MNP-based assicura magnetizzazione cella, con possibilità di targeting magnetico e non invasivo MRI tracing accompagnamento. Questo può fornire una base per magneticamente guidate, terapie cellulari geneticamente ingegnerizzati che possono essere monitorati in modo non invasivo con MRI.

Lo scopo principale del protocollo proposto è di produrre risposte magnetiche cellule miR-modificati e condurre loro caratterizzazione accurata (Figura 1). Di conseguenza, le cellule in modo efficiente trasfettate, sensibili alla selezione magnetica e di orientamento e rilevabili con la risonanza magnetica, devono essere ottenuti. In primo luogo, le identità di HUVEC isolati sono stati confermati mediante colorazione tipica con il CD31 marcatore endoteliale (PECAM) (Figura 2A) e dalla loro capacità di formare tubi sulla matrice membrana basale appropriata (Figura 2B). Le cellule ottenute hanno preso il miR introdotto da PEI / MNP molto efficiente; La microscopia ha dimostrato che tutte le cellule erano positive per un segnale di etichettato miR (Cy3) 24 ore dopo la trasfezione (Figura 3A). Soprattutto, nessuna morte cellulare è stata registrata rispetto alle cellule non trattate (Figura 3B), e nAspetto ormal stata mantenuta (Figura 3A). Come osservato con microscopio confocale a scansione laser, il segnale di Cy3-miR è stato principalmente situato all&#39;interno delle cellule. Inoltre, un esame più dettagliato della localizzazione intracellulare di tutte le parti del vettore trasfezione e miR stata effettuata con maggiore risoluzione usando 3-colore complessi marcati. SIM, Mir, PEI, e MNP segnali sono stati tutti rilevati nel citoplasma della regione perinucleare (Figura 3C). Inoltre, un esame dettagliato di sicurezza trasfezione vettore ha dimostrato che miR / PEI / MNP-HUVEC sono in grado di formare tubi sulla matrice membrana basale appropriato e che la rete risultante è paragonabile a quello delle cellule non trattate utilizzate come controllo positivo (Figura 4A ). Inoltre, le cellule trasfettate mantenute GJIC, come esperimenti 3D-FRAP rivelato. In particolare, quando le cellule vengono caricati con fluorescente GJ-Permeacolorante ble e uno di essi viene sbiancata, sua fluorescenza recupera causa della comunicazione con le cellule vicine e il trasferimento del colore risultante (Figura 4B). Soprattutto, per la presenza del superparamagnetico composto 40 (Figura 5A), applicazione PEI / MNP permette non solo trasfezione delle cellule, ma anche la magnetizzazione simultanea. La quantità risultante di ferro intracellulare è stata misurata utilizzando MPS (Figura 5B) per tutte le concentrazioni MNP applicati entro l&#39;intervallo ottimale (2,5 pmol / cm 2 miR; NP 25 complementata con 5-25 ug / mL MNP): 0,37 ± 0,079 a 0,7 ± 0,150 pg ferro / cellulare 17. Poiché l&#39;utilizzo di colonne di separazione magnetica dimostrato, per tutte queste concentrazioni MNP, la quantità di cellule magneticamente sensibili nel volume totale delle cellule trasfettate è ~ 70% (Figura 5C). Inoltre, transfettate HUVECs sono visibili con la risonanza magnetica (Figura 5D) all&#39;interno di agarosio in vitro fantasmi, imitando suscettibilità tessuti mouse. Inoltre, targeting magnetico di HUVEC trasfettate in condizioni dinamiche simulate in vitro è stato dimostrato di essere efficace (Figura 6). In questa configurazione sperimentale, anche il vigoroso movimento continuo di terreno di coltura non impedisce la crescita cellulare prevalente nella zona vicino applicazione del magnete. <img alt="Figura 1" src="/files/ftp_upload/55567/55567fig1.jpg" /> Figura 1. Schema Illustrazione della produzione di HUVECs magnetizzato miR-modificati e la loro analisi. Il PEI / MNP (polietilenimminica / vettore a base di nanoparticelle superparamagnetico) viene applicato per fornire microRNA (miR) per le cellule umane ombelicale vena endoteliali (HUVEC). Il prodotto cellulare ottenuta è caratterizzato dai seguenti parametri: sicurezza (compresa la vitalità cellulare, funzionalelità e capacità di comunicazione intercellulare); efficienza di trasfezione (cioè, miR efficienza di assorbimento e la funzionalità in seguito); magnetico targeting in vitro in condizioni dinamiche e statiche simulate; la risonanza magnetica (MRI) di rilevamento. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig1large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="figura 2" src="/files/ftp_upload/55567/55567fig2.jpg" /> Figura 2. Caratterizzazione dei isolata HUVEC. A. Immagine rappresentativa della HUVECs isolate e coltivate colorate con marcatore CD31 endoteliale. I nuclei sono di contrasto con DAPI (blu). La barra della scala è 20 um. Risultato B. rappresentativa del saggio formazione del tubo eseguita su isolato HUVECs; l&#39;immagine è stata registrata usando un microscopio confocale a scansione laser (inter differenzialeferenza contrasto) 18 ore dopo la semina delle cellule sulla matrice membrana basale. La barra della scala è di 100 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig2large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" src="/files/ftp_upload/55567/55567fig3.jpg" /> Figura 3. miR consegna di HUVEC utilizzando PEI / MNP. A. L&#39;assorbimento di targhetta miR (Cy3, rosso) 24 ore dopo la trasfezione (2,5 pmol / cm 2 di Cy3-contrassegnati miR, NP 25 e MNP 25 ug / mL) e la manutenzione di aspetto normale cella sono illustrati. Immagini sono state prese da microscopio confocale a scansione laser con un 514-nm laser di eccitazione (Cy3, rosso) e contrasto interferenziale differenziale. La barra della scala è 50 um. B. La vitalità cellulare 24 h post-trasfezione è stata valutata mediante citometria di flusso. La trama rappresenta i risultati ottenuti per HUVECs trattati con le seguenti composizioni complesse: 2,5 pmol / cm 2 di Cy3-miR; NP rapporto 25 integrato con 5 a 25 ug / mL di MNPs. Le barre rappresentano il rapporto tra il numero medio di cellule vitali e l&#39;intera popolazione di cellule (n = 6; barre di errore: SEM). C. Strutturato illuminazione microscopia (SIM) imaging 3-colore etichettato complessi miR / PEI / MNP assunte da HUVEC. Le cellule sono state transfettate come descritto sopra, incubato, e fissato 24 h dopo il trattamento; i nuclei sono stati di contrasto con DAPI. dati grezzi SIM sono stati registrati in z-stack ed elaborati; le immagini rappresentative sono il risultato della proiezione massima intensità. Sono stati applicati i seguenti laser di eccitazione: 405 nm (DAPI, blu), 488 nm (Atto488-PEI, arancio), 565 nm (Atto565-MNP, ciano) e 633 nm (Cy5-miR, rosso). La barra della scala è 5 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig3large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 4" src="/files/ftp_upload/55567/55567fig4.jpg" /> Figura 4. La sicurezza degli HUVECs modifica con miR / PEI / MNP. A. Un saggio di formazione del tubo è stata eseguita con le cellule trasfettate (2,5 pmol / cm 2 di SCR-MIR NP 25 e MNP 25 ug / mL) 48 h post-trattamento. Immagini sono state acquisite con un microscopio confocale a scansione laser (cioè differenziale contrasto interferenziale) 18 ore dopo semina delle cellule su matrici membrana basale. HUVEC trasfettate con miR / PEI sono stati usati come controllo tossicità e cellule non trattate come controllo positivo. La barra della scala è di 100 um. La trama rappresenta il rapporto tra le cellule HUVEC trasfettate e le cellule non trattate utilizzando diversi parametri: lunghezza del tubo, il numero di rami, e giunzioni (n = 3, le barre di errore: SEM). B. La giunzione mediata comunicazione intercellulare gap di miR / PEI / MNP modificato HUVEC è stata valutata 24 ore dopo l&#39;transfeczione. Per questo scopo, le cellule sono state caricate con il calceina colorante GJ-permeabile (arancione); recupero di fluorescenza dopo photobleaching (FRAP) è stata esaminata in 3D da celle di scansione di test in z-stack. Immagini rappresentative di cellule calceina-caricato prima del candeggio, direttamente dopo lo sbiancamento, e 15 minuti post-candeggio (con fluorescenza recuperati) sono raffigurati. La barra della scala è 20 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig4large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 5" src="/files/ftp_upload/55567/55567fig5.jpg" /> Figura 5. cellulare magnetizzazione risultante dalla trasfezione con PEI / MNP e la sua applicazione. A. immagine rappresentativa del filtrato MNPs, preso con TEM, illustrando loro morfologia cluster. Una piccola taglia (~ 5 - 15 nm) di particelle di ossido di ferro singoli (con conseguente superparamagnetismo) è quindiconfermato. La barra della scala è di 100 nm. B. Il caricamento intracellulare delle cellule trasfettate è stata valutata mediante spettroscopia particella magnetica (MPS) 24 ore dopo la trasfezione. Il gruppo rappresentativo raffigura lo spettro MPS di campioni esaminati. In particolare, la sospensione puro MNP (50 mL) è servita da riferimento (quadrati blu); i cerchi sono gli spettri MPS di due campioni transfettate cellule (cerchi rossi: MNP 25 ug / mL; cerchi verdi: MNP 5 ug / mL), mentre i triangoli grigi mostrano lo spettro di fondo rilevato ottenuto da una misura senza alcun campione. Notare la scala logaritmica l&#39;ampiezza (A). C. La quantità di cellule magneticamente modificata è stata quantificata mediante l&#39;applicazione di HUVEC trasfettate (2,5 pmol / cm 2 miR; NP 25 complementata con 5-25 ug / mL di MNP), raccolte mediante tripsinizzazione 24 h post-trattamento, per un magnetico colonna di separazione cellulare. La risultante frazione magneticamente positivo (cioè, che è rimasta nella colonna)è stato contato, e la sua percentuale su tutta la quantità di cellule transfettate si riflette sul terreno per ciascuna concentrazione MNP (triangoli rossi). La vitalità cellulare è stata successivamente esaminata dal Trypan saggio di esclusione del blu (rombi grigi). I dati sono presentati come media ± SEM (n = 3). D. L&#39;immagine illustrativo MRI transfettate cellule HUVEC (300.000 cellule; 2,5 pmol / cm 2 miR; NP 25 e 25 ug / mL di MNP) incorporato in un fantoccio agarosio è stato registrato con un sistema MRI animale 7.1 T. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig5large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 6" src="/files/ftp_upload/55567/55567fig6.jpg" /> Figura 6. In Vitro magnetica Targeting di miR / PEI / MNP-HUVEC in simulate condizioni dinamiche. HUVECs sono stati raccolti 24 h post-trasfezioneion (2,5 pmol / cm 2 di Cy3-miR; NP 25 e MNP 25 ug / mL) e ri-inoculate in un terreno di coltura fresco nei pozzetti, con un piccolo magnete collegata localmente alla parete laterale. A sua volta, questa piastra di coltura è stato fissato ad un agitatore rotante a 150 rpm. attaccamento cellulare e la crescita sono stati valutati 12 ore dopo fissando cellule con PFA, colorazione loro nuclei con DAPI, e l&#39;esecuzione di scansione laser confocale (laser di eccitazione: 405 nm, DAPI, blu, 514 nm, Cy3, arancione). Immagini rappresentative raffigurano la crescita delle cellule della zona, con applicazione del magnete; senza applicazione del magnete; e nel centro della cultura pozzo, dove il flusso di liquido è stato concentrato cellule. Le barre scala sono 50 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55567/55567fig6large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a>

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Questo manoscritto descrive l&#39;erogazione efficiente, non virale miR alle cellule endoteliali da un vettore PEI / MNP e la loro magnetizzazione. Così, oltre alla modificazione genetica, questo approccio consente di orientamento delle cellule magnetica e risonanza magnetica rilevabilità. La tecnica può essere utilizzata per migliorare le caratteristiche dei prodotti cellulari terapeutici.

preparazione e<em&gt; In Vitro</em&gt; Caratterizzazione di magnetizzato miR-modificato cellule endoteliali

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Nanyang Technological University

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K Views.  University of Rostock.  Questo manoscritto descrive l'erogazione efficiente, non virale miR alle cellule endoteliali da un vettore PEI / MNP e la loro magnetizzazione. Così, oltre alla modificazione genetica, questo approccio consente di orientamento delle cellule magnetica e risonanza magnetica rilevabilità. La tecnica può essere utilizzata per migliorare le caratteristiche dei prodotti cellulari terapeutici. 

Video: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full thickness corneal transplantation has been the treatment to restore sight in those limited by corneal disease. Some disadvantages to this approach include a high degree of post-operative astigmatism, lack of predictable refractive outcome, and disturbance to the ocular surface. The development of Descemet's stripping endothelial keratoplasty (DSEK), transplanting only the posterior corneal stroma, Descemet's membrane, and endothelium, has dramatically changed treatment of corneal endothelial disease. DSEK is performed through a smaller incision; this technique avoids 'open sky' surgery with its risk of hemorrhage or expulsion, decreases the incidence of postoperative wound dehiscence, reduces unpredictable refractive outcomes, and may decrease the rate of transplant rejection3-6.
Initially, cornea donor posterior lamellar dissection for DSEK was performed manually1 resulting in variable graft thickness and damage to the delicate corneal endothelial tissue during tissue processing. Automated lamellar dissection (Descemet's stripping automated endothelial keratoplasty, DSAEK) was developed to address these issues. Automated dissection utilizes the same technology as LASIK corneal flap creation with a mechanical microkeratome blade that helps to create uniform and thin tissue grafts for DSAEK surgery with minimal corneal endothelial cell loss in tissue processing.
Eye banks have been providing full thickness corneas for surgical transplantation for many years. In 2006, eye banks began to develop methodologies for supplying precut corneal tissue for endothelial keratoplasty. With the input of corneal surgeons, eye banks have developed thorough protocols to safely and effectively prepare posterior lamellar tissue for DSAEK surgery. This can be performed preoperatively at the eye bank. Research shows no significant difference in terms of the quality of the tissue7 or patient outcomes8,9 using eye bank precut tissue versus surgeon-prepared tissue for DSAEK surgery. For most corneal surgeons, the availability of precut DSAEK corneal tissue saves time and money10, and reduces the stress of performing the donor corneal dissection in the operating room. In part because of the ability of the eye banks to provide high quality posterior lamellar corneal in a timely manner, DSAEK has become the standard of care for surgical management of corneal endothelial disease.
The procedure that we are describing is the preparation of the posterior lamellar cornea at the eye bank for transplantation in DSAEK surgery (Figure 1).

Endothelial corneal transplantation is a surgical technique for treatment of posterior corneal diseases. Mechanical microkeratome dissection to prepare tissue results in thinner, more symmetric grafts with less endothelial cell loss and improved outcomes. Dissections can be performed at the eye bank prior to corneal transplantation surgery.

Preparazione del tessuto corneale dei donatori per Keratoplasty Endothelial

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Ricerca

Medicina

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Differenziazione Isolamento, caratterizzazione e comparata delle cellule umane Dental Pulp staminali derivate da denti permanenti mediante due diversi metodi

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying mechanisms involved in it are useful for treatment. There are both in vivo and in vitro methods available for this purpose. In vivo models can mimic actual head injury as it occurs during TBI. However, in vivo techniques may not be exploited for studies at the cell physiology level. Hence, in vitro methods are more advantageous for this purpose since they provide easier access to the cells and the extracellular environment for manipulation.
Our protocol presents an in vitro model of TBI using stretch injury in brain microvascular endothelial cells. It utilizes pressure applied to the cells cultured in flexible-bottomed wells. The pressure applied may easily be controlled and can produce injury that ranges from low to severe. The murine brain microvascular endothelial cells (cEND) generated in our laboratory is a well-suited model for the blood brain barrier (BBB) thus providing an advantage to other systems that employ a similar technique. In addition, due to the simplicity of the method, experimental set-ups are easily duplicated. Thus, this model can be used in studying the cellular and molecular mechanisms involved in TBI at the BBB.

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

In vitro traumatic brain injury models are being developed to reproduce in vivo brain deformation. Stretch-induced injury has been employed for astrocytes, neurons, glial cells, aortic, and brain endothelial cells. However, our system uses a blood brain barrier (BBB) model that possesses properties constituting a legitimate model of the BBB to establish an in vitro&#160;TBI model.

Stretch in microvascolari cerebrali cellule endoteliali (CEND) come<em&gt; In Vitro</em&gt; Trauma cranico modello della barriera ematoencefalica

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to extravasate and form a secondary niche.&#160;The extravasation of tumor cells from the blood vascular system can be studied using endothelial cells (ECs) and tumor cells obtained from different cell lines.&#160;Initial studies were conducted using static conditions but it has been well documented that ECs behave differently under physiological flow conditions.&#160;Therefore, different flow chamber assemblies are currently being used to studying cancer cell interactions with ECs.&#160;Current flow chamber assemblies offer reproducible results using either different cell lines or fluid at different shear stress conditions.&#160;However, to observe and study interactions with rare cells such as circulating tumor cells (CTCs), certain changes are required to be made to the conventional flow chamber assembly.&#160;CTCs are a rare cell population among millions of blood cells. Consequently, it is difficult to obtain a pure population of CTCs.&#160;Contamination of CTCs with different types of cells normally found in the circulation is inevitable using present enrichment or depletion techniques.&#160;In the present report, we describe a unique method to fluorescently label circulating prostate cancer cells and study their interactions with ECs in a self-assembled flow chamber system.&#160;This technique can be further applied to observe interactions between prostate CTCs and any protein of interest.

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Our report describes a unique method to visualize and analyze CTC/EC interactions in prostate cancer under physiological flow conditions.

Nel metodo in vitro per osservare le interazioni E-selectina-mediata Tra prostata cellule tumorali circolanti derivate da pazienti e Cellule endoteliali umane

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, along with its basement membrane (Descemet&#39;s membrane) is introduced onto the recipient&#39;s posterior stroma3. Unlike Descemet&#8217;s Stripping Automated Endothelial Keratoplasty (DSAEK), where additional donor stroma is introduced, no unnatural stroma-to-stroma interface is created. As a result, the natural anatomy of the cornea is preserved as much as possible allowing for improved recovery time and visual acuity4. Endothelial Keratoplasty (EK) is the procedure of choice for treatment of endothelial dysfunction. The advantages of EK include rapid recovery of vision, preservation of ocular integrity and minimal refractive change due to use of a small, peripheral incision1. DSAEK utilizes donor tissue prepared with partial thickness stroma and endothelium. The rapid success and utilization of this procedure can be attributed to availability of eye-bank prepared precut tissue. The benefits of eye-bank preparation of donor tissue include elimination of need for specialized equipment in the operating room and availability of back up donor tissue in case of tissue perforation during preparation. In addition, high volume preparation of donor tissue by eye-bank technicians may provide improved quality of donor tissue. DSAEK may have limited best corrected visual acuity due to creation of a stromal interface between the donor and recipient cornea. Elimination of this interface with transplantation of only donor Descemet&#39;s membrane and endothelium in DMEK may improve visual outcomes and reduce complications after EK5. Similar to DSAEK, long term success and acceptance of DMEK is dependent on ease of availability of precut, eye-bank prepared donor tissue. Here we present a stepwise approach to donor tissue preparation which may reduce some barriers eye-banks face in providing DMEK grafts.

Endothelial keratoplasty is a surgical technique continuously evolving as advancements result in transplantation of thinner grafts with each succession1. Here we present a technique for controlled manual tissue dissection to allow safe and repeatable separation of endothelium and Descemet&#39;s membranes from donor corneoscleral buttons for transplantation2.

Corneale Preparazione donatore di tessuti per di Descemet Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The approach allows unbiased identification and functional characterization of individual colorectal afferents. Extracellular recordings of propagated action potentials (APs) that originate from one or a few afferent (i.e., single-fiber) receptive fields (RFs) in the colorectum are made from teased nerve fiber fascicles. The colorectum is removed with either the pelvic (PN) or lumbar splanchnic (LSN) nerve attached and opened longitudinally. The tissue is placed in a recording chamber, pinned flat and perfused with oxygenated Krebs solution. Focal electrical stimulation is used to locate the colorectal afferent endings, which are further tested by three distinct mechanical stimuli (blunt probing, mucosal stroking and circumferential stretch) to functionally categorize the afferents into five mechanosensitive classes. Endings responding to none of these mechanical stimuli are categorized as mechanically-insensitive afferents (MIAs). Both mechanosensitive and MIAs can be assessed for sensitization (i.e., enhanced response, reduced threshold, and/or acquisition of mechanosensitivity) by localized exposure of RFs to chemicals (e.g., inflammatory soup (IS), capsaicin, adenosine triphosphate (ATP)). We describe the equipment and colorectum&#8211;nerve recording preparation, harvest of colorectum with attached PN or LSN, identification of RFs in the colorectum, single-fiber recording from nerve fascicles, and localized application of chemicals to the RF. In addition, challenges of the preparation and application of standardized mechanical stimulation are also discussed.

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates a protocol for conducting single-fiber electrophysiological recordings on an in vitro mouse colorectum-nerve preparation.

In vitro Caratterizzazione funzionale del topo colorettale Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Studiare cancro del pancreas staminali caratteristiche cellulari per lo sviluppo di nuove strategie di trattamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

Isolamento e cultura espansione delle cellule endoteliali tumore-specifici

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Isolamento e coltura di cellule endoteliali primarie dalle arterie e vene Canine

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin indotta Gonfiore intestinale organoidi: An<em&gt; In Vitro</em&gt; Test per la valutazione della risposta farmacologica nella fibrosi cistica pazienti

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...