תמיכה עבור פרויקט זה במימון סופק על-ידי התוכנית מחקר מדעי בסיסי דרך לאומי מחקר קרן של קוריאה (ב- NRF) ממומן על ידי משרד המדע ICT (2016R1A2B2006354).

1. הכנת מדיה
<ol><li>להכין תמצית שמרים עם תוספי מזון (כן), כן ללא אדנין (כן נמוך אייד), בינוני הביקוע גלוטמט (PMG12), וכן PMG ללא אדנין (PMG-אייד) על ידי ערבוב המרכיבים כפי שמתואר בטבלה 1. כן-אייד (איד נמוכה) ו לוחות PMG איד יש את כל המרכיבים אותו, אבל אדנין מושמט מן האחרון.<ol>
<li>השתמש המניה מלח (50 x) הבאות: 52.5 g/L MgCl2·6H2O 2 g/L CaCl2·2H2O, 50 גרם/ליטר אשלגן כלורי, 2 g/L נה2כך4 ב מים מזוקקים. מסנן לחטא באמצעות מסנן גודל הנקבוביות 0.22-מיקרומטר ולאחסן ב 4 º C.</li>
		<li>השתמש ויטמין הבאים (1, 000 x) מניות: 1 g/L pantothenate 10 גרם/ליטר nicotinic חומצה, אינוסיטול 10 גרם/ליטר, ביוטין 10 mg/L במים מזוקקים. מסנן לחטא באמצעות מסנן גודל הנקבוביות 0.22-מיקרומטר ולאחסן ב 4 º C.</li>
		<li>השתמש המינרל הבאים (10, 000 x) מניות: חומצה בורית 5 g/L, MnSO 4 g/L4,4·7H ZnSO 4 g/L2O, 2 g/L FeCl2·4H2O, MoO 0.4 g/L3, 1 g/L קי, 0.4 g/L CuSO4·5H2O , 10 גרם/ליטר חומצת לימון במים מזוקקים. מסנן לחטא באמצעות מסנן גודל הנקבוביות 0.22-מיקרומטר ולאחסן ב 4 º C. הערה: בינוני נוזלי כן יכולה להיעשות על-ידי השמטת את אגר.</li>
	</ol>
</li>
	<li>אוטוקלב המדיום לקרר אותו אל מתחת 60 ° C תוך כדי ערבוב עם בר stir, בקצב של 200 סל ד.</li>
	<li>עבור לוחות כן + G418 (geneticin), להוסיף 1 מ"ל/L G418 פתרון מניות המדיום. כן.<ol>
<li>להשתמש את G418 הבאים (1, 000 x) מניות: 100 מ"ג/מ"ל G418 במים מזוקקים. מסנן לחטא באמצעות מסנן גודל הנקבוביות 0.22-מיקרומטר, aliquot 1.5 mL צנטריפוגה צינורות, חנות ב-20 ° C.</li>
	</ol>
</li>
	<li>מערבבים עוד 5-10 דקות, aliquot התקשורת 90-מ מ פטרי (1 ליטר של aliquots בינוני עד בערך 40 פטרי. חנות את הלוחיות ב 4 º C.</li>
</ol>2. שיבוט של rpt4 + ו שלה 5' / 3' UTRs
<ol><li>לבצע PCR עם תחל p1 ו- p2 (איור 1 א') באמצעות ביקוע שמרים הדנ א (gDNA) כמו התבנית הנפח הכולל של 50 µL (~ 1 µg ה-DNA, האנזים U 20, 1 x תגובת מאגר), ולאחר החלת את מחזורי התגובה המתוארות בטבלה 2 כדי להגביר 3,315-בסיס פרגמנט זוג (bp) הכוללת rpt4 + ו שלה 5' / 3' UTRs. לטהר את מוצר ה-PCR באמצעות של ערכת טיהור13 לפי הוראות היצרן (איור 1 א').</li>
	<li>לעכל את וקטור KS(-) pBlueScript14 ו את מקטע ה-DNA מוגבר המכיל rpt4 + עם שלה 5' / 3' UTRs עם BamH1 ו Xho1 ב הנפח הכולל של 20 µL (DNA ~ 1 µg, אנזים U 20, 1 x עיכול מאגר) ב 37 מעלות צלזיוס בתוך אמבט מים במשך 16-18 h (איור 1B).</li>
	<li>ג'ל לטהר את הווקטור מעוכל (1.2% agarose ג'ל) והכנס את הדנ א על ידי ביצוע מבוסס-טה agarose בג'ל (100 וולט, 1 h), excising הלהקות הדנ א של גודל הרצוי לבודד את ה-DNA עם ערכת חילוץ ג'ל15.</li>
	<li>מאתרים ומפסיקים את וקטור והוספה הדנ א באמצעות T4 DNA ליגאז על-ידי ביצוע תגובה מצדו 20-µL המכיל 50-100 ננוגרם של וקטור ה-DNA, ~ 3-fold טוחנת עודף של ה-DNA של הוספה, 400 U T4 DNA ליגאז 1 x מאגר מצדו. דגירה תערובת זו ב 18 מעלות צלזיוס במשך 16-18 h.</li>
	<li>להפוך את ה-DNA מחוברים µL 100 של e. coli DH5α על-ידי החלת הלם חום עבור 70 s-42 ° C. להוסיף 1 מ"ל של ליברות, תקופת דגירה של h 1 ב 37 מעלות צלזיוס להתאוששות. לבצע צנטריפוגה (13,800 x g), למחוק את הצלחת supernatant, כל טרנספורמציה e. coli תאים על צלחות LB-אמפיצילין (LA), של דגירה ב 37 מעלות צלזיוס במשך 16 שעות.</li>
	<li>לבחור 4-8 מושבות עם קיסמים ולגדול בן לילה ב 37 ° C 3 מ ל LA בינוני.</li>
	<li>לבודד את פלסמידים עם פלסמיד טיהור ערכת16 בשימוש על פי הפרוטוקול של היצרן ולבצע digestions אנליטית אנזים הגבלה עם 5 µL של פלסמיד מבודד, 5 U של כל אנזים הגבלה (BamH1 , Xho1) ו- 1 x מאגר ההגבלה. דגירה תערובת התגובה ב 37 מעלות צלזיוס בתוך אמבט מים עבור 3 ח' אשר השיבוט על-ידי קביעת רצף המועמד פלסמידים.</li>
</ol>3. החדרת מוטציה שקטה (Xho1 הגבלת האתר)
<ol><li>עיצוב זוג תחל 33-bp (p3 ו- p4) המכילים את השינוי הרצוי ברצף אחרת משלימים.</li>
	<li>לבצע PCR עם אמינות גבוהה פולימראז17 (איור 1C) בהנפח הכולל של 25 µL (10 ng של פלסמיד משובטים, 2 µL pmol פריימר מיקס 10, אנזים U 2, 1 x תגובת מאגר) באמצעות אופניים הפרמטרים המפורטים בטבלה3.</li>
	<li>לעכל את פלסמיד תבנית עם Dpnאני בהנפח הכולל של µL 20 (20 U אנזים, 1 x עיכול מאגר) ב- 37 מעלות צלזיוס ב מים אמבט 1 h.</li>
	<li>לשנות, להפיץ, לבודד, רצף של פלסמיד המכיל את מוטציה שקטה, כמתואר בצעדים 2.5-2.7. הערה: מוטציה שקטה יכולה גם הציג באמצעות שיטת השיבוט המאפשר חיבור שברי DNA מרובים התגובה יחיד18.</li>
</ol>4. אקראי מוטגנזה מכוונת של rpt4 + מאת PCR לשגיאות
<ol><li>לבצע PCR לשגיאות, באמצעות פלסמיד את המוטציה שקט (אתרXho1 ) התבנית, תחל p5 ו- p6, הנפח הכולל של 50 µL (כמות תבנית מוגדרת בשלב 4.1.1, 2 µL 10 pmol פריימר מיקס, אנזים U 2.5, מאגר התגובה x 1) , ואת פולימראז מיוחד אשר נועד ליצור שגיאת גבוה שיעור19 (איור 1D). לבצע PCR כפי שמתואר בטבלה 2.<ol>
<li>השתמש µg 4-5 של תבנית פלסמיד לשלוט תדירות מוטציה ל bp 1/kb (kilobase). הערה: ריכוז גבוה (> 500 ng/µL) של פלסמיד, אשר ניתן לקבל באמצעות ערכת הכנה מיני20, נדרש.</li>
	</ol>
</li>
	<li>להשתמש בג'ל כדי לאשר מוצר ה-PCR של 2670 bp (1.2% agarose ג'ל). ג'ל לטהר המוצר PCR כפי שמתואר בשלב 2.5.</li>
</ol>5. הכנה של פיוז'ן PCR קטעים (קאן, 3' UTR)
<ol><li>לבצע PCR באמצעות pFA6a-KANMX621 תבנית, תחל p7 ו p8, התנאים המפורטים בטבלה 4 כדי לקבל השבר סמן (קאן). ג'ל לטהר השבר 1,480-bp וכתוצאה מכך כפי שמתואר בשלב 2.5 (איור 1E).<ol>
<li>בדוק אם stop codon של הגן שמיועד מוטציה ובאזור קידוד של גנים סמוכים שלה מופרדים על-ידי יותר מ-500 bp. לא ניתן להשתמש המחסל אנדוגני כאשר אזור זה הוא פחות מ 500 bp; במקום זאת, המחסל ADH אמור לשמש במקום המחסל אנדוגני. השינויים פרוטוקול נדרש להשתמש המחסל ADH מוצגים בטבלה 5. הערה: שינויים אלה חל רק כאשר המחסל ADH , אשר זמין פלסמיד pFA6a-3HA-KANMX6, משמש במקום המחסל אנדוגני.</li>
	</ol>
</li>
	<li>לבצע PCR עם משובטים rpt4 +-שמכיל וקטור p9 תבנית ואת צבעי בסיס, p10 ב הנפח הכולל של 50 µL (20 ng את פלסמיד משובטים, 2 µL pmol פריימר מיקס 10, אנזים U 2, 1 x תגובת מאגר), להשתמש בתנאים המוצגים טבלה 6. ג'ל לטהר שהושג 506-bp 3' UTR השבר (איור 1E).</li>
</ol>6. דור של הבונה השינוי על ידי היתוך PCR (איור 1E)
<ol><li>להכין את השברים 3 (mutagenized rpt4 +קאן, את 3' UTR) ב- 50 ng/µL.</li>
	<li>לבצע היתוך ש-PCR של השלושה קטעים באמצעות תחל p11 ו- p12, כפי שמתואר בטבלה 7. (הפרוטוקול עבור פיוז'ן PCR הוא שינוי של הפרוטוקול המקורי22). לטהר המוצר העיקרי של ה-PCR 4,398-bp.<ol>
<li>השתמש rpt4 +: KAN:3'UTR קטעים ביחס של 1:3:1 לקבלת תוצאות אופטימליות. הערה: הסכום הכולל של ה-DNA הוספה לא יעלה על 500 ng. הכמות המומלצת של rpt4 +: KAN:3'UTR הוא 50 ng:150 ng:50 ng. האזור mutagenized הוא כ- 1.6 קילו, אז המספר המינימלי של מושבות שמרים זה היה חשבון על כל השילובים האפשריים של כל בסיס להיות מוטציה לשלושה האחרים הוא 1,600 x 3 = 4,800 מושבות. כי התגובה טרנספורמציה אחת מניבה בדרך כלל המושבות 400-500, התגובות לפחות 10 שווה של פיוז'ן PCR לבנות נדרשת. צורך זה יכולים להתקיים על ידי פשוט הגדלת הסכום התגובה (קרי, מספר המבחנות) לפי פקטור של 10.</li>
	</ol>
</li>
</ol>7. שינוי של שמרים ביקוע על ידי אלקטרופורציה (איור 1F)
<ol><li>לחסן שמרים עד 10 מ"ל של כן בינוניים עד רוויה מאת המקננת זה עבור יותר מ 16 h.</li>
	<li>לדלל לתאים צפיפות אופטית על 600 nm (OD600) של 0.2 ב 200 מ ל כן בינוני דגירה ב 30 מעלות צלזיוס ברעידות עבור h 5-6, כדי OD600 = 0.6 - 0.8.</li>
	<li>להתרכז לתאים OD600 = 30, לוותר על ארבעה צינורות חרוט 50-mL ולהירגע על קרח למשך 10 דקות.</li>
	<li>לקצור את התאים על ידי ביצוע צנטריפוגה ב 1,050 x g עבור מינימום 3-4 מעלות צלזיוס. מניחים את הצינורות, אלקטרו 10-וואקום על קרח. בצע את השלבים 7.3-7.8 על קרח.</li>
	<li>למחוק את תגובת שיקוע והוסף 15 מ"ל של 1.2 מ' בסורביטול. ללחוץ בעדינות את הצינורות כדי resuspend את התאים.</li>
	<li>Centrifuge התאים ב- g x 1050 עבור מינימום 3-4 מעלות צלזיוס.</li>
	<li>חזור על שלבים 7.4 ו- 7.5. למחוק את תגובת שיקוע. להוסיף 500 µL של 1.2 מ' בסורביטול כל שפופרת, resuspend את התאים, וכן לאסוף את כל התאים אחד צינור חרוטי 15-ml.</li>
	<li>להוסיף בסורביטול 1.2 מ' עד 2.4 מ ל (OD600 = 10 0.2 מ"ל). שמור את הצינורית על קרח.</li>
	<li>להוסיף 200 µL של תאים בסורביטול-הושעתה (ודא שהם מושעים באופן מלא) צניעותו EP המכיל הפיוז'ן PCR לבנות, מערבבים היטב, להעביר את הדגימה אלקטרו-cuvette.</li>
	<li>Electroporate התאים עם האפשרויות הבאות: פטריות, ShS (2.00kV, הדופק 1).</li>
	<li>להוסיף µL 600 של 1.2 מ' בסורביטול כל אלקטרו-cuvette עבור הנפח הכולל של 800 µL, ופרש לאחר מכן התאים על כן ארבעה לוחות (µL 200/צלחת). אלקטרו עשר-וואקום אחלק ל-40 כן צלחות.</li>
	<li>דגירה הלוחות ב 30 מעלות צלזיוס במשך 24 שעות ביממה.</li>
	<li>לבצע ציפוי משוכפל כדי כן + G418, דגירה הלוחות ב 30 מעלות צלזיוס למשך 3 ימים.</li>
</ol>8. מבחר של יציב הטרוכרומטין מוטציות, בדיקת תוצאות חיוביות שגויות
<ol><li>על כל צלחת כן + G418, לבצע ציפוי משוכפל כן-אייד (איד נמוך), צלחות PMG-אייד (לא אייד). תקופת דגירה הלוחות עותק משוכפל של 1-2 ימים ב- 30 מעלות צלזיוס, עד הופעה כלשהי של המושבות על לוחות כן-אייד צבע אדום (איור 1 ג'י).</li>
	<li>להשוות לוחות כן-אייד ואייד PMG ותאים בחר להראות ורוד או לבן על הצלחת. איד. כן, גם לגדול על הצלחת PMG-אייד. אל תבחר מושבות ללא גידול על PMG-אייד, כפי שהם תוצאות חיוביות שגויות (למשל, המשקף הקלטת קאן משולב באתר-יעד בחלקים אחרים של הגנום).</li>
	<li>לאסוף כ עונה 1 פרק 105 תאים מהמושבה לכל, דגירה ב 10 µL של SPZ, לאודנום zymolyase 2.5 mg/mL 100 T ב 37 מעלות צלזיוס במשך לפחות 30 דקות שימוש 1 µL של פתרון זה לבצע כתבנית המוצא המושבה PCR (איור 1 H).<ol>
<li>להפוך SPZ (50 מ"ל) על ידי ערבוב 30 מ של 2 מ' בסורביטול, 4.05 מ של 1 מ ' נה2HPO4, mL 0.95 NaH2PO4 ו-15 מיליליטר מים מזוקקים (pH הסופי, 7.5). (5 מ"ל) יכול להיות בתוספת zymolyase ודוגמאות המאוחסן ב- 500-µL aliquots ב-20 ° C עד השימוש.</li>
	</ol>
</li>
	<li>לבצע בג'ל (1.2% agarose ג'ל, 180V, 20 דקות) כדי להמחיש את התוצאות של + המושבה ה-PCR. בחר תגובות תערוכת ה-PCR להקות של גודל תקין ולעכל 5 µL של כל מוצר התגובה עם Xhoאני (4 U אנזים 1 x עיכול מאגר, תנורים 37 ° C, 1 h) לסנן תוצאות חיוביות שגויות (איור 1 H).</li>
	<li>לבצע בג'ל להמחיש את מעכל XhoI (1.2% Agarose ג'ל, 180 V, 20 דקות). סמן את המושבות שמוצריהן PCR נחתכים על ידי XhoI, לרפא אותם ללוחות כן + G418 (איור 1I).</li>
	<li>לבודד gDNA מתאי שמרים ביקוע ולבצע רצף של מוצרי ה-PCR23. להשוות את הרצף שהושג עם הרצף פראי-סוג כדי לזהות מוטציות (איור 1I).</li>
	<li>ישירות מחדש מציגים את mutation(s) פראי-סוג תאים על-ידי הפיכתם עם בונה פיוז'ן מוגבר על ידי ה-PCR של תאים מוטציה23. כדי לאשר את פנוטיפ בתאים מוטציה עשה לאחרונה (איור 1J) לצפות בקבצים יש להשתמש בתוכנת עריכה התומכת בפורמט הבחינה.<ol>
<li>פיוז'ן שינוי המבנה יכול להיות בקלות מוגבר על ידי PCR עם תחל p1, p10 באמצעות ה-DNA גנומי של מוטציות כמו התבנית הנפח הכולל של 50 µL (~ 1 µg ה-DNA, האנזים U 20, 1 x תגובת מאגר), וליישם את מחזורי התגובה המתוארים בטבלה 2 . טרנספורמציה של הבונה יכול להיעשות על-ידי ביצוע השלבים הבאים 7.1-7.13.</li>
	</ol>
</li>
</ol>

<ol>
	<li>Pritchard, L., Corne, D., Kell, D., Rowland, J., Winson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+model+of+error-prone+PCR.">A general model of error-prone PCR.</a> J Theor Biol. 234 (4), 497-509 (2005).</li><li>Pfeifer, G. P., You, Y. H., Besaratinia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+induced+by+ultraviolet+light.">Mutations induced by ultraviolet light.</a> Mutat Res. 571 (1-2), 19-31 (2005).</li><li>Moreno, S., Klar, A., Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetic+analysis+of+fission+yeast+Schizosaccharomyces+pombe.">Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.</a> Methods Enzymol. 194, 795-823 (1991).</li><li>Selifonova, O., Valle, F., Schellenberger, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+novel+traits+in+microorganisms.">Rapid evolution of novel traits in microorganisms.</a> Appl Environ Microbiol. 67 (8), 3645-3649 (2001).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+DNA+shuffling+works.">How DNA shuffling works.</a> Science. 293 (5528), 237 (2001).</li><li>Sahu, P. P., Sharma, N., Puranik, S., Chakraborty, S., Prasad, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tomato+26S+Proteasome+subunit+RPT4a+regulates+ToLCNDV+transcription+and+activates+hypersensitive+response+in+tomato.">Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato.</a> Sci Rep. 6, 27078 (2016).</li><li>Xu, Q., Singer, R. A., Johnston, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sug1+modulates+yeast+transcription+activation+by+Cdc68.">Sug1 modulates yeast transcription activation by Cdc68.</a> Mol Cell Biol. 15 (11), 6025-6035 (1995).</li><li>Bhat, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+ATPase+Sug1+plays+a+critical+role+in+regulating+MHC+class+II+transcription.">The 19S proteasome ATPase Sug1 plays a critical role in regulating MHC class II transcription.</a> Mol Immunol. 45 (8), 2214-2224 (2008).</li><li>Chang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Gal4+activation+domain+binds+Sug2+protein,+a+proteasome+component,+in+vivo+and+in+vitro.">The Gal4 activation domain binds Sug2 protein, a proteasome component, in vivo and in vitro.</a> J Biol Chem. 276 (33), 30956-30963 (2001).</li><li>Ekwall, K., Cranston, G., Allshire, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fission+yeast+mutants+that+alleviate+transcriptional+silencing+in+centromeric+flanking+repeats+and+disrupt+chromosome+segregation.">Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation.</a> Genetics. 153 (3), 1153-1169 (1999).</li><li>Grewal, S. I., Jia, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterochromatin+revisited.">Heterochromatin revisited.</a> Nat Rev Genet. 8 (1), 35-46 (2007).</li><li>Forsburg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Forsburg Lab Recipes: Fission Yeast Media. , (2011).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick PCR Purification Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> pBlueScript II Vector. , (2005).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick Gel Extraction Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QuickGene SP Kit Plasmid Kit II (SP-PL2). , (2016).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PfuUltra High-fidelity DNA Polymerase. , (2004).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gibson Assembly Master Mix. , (2017).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneMorph II Random Mutagenesis Kits. , (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plasmid Plus Midi Kit. , (1999).</li><li>Bahler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+modules+for+efficient+and+versatile+PCR-based+gene+targeting+in+Schizosaccharomyces+pombe.">Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.</a> Yeast. 14 (10), 943-951 (1998).</li><li>Szewczyk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+PCR+and+gene+targeting+in+Aspergillus+nidulans.">Fusion PCR and gene targeting in Aspergillus nidulans.</a> Nat Protoc. 1 (6), 3111-3120 (2006).</li><li>Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Fission Yeast Handbook. , (2000).</li><li>Seo, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+is+directly+involved+in+the+regulation+of+heterochromatin+spreading+in+fission+yeast.">The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast.</a> J Biol Chem. , (2017).</li><li>Tang, N. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterisation+of+temperature+sensitive+mutants+of+genes+encoding+the+fission+yeast+spindle+pole+body.">Generation and characterisation of temperature sensitive mutants of genes encoding the fission yeast spindle pole body.</a> PeerJ Preprints. 5, e3377v3371 (2017).</li><li>Rasooly, A., Weisz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+activities+of+phloxine+B+and+other+halogenated+fluoresceins+against+methicillin-resistant+Staphylococcus+aureus.">In vitro antibacterial activities of phloxine B and other halogenated fluoresceins against methicillin-resistant Staphylococcus aureus.</a> Antimicrob Agents Chemother. 46 (11), 3650-3653 (2002).</li><li>Wilson, D. S., Keefe, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+mutagenesis+by+PCR.">Random mutagenesis by PCR.</a> Curr Protoc Mol Biol. , (2001).</li></ol>

המחברים אין לחשוף.

מוטגנזה מכוונת אקראית באמצעות PCR לשגיאות הוא כלי רב עוצמה ליצירת מאגר מגוון של מוטציות באזור נתון. טכניקה זו שימושית במיוחד עבור מחקרים אשר מבקשים להעריך את הפונקציה של חלבון תחת נסיבות מסוימות. לדוגמה, במסמך זה השתמשנו PCR לשגיאות כדי להעריך את תפקוד 19 פרוטאוזום יחידה משנית, Rpt4, בתחזוקת הטרוכרומטין. על ידי שינוי האזור ממוקד על ידי ה-PCR לשגיאות, התאמת התנאים ההקרנה, הצלחנו להפוך למוטציות תאים על האזור גנומית של עניין המסך פנוטיפ הרצוי. לאחרונה, שיטה דומה שימשה כדי לבודד תאי שמרים ביקוע מחסה מוטציות בגן רכיב25גוף קוטב פלך.
היתרון המפתח של אקראי מוטגנזה מכוונת היא כי ייתכן להחיל אותה על גנים שאינם חיוניים והן חיוניות. מוטגנזה מכוונת אקראי של גנים חיוניים תניב מוטציות מגוונים, כגון אלה בעלי פגמים פונקציונלי עדינים ו/או חלקי לאפשר תא הכדאיות להתקיים, או מוטציות פונקציות אשר מושפעים רק תחת תנאי ספציפי. דוגמה של האחרונים היא מוטציה הרגיש. מוטציות כאלה עשויים להיות מבודדים באמצעות 5 מ"ג/ליטר phloxine B, אשר כתמי תאים הגוסס באדום, מאפשר לתאים הגדלים לאט להיות מכובד למות תאים26.
השלב הקריטי של פרוטוקול זה הוא הצעד PCR מועדת לטעויות. בשלב זה, חשוב לשלוט תדר מוטציה אשר יכול להשתנות בהתאם את מספר מחזורי PCR ואת הסכום הראשוני של תבנית. אנו ממליצים כי המשתמש לתקן את מספר מחזורי PCR, משתנים הסכום הראשוני של תבנית, כפי שמצאנו שזה יהיה נוח יותר אסטרטגיה ואופטימיזציה. נציין כי הטכניקה של PCR לשגיאות כבר נרחב זמין במשך עשרות שנים. אם המשתמש בוחר, הם עשויים לחפש שיטה ידנית ביצוע PCR לשגיאות27 בלי באמצעות ערכת מוטגנזה מכוונת זמינים מסחרית.
כמו אזהרה, שיעור חיובי כוזב של פרוטוקול זה הוא גבוה למדי. לפיכך, מועמדים מוטציה צריך לעבור סדרה של הקרנות נועד לסנן את תוצאות חיוביות שגויות. מצאנו כי שיתוף השקטה של אתר ההגבלה בגן היעד יכול לעזור למנוע את הצורך נושא תוצאות חיוביות שגויות לשלב יחסית מפרך של רצף. זה חסכוני, המועמדים מוטנטים עשויים מספר מאות או אפילו מעבר.

גנטיקה קדימה היא שיטה קלאסית שבה חוקרים לחפש מוטנטים המתרחשים באופן טבעי המציגים פנוטיפ מסוים, ואת לבצע ניתוח גנטי. גנטיקה הפוכה, מוטציות יוכנסו הגן עניין, פנוטיפ נבדק. במקרה האחרון, מוטגנזה מכוונת אקראי של גנים יעד משמש לעתים קרובות כדי ליצור מאגר של מוטציות נבחרו לאחר מכן עבור פנוטיפים הרצויה, כגון רגישות טמפרטורה או שינו את פעילות אנזימטיות. ניתן להשתמש בשיטות שונות כדי להשיג מוטגנזה מכוונת אקראי, כולל PCR לשגיאות1; הקרנה UV2; מוטגנים כימיים, כגון אתיל methanesulfonate (EMS) או חומצה חנקיתית3; השימוש של זנים הנתונים זמניים, כגון אלה יתר לבטא mutD5 4; וסדר דנ א5.
כאן, אנו מתארים אסטרטגיה הפוכה-גנטיקה שבו אנו מנצלים PCR לשגיאות לייצר בריכות מוטציה גן המטרה שמרים ביקוע. כפי שאפשר לנחש מהשם שלו, שיטה זו יוצר מוטציות על ידי בכוונה הצגת שגיאות במהלך ה-PCR. בניגוד לשיטות אחרות מוטגנזה מכוונת, PCR לשגיאות מאפשר למשתמש להגדיר את האזור כדי להיות mutagenized. זה עושה את זה שימושי במיוחד המאמצים לחקור את הפונקציה של חלבון/תחום עניין.
כדי להדגים את הפרוצדורה מוטגנזה מכוונת אקראית זו, אנו בזאת השתמש rpt4 +, שמקודד את יחידת משנה פרוטאוזום 19, כדוגמה. Rpt4 הוכח יש פונקציות proteolysis תלויית אורגניזמים שאינם ביקוע שמרים6,7,8,9, פגם proteolysis עלול לגרום השפעות עקיפות על ידי שינוי חלבונים רמות. לפיכך, אנו, איבחון מוטציות שהפעיל שינויים proteolysis עצמאית, במטרה לחקור את תפקוד פרוטאוזום על הטרוכרומטין.
PCR לשגיאות ניתן ליישם בכל אזור הגן על-ידי כוונון המיקום שבו לאגד צבעי יסוד. ניתן לזהות מוטנטים כי התערוכה פנוטיפי לשינוי המיוחל עם כתבים המתאים. כאן, אנחנו מנוצל של הכתב ade6 + הוספת תאים 1 החיצוני חוזרים על עצמם (otr) אזור10. הטרוכרומטין מכוננת נוצר ב אזור זה11, אז הכתב ade6 + מושתק במצב פראי-סוג; זה מסומן על ידי מושבות אדום10. מוטציה אשר שיערער את הטרוכרומטין מכוננת על תאים יוביל הביטוי של ade6 + הכתב, אשר הוא מדמיין בתור מושבות לבן.

<table border="0" cellpadding="0" cellspacing="0" width="825">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">1. Media</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td style="width:285px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Glucose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G8270-10KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Yeast extract</td>
			<td style="width:155px;">BD Biosciences</td>
			<td style="width:119px;">212720</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Leucine</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">87070-0310</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Adenine sulfate</td>
			<td style="width:155px;">ACR</td>
			<td style="width:119px;">16363-0250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Uracil&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">U0750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Histidine</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">H8125</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KH2PO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">1.05108.0050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">NaCl</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">19015-0350</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">MgSO4&#8226;7H2O</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">63140</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CaCl2</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">12095</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Potassium phthalate</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6758-500g</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Inositol</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">I7508-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Biotin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B4501-100MG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Boric Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B6768-1KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MnSO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">M7634-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">ZnSO4&#8226;7H2O&#160;</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">83060-031</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">FeCl2&#8226;4H2O</td>
			<td style="width:155px;">KANTO</td>
			<td style="width:119px;">CB8943686</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Sodium molybdate dihydrate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">31621</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KI</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">80090-0301</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CuSO4&#8226;5H2O</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">09605</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">D-myo-inositol</td>
			<td style="width:155px;">MP biomedicals</td>
			<td style="width:119px;">102052</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Pantothenate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">26003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Nicotinic Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">N4126-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">(NH4)2SO4&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A4418-100G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Agarose</td>
			<td style="width:155px;">Biobasic</td>
			<td>D0012</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">G418, geneticin</td>
			<td style="width:155px;">LPS</td>
			<td style="width:119px;">G41805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">2. Enzyme reactions</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">PfuUltra II Fusion HS DNA Polymerase</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">600380</td>
			<td>For site-directed mutagenesis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">GeneMorphII Random mutagenesis Kit</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">200500</td>
			<td>For error-prone PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Phusion High-Fidelity DNA Polymerase</td>
			<td style="width:155px;">Thermo Fisher</td>
			<td>F-530L</td>
			<td>For fusion PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Ex Taq&#160;DNA Polymerase</td>
			<td style="width:155px;">Takara</td>
			<td style="width:119px;">RR001b</td>
			<td>For general PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">BamH1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Xho1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td>R0146S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Dpn1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">3. Equipment</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Velveteen square, black</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">89033-116</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Replica-plating tool</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">25395-380</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MicroPulser Electroporator</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652100&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Electroporation Cuvettes, 0.2 cm gap</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652086&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Thermal Cycler</td>
			<td style="width:155px;">Bioer</td>
			<td style="width:119px;">BYQ6078</td>
			<td>For fusion PCR ramp reaction&#160;</td>
		</tr>
	</tbody>
</table>

gene-targeted random mutagenesis to select heterochromatin-destabilizing proteasome mutants in fission yeast

מוטגנזה מכוונת אקראי של גנים היעד משמשת לזיהוי מוטציות תשואה של פנוטיפ הרצוי. שיטות העשויות לשמש להשגת מוטגנזה מכוונת אקראי, PCR לשגיאות היא אסטרטגיה נוחה ויעילה ליצירת מאגר מגוון של מוטציות (כלומר., ספרייה מוטציה). PCR לשגיאות הוא שיטת הבחירה כאשר חוקר מבקש להפוך למוטציות אזור מוגדרים מראש, כגון האזור קידוד של הגן תוך השארת אזורים אחרים גנומית מעושה. לאחר ספריית מוטנטים מוגבר על-ידי ה-PCR לשגיאות, זה חייב להיות משובטים לתוך פלסמיד מתאים. הגודל של הספרייה שנוצר על ידי ה-PCR לשגיאות מוגבל בשל היעילות של השלב שיבוט. עם זאת, בשמרים ביקוע, שמר הביקוע, הצעד השיבוט יכול להיות מוחלף על ידי שימוש יעילים ביותר בשלב אחד פיוז'ן PCR כדי ליצור מבנים לשינוי. מוטציות של פנוטיפים הרצוי ייתכן ואז שנבחר באמצעות עיתונאים המתאים. כאן, אנו מתארים את האסטרטגיה הזאת בפירוט, לוקחים כדוגמה, כתב להוסיפה אצל הטרוכרומטין centromeric.

המוטציות Rpt4 שנרכש על-ידי ביצוע ההליכים המתוארים באיור 1 ניתן לנתח אותם על-ידי הערכת את הצבעים של המושבות. הצבעים של המושבות הם הבחינו על גבי הלוחות הרלוונטיים ומקטין את המספר באיור2. הכתב ade6 + להוסיפה אצל באזור הטרוכרומטין מושתק בפראי-סוג ומראה מושבות אדום בצלחת כן-אייד. ברגע הטרוכרומטין הוא גרם אולי לפגיעה ביציבות הכתב ade6 + מתבטא, מושבות לבן יכול להיות שנצפו בצלחת כן-איד כמו מוטציה clr4Δ . המוטציות Rpt4 ממוסך הם כפי שמוצג. מוטציה rpt4-1 מראה destabilization הטרוכרומטין חמור ביותר.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57499/57499fig1.jpg"> איור 1 : ייצוג סכמטי של הפרוטוקול. (א) ייצוג סכמטי של המוצר PCR מתקבל על ידי בסיבוב הראשון של ה-PCR, אשר מתבצע באמצעות תחל 1 ו- 2. (B) המבוסס על הגבלת שכפול של השבר rpt4 + . (ג) מוטגנזה של וקטור משוכפל משמש כדי להציג מוטציה שקטה אשר מוסיף אתר ההגבלה XhoI . (ד) אקראי מוטגנזה מכוונת של rpt4 + קידוד אזור מתבצעת באמצעות PCR מועדת לטעויות. (ה) השבר מוטציה rpt4 + , השבר קאן ו- 3' UTR השבר הצטרפו פיוז'ן PCR להפקת קלטת טרנספורמציה-מוכנות. (נ) ביקוע השמרים הופכים עם פיוז'ן PCR לבנות, אשר מחליף את רצף אנדוגני rpt4 + מאת רקומבינציה הומולוגית. (G) שנבחר קאן מושבות משוכפל מצופה כן-אייד (איד נמוך), צלחות PMG-אייד (לא אייד) הינם חיוביים מושבות נבחרו. (H) PCR והגבלה XhoI עוקבות של המוצר PCR משמשים כדי למנוע תוצאות חיוביות שגויות. (I) המוטציה הגורמת של פנוטיפ מזוהה על ידי תיקון של מושבות שנבחר, התפשטות של תאים, הפקת דנ א גנומי (gDNA), רצף של החלק הרלוונטי של rpt4 +. (J) מוטציות סיבתי מאושרות (ואת תוצאות חיוביות שגויות נשלטים) על ידי החדרת ישירות את המוטציה פראי-סוג התאים. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57499/57499fig2.jpg"> איור 2 : הטרוכרומטין מוטנטים דה-דיכוי של Rpt4. תרשים סכמטי של otr1::ade6 + הכתב (למעלה). 5-fold דילולים טורי של מוטציות Rpt4 ממוסך בחר נצפו על גבי הלוחות המצוין בצו של הגדלת רמת הטרוכרומטין הקשורה (למטה). איור זה שונה מן המאמר 'פרוטאוזום 19 מעורבת ישירות ברגולציה של הטרוכרומטין שמתפשט בבית ביקוע שמרים"מאת Seo. et al., 201724. הדמות הלא הקצוץ ניתן למצוא במאמר המקורי. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td rowspan="2">רכיב</td>
			<td colspan="2">סוג של צלחת</td>
		</tr>
<tr>
<td>כן</td>
			<td>PMG</td>
		</tr>
<tr>
<td>תמצית שמרים</td>
			<td>5 g/L</td>
			<td></td>
		</tr>
<tr>
<td>גלוקוז</td>
			<td>30 g/L</td>
			<td>20 גרם/ליטר</td>
		</tr>
<tr>
<td>אדנין</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>היסטידין</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>לאוצין</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>אורציל</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>Pthalate מימן אשלגן</td>
			<td></td>
			<td>3 g/L</td>
		</tr>
<tr>
<td>נה2HPO4
</td>
			<td></td>
			<td>2.2 g/L</td>
		</tr>
<tr>
<td>חומצה גלוטמית-L</td>
			<td></td>
			<td>3.75 g/L</td>
		</tr>
<tr>
<td>מלחי</td>
			<td></td>
			<td>20 מ ל/L</td>
		</tr>
<tr>
<td>ויטמינים</td>
			<td></td>
			<td>1 מ"ל/L</td>
		</tr>
<tr>
<td>מינרלים</td>
			<td></td>
			<td>0.1 מ"ל/L</td>
		</tr>
<tr>
<td>אגר</td>
			<td>16 g/L</td>
			<td>16 g/L</td>
		</tr>
</tbody></table>טבלה 1. מרכיבי כן PMG צלחות
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>טמפרטורה</td>
			<td>זמן</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">מחזורים</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 דקות</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>8oC</td>
			<td>. תחזיק</td>
			<td></td>
		</tr>
</tbody></table>בטבלה 2. תוכנית מומלצת PCR מוטגנזה
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>טמפרטורה</td>
			<td>זמן</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>95oC</td>
			<td>30 s</td>
			<td rowspan="3">19 מחזורים</td>
		</tr>
<tr>
<td>55oC</td>
			<td>1 דקות</td>
		</tr>
<tr>
<td>72oC</td>
			<td>7 דקות</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>8oC</td>
			<td>. תחזיק</td>
			<td></td>
		</tr>
</tbody></table>בטבלה 3. תוכנית מומלצת PCR PCR לשגיאות
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>טמפרטורה</td>
			<td>זמן</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">מחזורים</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 דקות</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>8oC</td>
			<td>. תחזיק</td>
			<td></td>
		</tr>
</tbody></table>בטבלה 4. מומלץ PCR תוכנית להשגת השבר קאן
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>שינוי</td>
			<td>כדי</td>
			<td colspan="2">למשל במקרה של rpt4 +</td>
		</tr>
<tr>
<td>תבנית וקטורית</td>
			<td>pFA6a-3HA-KANMX6</td>
			<td colspan="2"></td>
		</tr>
<tr>
<td>וקטור מחייב רצף p7</td>
			<td>ATTACGCTGCTCAGTGCTGA</td>
			<td colspan="2" rowspan="2">ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA</td>
		</tr>
<tr>
<td>תלוי רצף p7</td>
			<td>הרצף 50bp האחרון כולל את stop codon</td>
		</tr>
<tr>
<td>תלוי רצף p8</td>
			<td>הסדרה 50bp הראשונה מיד לאחר stop codon (רצף משלים)</td>
			<td colspan="2">AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC</td>
		</tr>
<tr>
<td>רצף p9</td>
			<td>להתחיל מיד לאחר stop codon</td>
			<td colspan="2">tgcacatatatccaaaaagccatgaa</td>
		</tr>
<tr>
<td>רצף של p10</td>
			<td>לייצר ~ שבר 500bp עם p9 (seqeucne משלימים)</td>
			<td colspan="2">TAGACGTTTTTCCTCGTTTCTTTGTC</td>
		</tr>
</tbody></table>טבלה 5. השינויים הנדרשים כאשר המחסל ADH משמש במקום המחסל אנדוגני
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>טמפרטורה</td>
			<td>זמן</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">מחזורים</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>1 דקות</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 דקות</td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>8oC</td>
			<td>. תחזיק</td>
			<td></td>
		</tr>
</tbody></table>טבלה 6. מומלץ PCR תוכנית להשגת 3' UTR השבר
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>טמפרטורה</td>
			<td>זמן</td>
			<td>הרמפה</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>94oC</td>
			<td>2 דקות</td>
			<td></td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 מחזורים</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2:30 דקות</td>
			<td>0.2 oC/s</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">5 מחזורים</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2:30 דקות</td>
			<td>0.2 oC/s + s/מחזור 5</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 מחזורים</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2:30 דקות</td>
			<td>0.2 oC/s + s/מחזור 20</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 דקות</td>
			<td></td>
			<td>מחזור 1</td>
		</tr>
<tr>
<td>8oC</td>
			<td>. תחזיק</td>
			<td></td>
			<td></td>
		</tr>
</tbody></table>טבלה מס ' 7. תוכנית מומלצת PCR פיוז'ן PCR
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr>
<td>CBL1877</td>
			<td>h +</td>
			<td>ade6-210 leu1-32 ura4-D18 otr1R (dg-glu) Sph1:ade6</td>
		</tr></tbody></table>S1 טבלה: זן השתמשו במחקר זה
<img src="/files/ftp_upload/57499/57499tbl2.jpg"> טבלה S2: רשימת תחל השתמשו במחקר זה

Watch this Scientific Journal Video about Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast at JoVE.com

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

גן במיקוד אקראי מוטגנזה מכוונת לבחירת יציב הטרוכרומטין פרוטאוזום מוטציות שמרים ביקוע

מאמר זה מתאר מתודולוגיה מפורט אקראי מוטגנזה מכוונת של גנים היעד בביקוע שמרים. כדוגמה, אנחנו יעד rpt4 +, שמקודד של יחידת משנה של פרוטאוזום 19, וכן מסך מוטציות ביציבותה הטרוכרומטין.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

gene-targeted-random-mutagenesis-to-select-heterochromatin

Nanyang Technological University

Research

JoVE Journal

Genetics

10.6K Views.  Korea Advanced Institute of Science and Technology. מאמר זה מתאר מתודולוגיה מפורט אקראי מוטגנזה מכוונת של גנים היעד בביקוע שמרים. כדוגמה, אנחנו יעד rpt4 +, שמקודד של יחידת משנה של פרוטאוזום 19, וכן מסך מוטציות ביציבותה הטרוכרומטין.

Video: Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetic mutagenesis אקראי באמצעות היסטון-miniSOG ב<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

תפוקה גבוהה בידוד Assisted רובוטית של מוטאנטים קטלניים רגישים-טמפרטורה<em&gt; Chlamydomonas reinhardtii</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

ממוקד<em&gt; באתרו</em&gt; גני mutagenesis של היסטון שמרים הנץ

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

באמצעות טכניקה ג&#39;ל אלקטרופורזה פלורסנט PCR-נימי הגנוטיפ קריספר / Cas9 בתיווך נוק מוטאנטים בתוך פורמט תפוקה גבוהה

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

CRISPR/Cas9 ג'ין עריכה כדי להפוך מותנה מוטציות של בני אדם טפיל המלריה falciparum פ

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

ביטוי ההזדווגות מבוססי ספריית הקרנה שמרים

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

אפיון שינויים Post-translational שינוי היסטון במודלים ניווניות Proteinopathy שמרים

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

מסך משתיק קול עמוק רצף-בסיוע, ספונטני ב ביקוע שמרים שמר הביקוע

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Enhanced Yeast One-hybrid Screens To Identify Transcription Factor Binding To Human DNA Sequences

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and computational approaches. One such method is the yeast one-hybrid (Y1H) assay, in which interactions between TFs and DNA regions are tested in the milieu of the yeast nucleus using reporter genes. Y1H assays involve two components: a &#8216;DNA-bait&#8217; (e.g., promoters, enhancers, silencers, etc.) and a &#8216;TF-prey,&#8217; which can be screened for reporter gene activation. Most published protocols for performing Y1H screens are based on transforming TF-prey libraries or arrays into DNA-bait yeast strains. Here, we describe a pipeline, called enhanced Y1H (eY1H) assays, where TF-DNA interactions are interrogated by mating DNA-bait strains with an arrayed collection of TF-prey strains using a high density array (HDA) robotic platform that allows screening in a 1,536 colony format. This allows for a dramatic increase in throughput (60 DNA-bait sequences against &#62;1,000 TFs takes two weeks per researcher) and reproducibility. We illustrate the different types of expected results by testing human promoter sequences against an array of 1,086 human TFs, as well as examples of issues that can arise during screens and how to troubleshoot them.

Here, we present an enhanced yeast one-hybrid screening protocol to identify the transcription factors (TFs) that can bind to a human DNA region of interest. This method uses a high-throughput screening pipeline that can interrogate the binding of &#62;1,000 TFs in a single experiment.

מסכי אחד-היברידית משופרת שמרים לזהות גורם שעתוק מחייב את רצפי דנ א אנושי

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and ...

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, Eastern equine encephalitis, lymphatic filariasis, and Saint Louis encephalitis. Notably, avian malaria has played a major role in the extinction of numerous endemic island bird species, while WNV has become an important vector-borne disease in the United States. To gain further insight into C. quinquefasciatus biology and expand their genetic control toolbox, we need to develop more efficient and affordable methods for genome engineering in this species. However, some biological traits unique to Culex mosquitoes, particularly their egg rafts, have made it difficult to perform microinjection procedures required for genome engineering. To address these challenges, we have developed an optimized embryo microinjection protocol that focuses on mitigating the technical obstacles associated with the unique characteristics of Culex mosquitoes. These procedures demonstrate optimized methods for egg collection, egg raft separation and other handling procedures essential for successful microinjection in C. quinquefasciatus. When coupled with the CRISPR/Cas9 genome editing technology, these procedures allow us to achieve site-specific, efficient and heritable germline mutations, which are required to perform advanced genome engineering and develop genetic control technologies in this important, but currently understudied, disease vector.

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

This protocol describes microinjection procedures for Culex quinquefasciatus embryos that are optimized to work with CRISPR/Cas9 gene editing tools. This technique can efficiently generate site-specific, heritable, germline mutations that can be used for building genetic technologies in this understudied disease vector.

אמבריו מיקרו-סינתזה טכניקות עבור מוטגנזה יעילה ספציפית לאתר בקולקס quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, ...