המחברים תודה Jan אפל לסיוע טכני מעולה שלו במהלך הקמתה של פרוטוקול זה. לעבודה במעבדה ראדה-איגלסיאס נתמך על-ידי CMMC מגזר מימון, מענקי מחקר DFG (RA 2547/1-1, RA 2547/2-1, ו טה 1007/3-1), UoC מתקדמים החוקרת קבוצת גרנט, המענק CECAD.

<ol>
	<li>Jenuwein, T., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+the+histone+code.">Translating the histone code.</a> Science. 293 (5532), 1074-1080 (2001).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128 (4), 693-705 (2007).</li><li>Wang, Z., Schones, D. E., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+epigenomes.">Characterization of human epigenomes.</a> Curr Opin. Genet Dev. 19 (2), 127-134 (2009).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S. A., Flynn, R. A., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+chromatin+signature+uncovers+early+developmental+enhancers+in+humans.">A unique chromatin signature uncovers early developmental enhancers in humans.</a> Nature. 470 (7333), 279-283 (2011).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Nat Acad Sci USA. 107 (50), 21931-21936 (2010).</li><li>Benayoun, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K4me3+breadth+is+linked+to+cell+identity+and+transcriptional+consistency.">H3K4me3 breadth is linked to cell identity and transcriptional consistency.</a> Cell. 158 (3), 673-688 (2014).</li><li>Rehimi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenomics-Based+Identification+of+Major+Cell+Identity+Regulators+within+Heterogeneous+Cell+Populations.">Epigenomics-Based Identification of Major Cell Identity Regulators within Heterogeneous Cell Populations.</a> Cell Rep. 17 (11), 3062-3076 (2016).</li><li>Whyte, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Master+transcription+factors+and+mediator+establish+super-enhancers+at+key+cell+identity+genes.">Master transcription factors and mediator establish super-enhancers at key cell identity genes.</a> Cell. 153 (2), 307-319 (2013).</li><li>Valouev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+transcription+factor+binding+sites+based+on+ChIP-Seq+data.">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data.</a> Nat Methods. 5 (9), 829-834 (2008).</li><li>Dahl, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+histone+H3K4me3+domains+in+mouse+oocytes+modulate+maternal-to-zygotic+transition.">Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition.</a> Nature. 537 (7621), 548-552 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nat Biotech. 33 (11), 1165-1172 (2015).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nat Methods. 12 (10), 963-965 (2015).</li><li>Zhang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allelic+reprogramming+of+the+histone+modification+H3K4me3+in+early+mammalian+development.">Allelic reprogramming of the histone modification H3K4me3 in early mammalian development.</a> Nature. 537 (7621), 553-557 (2016).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Dev Dynam. 195 (4), 231-272 (1951).</li><li>Ho, J. W. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+metazoan+chromatin+organization.">Comparative analysis of metazoan chromatin organization.</a> Nature. 512 (7515), 449-452 (2014).</li><li>Calo, E., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+enhancer+chromatin:+what,+how,+and+why?.">Modification of enhancer chromatin: what, how, and why?.</a> Mol Cell. 49 (5), 825-837 (2013).</li><li>Spitz, F., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors:+from+enhancer+binding+to+developmental+control.">Transcription factors: from enhancer binding to developmental control.</a> Nat Rev Genetics. 13 (9), 613-626 (2012).</li></ol>

המחברים אין לכל אינטרסים כלכליים מתחרים להיות מגולה.

Epigenomic פרופיל של שינוי היסטון באמצעות שבב-seq יכול לשמש כדי לשפר את הביאור פונקציונלי של הגנום חוליות שונות בהקשרים הסלולר4,5,18. פרופילים אלה epigenomic יכול לשמש, בין היתר, כדי לזהות רכיבים משפר, להגדרת המדינה הרגולציה של מוצרי טיפוח טבעיים (קרי, פעיל, בשלה, או צפוי), וכדי להגדיר תא מרכזי זהות הרגולטורים ביולוגית שונה או הקשרים הפתולוגיים (למשל, תחומים יזם H3K4me3 רחב, סופר-מוצרי טיפוח טבעיים)6,7,9,10,11,19. עם זאת, בשל המגבלה הטבועה של שבב וזמינותו, אשר בדרך כלל דורש מיליוני תאים, שינוי היסטון רוב פרופילים נוצרו במבחנה תא קווי וסלולרי הניתנות ממוין ויוו בכמויות גדולות 4. לאחרונה, מספר שבב-seq פרוטוקולים תוארו התואמים למספרי הטלפון הנייד נמוך ביותר, ובכך מרחיבה באופן דרמטי את מגוון סוגי תאים, רקמות ב epigenomic אילו פרופילים, באופן עקרוני, ניתן להפיק13 ,14,15,16. אלה שבב-seq פרוטוקולים חדשים כל להסתמך על ספציפיות אד הוק שיטות הכנה ספריית המחייבים, לפחות בחלק מהמקרים, ציוד סטנדרטי ו/או ריאגנטים14,15,16.
כאן, אנו מתארים את פרוטוקול שבב שעובד עם נמוכים למספרים תא ביניים (5 x 104 - 5 x 105 תאים) המתקבל ויוו רקמות עובריים שונים10. כדי להגדיל את הרגישות של מבחני השבב שלנו, חיסלנו כמה צעדים בדרך כלל משתמשים במהלך שבב, כגון תאים רציפים, פירוק גרעיני, אשר עלולה לגרום לאובדן הדרגתי של חומר יקר-ערך. לפיכך, לאחר crosslinking, דגימות מטופלים עם מאגר פירוק יחיד, לאחר מכן הם sonicated כדי למזער את אובדן הדגימה. חשוב, פרוטוקול השבב שלנו הוא תואם עם ניתוח qPCR, ובכך מאפשר ניתוח epigenomic של הנבחרת לוקוסים עניין. יתר על כן, הפרוטוקול השבב שלנו יכול להיות משולב עם השבב-seq ספריית הכנה בשיטות הרגילות, לכן להיות שימושי שעשוי להיות רוב מעבדות עם גישה לטכנולוגיות הדור הבא רצפי.
שבב ופרוטוקולים שבב-seq יכול לשמש לא רק לחקור את הפרופילים איגוד היסטון שינויים רבים, אלא גם לחשוף את האתרים מחייב של הרגולטורים תעתיק חשובים אחרים, כגון גורמי שעתוק שיתוף activators (למשל, p300, CBP)20. בדרך כלל, צ'יפס (ועל שבב-seq) גורמי שעתוק שיתוף activators, אשר אינם בשפע כמו גם שינויים היסטוניים, דורשים חומר משמעותית המוצא יותר מאשר צ'יפס ללוחיות היסטון. כך, הפרוטוקול המתואר אולי אינם פועלים בהכרח עבור רוב גורמי שעתוק או שיתוף activators אלא אם כן מספר החל תאים היא משמעותית מוגברת (למשל, 5 x 105 - 5 x 106 תאים) ו/או ספציפי מאוד, נוגדנים יעיל הינם זמינים. למרות זאת, עם נוספים מיטוב ואת שיטות הכנה ובשיפור ספריה, אנו צופים כי השבב-seq מחומר סלולרית מוגבל יהיה ריאלי עבור רוב חלבוני.
למרות הפרוטוקולים שבב ו שבב-seq שלנו יש מאומת בהרחבה עבור מגוון של שינויים היסטון ורקמות עובריים, ברצוננו להדגיש כמה צעדים קריטיים שאנו מחשיבים חיוני כדי יצירת פרופילים באיכות גבוהה epigenomic. ראשית, הדגימות עובריים צריך להיות מבודד טריים בתנאים לא מתפשרים כרומטין שלמות. אלה כוללים ביצוע ניתוח תחת בתנאי קור או פלאש-הקפאה במאגר דגימות עד נצבר מספיק חומר. עוד צעד קריטי הוא sonication, אשר צריך להיות מותאם במדויק לבצע שבבי באיכות גבוהה. תנאים אופטימליים sonication לעתים קרובות להשתנות, בהתאם לסוג הרקמה, כמות הרקמה, או את sonicator בשימוש. ואחרון חביב, שבב מוצלח בסופו של דבר מסתמכת על הזמינות של ספציפי, שבב תואמי נוגדנים נגד החלבונים של ריבית.

שינויים post-translational היסטון מעורבים ישירות תהליכים תלויי-כרומטין שונים, כולל תמלול, שכפול ה-DNA תיקון1,2,3. יתר על כן, שינויים שונים היסטון להראות חיובי (למשל, H3K4me3 ו- H3K27ac) או שלילי (למשל, H3K9me3 ו- H3K27me3) מתאמים עם ביטוי גנים, יכול להיות מוגדר באופן רחב כמו הפעלת או מדכאת היסטון מסמן, בהתאמה2,3. כתוצאה מכך, מפות שינוי היסטון גלובלית, המכונה גם epigenomic מפות, הופיעו כלי אוניברסלי ועוצמתי להוסיף ביאור פונקציונלית הגנום חוליות4,5. לדוגמה, דיסטלי רצפים רגולטוריות כגון משפרי ניתן לזהות המבוסס על הנוכחות של חתימות כרומטין ספציפיים (למשל, פעיל משפרי: H3K4me1 ו- H3K27ac), אשר להבדיל ביניהם לבין יזם proximal אזורים (למשל, היזמים פעיל: H3K4me3)6,7,8. מצד שני, גנים עם פונקציות הרגולציה של זהות תא העיקריים נמצאים בדרך כלל עם כרומטין רחבה תחומים מסומנים H3K4me3 או H3K27me3, בהתאם למצב פעיל או לא פעיל transcriptionally של גנים הבסיסית, בהתאמה9 ,10. באופן דומה, הביטוי של גנים זהות תא מרכזי נראה להיות לעתים קרובות תחת פיקוח מרובים והמרגשים מקובצים באשכולות משפרי (קרי, סופר משפרי), אשר יכול להיות מזוהה תחומים רחבה המסומן H3K27ac11.
כיום, מפות שינוי היסטון נוצרות באמצעות טכנולוגיית שבב-seq, אשר לעומת גישות קודמות כגון צ'יפס-שבב (צ'יפ מצמידים מיקרו-מערכים) מספק רזולוציה גבוהה יותר, חפצים פחות, פחות רעש, כיסוי גדול ואת התחתון עולה12. ובכל זאת, הדור של מפות epigenomic באמצעות טכנולוגיית שבב-seq יש מגבלות הטבועות, הקשורים בעיקר היכולת לבצע בהצלחה שבב הדגימות עניין. פרוטוקולים שבב מסורתי נדרש בדרך כלל מיליוני תאים, אשר מגבלת תחולתה של שיטה זו חוץ גופית בתוך תא קווים או תאים אשר ניתן בקלות מבודד ויוו (למשל, תאי דם). השנים האחרונות, מספר פרוטוקולים שבב ששונה תואם עם מספרי הטלפון הנייד נמוך כבר מתואר13,14,15,16. עם זאת, פרוטוקולים אלה נועדו במיוחד כדי להיות יחד עם הדור הבא רצפי (קרי, צ'יפ-seq), הם בדרך כלל להשתמש אד הוק ספריית הכנה שיטות13,14, 15 , 16.
כאן, אנו המתואר פרוטוקול הצ'יפ שיכול לשמש כדי לחקור שינוי היסטון פרופילים באמצעות מספרי הטלפון הנייד נמוכים בינוניים (5 x 104 - 5 x 105 תאים) או לוקוסים שנבחר (קרי, שבב-qPCR) או באופן גלובלי (קרי, שבב-seq) (איור 1). כאשר משולב שבב-seq לטכנולוגיה, פרוטוקול השבב שלנו יכול לשמש יחד עם שיטות הכנה ספרייה תקנית, ובכך בהרחבה נגיש מעבדות רבות10. פרוטוקול זה שימש לחקור מספר סימני היסטון (למשל, H3K4me3, H3K27me3 ו H3K27ac) ברקמות עוף שונה עובריים (למשל, בעמוד השדרה שפופרת פגמים בתעלה (SNT), frontonasal prominences ו epiblast). עם זאת, אנו צופים כי זה צריך להיות בהרחבה החלים על אורגניזמים אחרים שבו דגימות רלוונטי מבחינה ביולוגית או קלינית יכולה להיות מושגת רק בסכומים נמוכים.

<table>
	<tbody>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BSA powder</td>
			<td>Carl Roth</td>
			<td>3737.3</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Saline buffer (PBS)</td>
			<td>Sigma Aldrich</td>
			<td>D8537</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCL pH8.0</td>
			<td>Sigma Aldrich</td>
			<td>T1503</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Carl Roth</td>
			<td>3957.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Carl Roth</td>
			<td>8043.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Carl Roth</td>
			<td>3054.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-Deoxycholate</td>
			<td>Sigma Aldrich</td>
			<td>D6750-24</td>
			<td></td>
		</tr>
		<tr>
			<td>N-lauroylsarcosine</td>
			<td>Sigma Aldrich</td>
			<td>61743-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Applichem</td>
			<td>A3724,0250</td>
			<td></td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Carl Roth</td>
			<td>3739.2</td>
			<td></td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Sigma Aldrich</td>
			<td>I3021-100ml</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Carl Roth</td>
			<td>1833</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G/magnetic beads</td>
			<td>Invitrogen</td>
			<td>1004D</td>
			<td></td>
		</tr>
		<tr>
			<td>37% Formaldehyde</td>
			<td>Sigma Aldrich</td>
			<td>252549-1L</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RNase</td>
			<td>Peqlab</td>
			<td>12-RA-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma Aldrich</td>
			<td>46.35 E</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-butyrate</td>
			<td>Sigma Aldrich</td>
			<td>SLB2659V</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase inhibitor</td>
			<td>Roche</td>
			<td>5892791001</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBRgreen Mix</td>
			<td>biozym</td>
			<td>617004</td>
			<td></td>
		</tr>
		<tr>
			<td>dH2O</td>
			<td>Sigma Aldrich</td>
			<td>W4502</td>
			<td></td>
		</tr>
		<tr>
			<td>1Kb ladder</td>
			<td>Thermofisher</td>
			<td>SM1333</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma Alrich</td>
			<td>03756-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Invitrogen</td>
			<td>16500-500</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X)</td>
			<td>Gibco</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Octylphenol Ethoxylate (Triton X 100)</td>
			<td>Roth</td>
			<td>3051.4</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (Dulbecco&#180;s Modified Eagle Medium)</td>
			<td>Gibco</td>
			<td>31331-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel loading tips Multiflex</td>
			<td>A.Hartenstein</td>
			<td>GS21</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Plates</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>384 well</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL tubes</td>
			<td>Sarstedt</td>
			<td>72,706</td>
			<td></td>
		</tr>
		<tr>
			<td>100-1000&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,762,211</td>
			<td></td>
		</tr>
		<tr>
			<td>2-20&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,213</td>
			<td></td>
		</tr>
		<tr>
			<td>2-200&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,211</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5-10&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>701,116,210</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27me3 antibody</td>
			<td>Active Motif</td>
			<td>39155</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27ac antibody</td>
			<td>Active Motif</td>
			<td>39133</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me3 antibody</td>
			<td>Active Motif</td>
			<td>39159</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me2 antibody</td>
			<td>Active Motif</td>
			<td>39141</td>
			<td></td>
		</tr>
		<tr>
			<td>End Repair Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Paramagnetic beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Resuspension buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>A-Tailing Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Adapter Indexes</td>
			<td>Illumina</td>
			<td>RS-122-2101</td>
			<td></td>
		</tr>
		<tr>
			<td>Stop Ligation Buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Primer Cocktail</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Enhanced PCR Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA ladder</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>Agilent</td>
			<td>19086</td>
			<td></td>
		</tr>
		<tr>
			<td>Sample Buffer</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Library Quantification Kit</td>
			<td>Kapa Biosystems</td>
			<td>KK4835 &#8211; 07960204001</td>
			<td></td>
		</tr>
		<tr>
			<td>Fertile chicken white eggs</td>
			<td>LSL Rhein Main</td>
			<td>KN: 15968</td>
			<td></td>
		</tr>
		<tr>
			<td>Needle (Neoject)</td>
			<td>A.Hartenstein</td>
			<td>10001</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe (Ecoject 10ml)</td>
			<td>Dispomed witt oHG</td>
			<td>21010</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Hermle</td>
			<td>Z 216 MK</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermoshaker</td>
			<td>ITABIS</td>
			<td>MKR13</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Active Motive</td>
			<td>EpiShear probe sonicator</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Diagenode</td>
			<td>Bioruptor Plus</td>
			<td></td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td></td>
		</tr>
		<tr>
			<td>Variable volume (5&#8211;1,000 &#956;l) pipettes</td>
			<td>Eppendorf</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Timer</td>
			<td>Sigma</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic holder</td>
			<td>Thermo Fisher</td>
			<td>DynaMag-2 12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Table spinner</td>
			<td>Heathrow Scientific</td>
			<td>Sprout</td>
			<td></td>
		</tr>
		<tr>
			<td>Mixer</td>
			<td>LMS</td>
			<td>VTX 3000L</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Cycler</td>
			<td>Roche</td>
			<td>Light Cycler; Serial Nr.5662</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Cycler</td>
			<td>Applied Biosystems</td>
			<td>Gene Amp PCR System 9700</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA and RNA quality control system</td>
			<td>Agilent</td>
			<td>Agilent 4200 TapeStation System</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>Dumont</td>
			<td>5-Inox-H</td>
			<td></td>
		</tr>
		<tr>
			<td>Perforated spoon</td>
			<td>World precision instruments</td>
			<td>501997</td>
			<td></td>
		</tr>
	</tbody>
</table>

chromatin immunoprecipitation (chip) protocol for low-abundance embryonic samples

Immunoprecipitation כרומטין (ChIP) היא טכניקה נפוץ עבור מיפוי הלוקליזציה של שינויים היסטוניים post-translationally שונה, גרסאות היסטון, גורמי שעתוק או שינוי כרומטין אנזימים של לוקוס נתון או בקנה מידה הגנום כולו. השילוב של מבחני שבב עם הדור הבא רצפי (קרי, צ'יפ-Seq) היא גישה רב-עוצמה לחשוף באופן גלובלי רשתות בקרה רגולטריות וכדי לשפר את הביאור פונקציונלי של הגנום, במיוחד של רצפי תקינה ללא קידוד. שבב פרוטוקולים מחייבים בדרך כלל כמויות גדולות של חומר הסלולר, ובכך מסלק את הישימות של שיטה זו לחקירת סוגי תאים נדיר או ביופסיות רקמות קטנה. על מנת להפוך וזמינותו שבב תואם כמות חומר ביולוגי אשר בדרך כלל ניתן להשיג ויוו במהלך המוקדמות מופרה חוליות, נתאר כאן פרוטוקול שבב פשוטה שבה מספר השלבים הדרושים להשלמת assay הצטמצם כדי למזער את אובדן הדגימה. פרוטוקול שבב זה שימש בהצלחה לחקור שינוי היסטון שונים שונים עוף עובריים ורקמות העכבר למבוגרים באמצעות נמוך עד בינוני תא מספרים (5 x 104 - 5 x 105 תאים). חשוב, פרוטוקול זה תואם טכנולוגיית שבב-seq בשיטות הכנה ספרייה תקנית, ובכך לספק epigenomic גלובל מפות ברקמות עובריים מאוד רלוונטי.

כדי להמחיש את הביצועים של פרוטוקול השבב שלנו, ביצענו ניסויים באמצעות סעיפים SNT במאגר מעוברים עוף HH19, prominences בלסת העליונה של HH22 עוף העוברים ולאחר שלב-HH3 עוברי עוף לחקור את הפרופילים איגוד של שבב-seq למגוון היסטון שינויים (קרי, H3K4me2, H3K27ac, H3K4me3 ו- H3K27me3). ברגע DNAs שבב התקבלו, היעילות sonication הוערך על ידי agarose בג'ל של קלט התואם DNAs (איור 3). לאחר מכן, השבב DNAs קלט שימשו לניתוח שבב-qPCR כדי למדוד את enrichments ב לוקוסים צפוי להיות מאוגד או לא מאוגד על-ידי השינויים היסטון ובדוקים (איור 4A). בדוגמה המוצגת איור 4A, H3K27me3 ו- H3K4me3 העשרה רמות בסעיפים HH19 SNT הוערכו על ידי שבב-qPCR סביב האזורים המקדם של SOX17 ו SOX2, שני גנים שהם לא פעיל ופעיל ב תחנת SNT, בהתאמה. כצפוי, יזם SOX2 חריפה סומן על-ידי H3K4me3, אבל לא על ידי H3K27me3, בעוד האמרגן SOX17 הראו דפוס הפוך (איור 4A). על ידי הערכת לוקוסים כמה, זה ניתן לאמוד את האיכות של השבב מבלי לאבד את חומר רב DNA לניתוח שבב-seq במורד הזרם. ברגע איכות הצ'יפס היה מאושר, צ'יפ-seq ספריות היו מוכנים, וסודרו. נציג לוקוסים מוצגים עבור כל אחד הרקמות עובריים ובדוקים עוף: (i) פרופילים עבור H3K27me3 ו- H3K4me3 של העוברים צ'יק SNT של HH19 סביב PAX7 (איור 4B); (ii) פרופילים עבור H3K4me2 ו- H3K27ac, prominences בלסת העליונה של עוברי עוף HH22 סביב SNAI1 (איור 4C); (iii) ופרופיל H3K27me3 ב HH3-שלב עוברי עוף סביב מיקומה TBX3/TBX5 (איור 4D) של.... ניסויים אלה שבב-seq ומתשובות כי פרוטוקול השבב שלנו יכול לשמש כדי ליצור פרופילים epigenomic מתוך כמות מוגבלת של חומר ביולוגי במגוון רחב של רקמות עובריים.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56186/56186fig1.jpg"> 
איור 1: סקירה סכמטי של פרוטוקול שבב נמוך-שפע דוגמאות עובריים מבודד עוברי עוף. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56186/56186fig2.jpg"> 
איור 2: סקירה קצרה של פרוטוקול Microdissection SNT. המקטע SNT רוחבי נחתך באותה רמת איחתי של העובר עוף ' HH19 '. לאחר הטיפול טריפסין, הרקמה ללא עצביות מוסר באופן מכני באמצעות מלקחיים. . לא, מיתר הגב; SNT, שפופרת פגמים בתעלה בעמוד השדרה; וכך, somite. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56186/56186fig3.jpg"> 
איור 3: דוגמה של האופטימלית Sonication- מדגם עוף SNT HH19 היה sonicated 11 מחזורים, עם 30 ב s ו 45 הדופק OFF s-משרעת 'גבוהה' באמצעות sonicator. Crosslinks היה הפוך, ה-DNA מטוהרים נפתרה ב- 1.5% agarose ג'ל. גודל אופטימלי פרגמנט נצפית לאחר 11 מחזורים, הנע בין 200-500 bp. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56186/56186fig4.jpg"> 
איור 4: נציג דוגמאות של ניתוח צ'יפ צ'יפ-qPCR או שבב-תת סעיף. (א) H3K27me3 (משמאל) ורמות H3K4me3 (מימין)-האזורים המצוין נמדדו על ידי ניתוח שבב-qPCR המבוצעת באמצעות סעיפים SNT מבודד מן העוברים בחורה HH19. האזור יזם SOX2 פעילה בתחום תחנת SNT, ובכך מסומן על-ידי H3K4me3, אבל לא על ידי H3K27me3; האזור יזם SOX17 אינו פעיל בתחנת SNT, לכן מועשר H3K27me3 אך לא H3K4me3; Chr6 Neg מייצג אזור intergenic ב עוף כרומוזום 6 והוא משמש פקד שלילי. קווי שגיאה לייצג סטיית התקן של משכפל טכני שלוש. (B) שבב-seq (H3K27me3 ילבשו ארגמן, H3K4me3 בכחול, קלט באדום) פרופילים של העוברים צ'יק SNTs של HH14 מוצגים סביב מיקומה PAX7. (ג) שבב-seq (H3K4me2 ב orange, H3K27ac בירוק, קלט באדום) פרופילים מ- prominences בלסת העליונה של העוברים צ'יק HH22 מוצגים סביב מיקומה SNAI1. (ד) שבב-seq (H3K27me3 במגנטה) ופרופילי קלט באדום מעוברים צ'יק HH3 מוצגים סביב מיקומה TBX3/TBX5. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56186/56186fig5.jpg"> 
איור 5: דוגמה של שבב-seq ספריית אימות באמצעות מערכת בקרת איכות RNA אוטומטי. הספריות באותו צ'יפ-seq נותחו באמצעות מערכת בקרת איכות אוטומטית RNA לפני (A) ואחרי (B) פריימר דיימר ניקוי. פריימר הדימרים ניתן לראות בתור להקה חלשה של bp ~ 135 ב- (א). <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig5large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>צעדים</td>
			<td>הבעיה</td>
			<td>סיבה אפשרית</td>
			<td>פתרון</td>
		</tr>
		<tr>
			<td>1,2,3,4 5 עד 11</td>
			<td>האות נמוכים שבב רעש יחסי לפי שבב-qPCR ו/או שבב-seq</td>
			<td>איכות רקמת בסכנה.</td>
			<td>לבצע מיקרו-ניתוח בתנאים קרים; אחרת כרומטין שלמות נמצאות בסיכון.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>לדוגמה הפסד לאחר צנטריפוגה דוגמאות תפור.</td>
			<td>השתמש DMEM בינוני עם סרום 10-20% או צנטריפוגה חזור על שלב ולהגדיל את הזמן 10 דקות.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Cross-linking משך.</td>
			<td>לייעל את הזמן crosslinking. Crosslinking מוגברת פעמים יכול להקל על זיהוי חלבונים מסויימים, כגון שיתוף activators, שותף repressors אשר לא נקלטות על ה-DNA ישירות.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>אובדן לדוגמה עקב שוטף מרובים ב- PBS.</td>
			<td>להקטין את מספר שוטף; ניתן לחזור על השלבים צנטריפוגה ב 1,500 x g.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Sonication שיוצרת וכתוצאה מכך בגדלים הדי ארוך מדי או קצר מדי.</td>
			<td>לבצע ניסוי כמובן זמן כדי למטב sonication תנאים. פרגמנט אופטימלית בגדלים הנעים בין 200 ל 500 bp</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>נוגדן אינו מתאים שבב.</td>
			<td>השתמש של נוגדנים שונים כנגד החלבון אנדוגני או נוגדן נגד תג נוסף של חלבונים exogenously ביטוי (לדוגמה: דגל, HA).</td>
		</tr>
		<tr>
			<td>12</td>
			<td>נמוך או לא מתקבלים אותות ב qPCR, אפילו עבור קלט דנ א</td>
			<td>תחל שיוצרת</td>
			<td>לבדוק את יעילות פריימר וספציפיות; עיצוב חדשה תחל.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>כמות מספקת של דנ א</td>
			<td>לא מספיק חומר המוצא. להגדיל את כמות הדנ א המשמש לכל תגובה qPCR.</td>
		</tr>
	</tbody>
</table>
-דף = "1" >טבלה 1: פתרון בעיות מדריך עבור שלבים שונים המעורבים הפרוטוקול.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>תחל</td>
			<td>רצף</td>
		</tr>
		<tr>
			<td>SOX2-F</td>
			<td>CCTTGCTGGGAGTACGACAT</td>
		</tr>
		<tr>
			<td>SOX2-R</td>
			<td>GCCCTGCAGTACAACTCCAT</td>
		</tr>
		<tr>
			<td>SOX17-F</td>
			<td>CCCTGAACTGTCATGTGTGG</td>
		</tr>
		<tr>
			<td>SOX17-R</td>
			<td>CAAACAGTTGCCTTTGAGCA</td>
		</tr>
		<tr>
			<td>Chr6-neg-F</td>
			<td>CCGTCAATCTCTGCTTGTGA</td>
		</tr>
		<tr>
			<td>Chr6-neg-R</td>
			<td>TGGAATCTGCTTGTCACTGC</td>
		</tr>
	</tbody>
</table>
טבלה 2: פריימר רצפי שבב-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Preincubation</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 דקות</td>
		</tr>
		<tr>
			<td colspan="3">הגברה</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td>10 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>10 s</td>
			<td>45</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>10 s</td>
			<td>מחזורים</td>
		</tr>
		<tr>
			<td colspan="3">התכה עקומה</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td>65 ° C</td>
			<td colspan="2">1 דקות</td>
		</tr>
		<tr>
			<td colspan="3">קירור</td>
		</tr>
		<tr>
			<td>40 ° C</td>
			<td colspan="2">30 s</td>
		</tr>
	</tbody>
</table>
טבלה 3: תנאים PCR על שבב-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">דנטורציה הראשונית</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">3 דקות</td>
		</tr>
		<tr>
			<td colspan="3">הגברה</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>98 ° C</td>
			<td>20 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>15 s</td>
			<td>15</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>30 s</td>
			<td>מחזורים</td>
		</tr>
		<tr>
			<td colspan="3">סיומת הסופי</td>
		</tr>
		<tr>
			<td>טמפרטורה</td>
			<td colspan="2">זמן</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td colspan="3">קירור</td>
		</tr>
		<tr>
			<td>4 ° C</td>
			<td colspan="2">. תחזיק</td>
		</tr>
	</tbody>
</table>
טבלה 4: PCR תנאים הגברה של מקטעי DNA בהכנה ספריית שבב-seq.

Watch this Scientific Journal Video about Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples at JoVE.com

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

כאן, אנו מתארים של כרומטין immunoprecipitation (ChIP) ופרוטוקול שבב-seq ספריית הכנה ליצירת פרופילים epigenomic גלובל מדגימות עובריים נמוך-שפע עוף.

כרומטין פרוטוקול Immunoprecipitation (ChIP) עבור דגימות עובריים נמוך-שפע

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

chromatin-immunoprecipitation-chip-protocol-for-low-abundance

Nanyang Technological University

Research

JoVE Journal

Genetics

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

15.6K Views.  University of Cologne. כאן, אנו מתארים של כרומטין immunoprecipitation (ChIP) ופרוטוקול שבב-seq ספריית הכנה ליצירת פרופילים epigenomic גלובל מדגימות עובריים נמוך-שפע עוף.

Video: Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

עקירות מלח רציפים לניתוח של כרומטין בצובר מחייב מאפיינים של כרומטין שינוי מתחמי

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

ניתוח של C-KIT ליגנד האמרגן באמצעות Immunoprecipitation הכרומטין

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

הכרומטין Immunoprecipitation (שבב) ב עכבר T-cell שורות

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

דור של כרומטין יליד Immunoprecipitation רצף ספריות לניתוח צפיפות נוקלאוזום

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

Immunoprecipitation כרומטין (ChIP) של היסטון שינויים של האפייה

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

CRISPR בתיווך ארגון מחדש של הכרומטין לולאה

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

כרומטין Immunoprecipitation של רקמת שומן חום מאתר

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

כרומטין Immunoprecipitation שימוש בנוקלאוסים מיקרוקוקל בתאי מיונקים

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

A Method to Study de novo Formation of Chromatin Domains

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity and/or disease. Despite tremendous efforts, our understanding of the formation and propagation of chromatin domains is still limited. Chromatin domains have been studied under steady-state conditions, which are not conducive to following the initial events during their establishment. Here, we present a method to inducibly reconstruct chromatin domains and follow their re-formation as a function of time. Although, first applied to the case of PRC2-mediated repressive chromatin domain formation, it could be easily adapted to other chromatin domains. The modification of and/or the combination of this method with genomics and imaging technologies will provide invaluable tools to study the establishment of chromatin domains in great detail. We believe that this method will revolutionize our understanding of how chromatin domains form and interact with each other.

A Method to Study de novo Formation of Chromatin Domains

This method is designed to follow formation of PRC2-mediated chromatin domains in cell lines, and the method can be adapted to many other systems.

שיטה ללמוד דה נובו היווצרות של כרומטין דומיינים

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription factors, histone modifications, and other DNA-associated proteins. ChIP-seq data can also be used to find differential binding of transcription factors in different environmental conditions or cell types. Initially, ChIP was performed through hybridization on a microarray (ChIP-chip); however, ChIP-seq has become the preferred method through technological advancements, decreasing financial barriers to sequencing, and massive amounts of high-quality data output. Techniques of performing ChIP-seq with bacterial biofilms, a major source of persistent and chronic infections, are described in this protocol. ChIP-seq is performed on Salmonella enterica serovar Typhimurium biofilm and planktonic cells, targeting the master biofilm regulator, CsgD, to determine differential binding in the two cell types. Here, we demonstrate the appropriate amount of biofilm to harvest, normalizing to a planktonic control sample, homogenizing biofilm for cross-linker access, and performing routine ChIP-seq steps to obtain high quality sequencing results.

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a method used to establish interactions between transcription factors and the genomic sequences they control. This protocol outlines techniques for performing ChIP-seq with bacterial biofilms, using Salmonella enterica serovar Typhimurium bacterial biofilm as an example.

גילוי מטרות רגולטוריות של CsgD באמצעות כרומטין Immunoprecipitation ורצף של תפוקה גבוהה (שבב-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...