המחברים מודים לפיטר רובינשטיין לדיון מועיל וייעוץ טכני ודוד Pellman לשיבוט PB1996 המקורי. עבודה זו נתמכה על ידי מענק מהמצעד הפרוטות ומימון מהרכיבה לילדים.

1. שיבוט לפלסמיד PB1996 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פריימרים DNA עיצוב והזמנה מחברת oligonucleotide הייצור כי האגף רצף היעד ומכיל אתרי הגבלה ייחודיים בפלסמיד ההורה שנבחר. הערה: במקרה זה, פריימרים נועדו להגביר את זוגות הבסיסים 400 בסוף &quot;5 של רצף Aip1. אתר הגבלת XhoI שולב בפריימר על 20 נ&quot;ב לפני רצף Aip1, וXmaI נכלל כ -20 נ&quot;ב לאחר רצף Aip1 היעד. פלסמיד המשמש לשיבוט היה PB1996, המכיל תג 3XGFP לקרינה, גן URA לבחירת זן שמרים, וגן התנגדות אמפיצילין לבחירה בקטריאלי. </li><li style=";text-align:right;direction:rtl"> לטהר את הדנ&quot;א הגנומי מזן הפלואידים Ura-שמרים. הערה: עיין באיור 1 לתרשים של תהליך השיבוט. </li><li style=";text-align:right;direction:rtl"> הפעל תגובת PCR סטנדרטית באמצעות שני פריימרים והדנ&quot;א הגנומי שמרים כדי להגביר את גן Aip1p עם אתרי ההגבלה משני enד. לעכל את המוצר ה-PCR ופלסמיד PB1996 עם אנזימי ההגבלה בתגובות נפרדות לכל יצרן מומלץ פרוטוקולים. במקרה זה XmaI וXhoI שימשו עם החיץ הנלווה ב-C ° 37 במשך שעה 1. </li><li style=";text-align:right;direction:rtl"> הפעל 0.8% ג&#39;ל אלקטרופורזה agarose כדי להפריד את שברי DNA מתעכלים. באחד היטב, טען סולם המוני DNA נמוך, ובבארות נפרדות, טען את כל התגובה ממערכת עיכול. הרץ את הג&#39;ל על 100 וולט כ 1 שעות, עד שחזית הצבע קרובה לסוף של הג&#39;ל. דמיין את הג&#39;ל תחת אור UV ולטהר את הקטע שמתאים למגזר חלבונים ואת הפלסמיד החתוך. </li><li style=";text-align:right;direction:rtl"> ולקשור מגזר Aip1 מתעכל ופלסמיד PB1996. להפוך את המוצר לתאי DH5α באמצעות פרוטוקולי יצרן (10 DNA μl עם 100 תאי μl ל30 דקות על קרח, הלם חום על 42 מעלות צלזיוס למשך 2 דקות, לגדול בתקשורת SOC לשעה 2 ב 37 מעלות צלזיוס) וצלחת על גבי צלחות תרבות הכולל אנטיביוטיקה לבחירה, במקרה זה LB +צלחות מגבר. בחר ולגדול מושבה אחת בתרבות נוזלית. לטהר את הפלסמיד החדש תוכנן. </li></ol> 2. דור הזנים שמרי Mutant <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש בזן שמרי הפלואידים בי אלל אקטין נמחק לבנות זן שמרים שעבר מוטציה. הערה: במקרה זה, את המתח ההורי היה מתנה נדיבה של ד&quot;ר פיטר רובינשטיין (אוניברסיטת איווה) והבנייה תוארה על ידי קוק ואח&#39; 20 זן זה חסר את הגן אקטין כרומוזומליות ומכיל פלסמיד שמקודד שמרי סוג בר. אקטין ואורציל. </li><li style=";text-align:right;direction:rtl"> השתמש בשמרים אקטין הסוג בר קידוד פלסמיד PRS עם TRP + בחירה כבסיס לפלסמיד mutagenesis 21. </li><li style=";text-align:right;direction:rtl"> בצע מכוון mutagenesis אתר על פלסמיד PRS להנדס את המוטציה missense ליקטין. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> למוטצית R256H ביקטין, להפיק את פריימר 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; כדי לשנות את Arg 256 256. הפעל mutagenesis סטנדרטיתגובת PCR עם פלסמיד משלב 2.2. </li><li style=";text-align:right;direction:rtl"> להפוך את הפלסמיד אקטין מוטציה מPCR לתאי DH5α. לבודד את ה-DNA פלסמיד ולרצף את הגן אקטין כדי לאמת את המוטציה. </li></ol></li><li style=";text-align:right;direction:rtl"> לשנות את קידוד פלסמיד שמרים אקטין מוטציה לתוך זן שמרים הפלואידים משלב 2.1. </li><li style=";text-align:right;direction:rtl"> תרבות התאים הפכו בTRP-צלחות כדי לבחור עבור שמרים המכילים TRP המכיל פלסמיד שמרים אקטין מוטציה +. </li><li style=";text-align:right;direction:rtl"> בחר לתאים חסרי פלסמיד המקורי המקודד אקטין סוג בר ואורציל (מתואר ב2.1) על ידי תאים תת culturing מTRP-הצלחות על צלחות המכילות 5-Fluoroorotic חומצה (5-פואה). 5-פואה מומרת לצורה רעילה, 5-flurouracil, בעצירת זנים המבטאים את גן URA3 הפונקציונלי. התאים שגדלים לאחר הבחירה בשלבים יכילו רק את הפלסמיד אקטין מוטציה. </li><li style=";text-align:right;direction:rtl"> לטהר DNA פלסמיד מזן השמרים החדש. רצף פלסמיד כדי להבטיח את הגן אקטין מוטציה הוא הווה. השתמש בזה זהלהתאמן במחקרים נוספים. תהליך זה נתח באיור 2. </li></ol> 3. הפיכת פלסמיד לתוך תאי שמרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לעכל את הפלסמיד Aip1p-GFP עם אנזים הגבלה כדי לאפשר השתלבות בשמרי כרומוזום. הערה: אתר ההגבלה חייב להיות מחוץ לגוש הרצף המכיל את תג הניאון, גן של עניין, וסמן בחירה. במקרה זה, להשתמש 1 μl של אנזים הגבלת HPAI עם 8-DNA μl וμl 1 של החיץ 10x הנלווה עבור שעה 1 ב 37 ° C. </li><li style=";text-align:right;direction:rtl"> תרבות ס תאי cerevisiae (משלב 2.5) שאינם מסוגלים לסנתז אורציל (Ura-מתח) לילה ב 5 מיליליטר בתקשורת YPD (1% תמצית שמרים, peptone 2%, ודקסטרוז 2%) על גלגל ב30 ° C. ספין למטה 1 מיליליטר של התאים 5 דקות ב1,000 x גרם. </li><li style=";text-align:right;direction:rtl"> הפוך תערובת PLATE. הפוך 10XTE ידי הוספת 5 מיליליטר של 1 M טריס pH 7.5 ו -2 מיליליטר של 250 מ&quot;מ חומצת ethylenediaminetetraacetic (EDTA) ל43 מיליליטר של DDH 2 O. הוסף 0.204 גרם של ליתיום אצטט 20 מיליליטר של 1XTE, אז 8 גרם של פוליאתילן גליקול (PEG) (MW ~ 3,300) ולסנן לעקר. </li><li style=";text-align:right;direction:rtl"> למזוג supernatant מהתאים סובבים מטה בשלב 3.2 ו resuspend התאים בנוזל שנותר. לתאים מושעים, להוסיף 2 μl של 10 מ&quot;ג / DNA ספק אשכים סלמון מיליליטר. הוסף 10 μl של פלסמיד דנ&quot;א מתעכל משלב 3.1 ומערבולת. הוסף 0.5 מיליליטר של צלחת ומערבולת. הוסף 20 μl של 1 M DTT ומערבולת. </li><li style=";text-align:right;direction:rtl"> דגירה את התערובת ל6-8 שעות ב25 ° C. Heat Shock התאים באמבט מים ב42 מעלות צלזיוס למשך 10 דקות. של תאים מהחלק התחתון של צינור microcentrifuge שבו הם התיישבו מתוך גבי-Ura צלחת הצלחת 100 μl. דגירה ב30 מעלות צלזיוס למשך 2-3 ימים או עד טופס מושבות. </li><li style=";text-align:right;direction:rtl"> בחר מושבות ופס בודדים החוצה אל-Ura צלחת. הערה: תאים אלו מכילים את הפלסמיד עם גן Aip1-GFP ועורה ישולב בכרומוזום, המאפשרים צמיחה. תאים אלה לאחר מכן ניתן להשתמש בmicroscopy. </li></ol> 4. לדמיין את תנועת חלבון Aip1p באמצעות השתקפות סה&quot;כ הפנימית מיקרוסקופ פלואורסצנטי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול תרבות של תאי שמרים עם Aip1p-GFP התאגד בYPD לילה על גלגל ב30 ° C. תת 1 מיליליטר של תרבות הלילה ל9 מיליליטר של-Ura תקשורת. לגדל את התאים ל3-4 שעות נוספות על שייקר ב30 ° C כדי לוודא שהם נמצאים בשלב צמיחת יומן. </li><li style=";text-align:right;direction:rtl"> הוסף 3 μl של תאים לשקופית מיקרוסקופ זכוכית ולהוסיף coverslip. אפשר התאים להסתפק בשקופית למשך 5 דקות. מניחים את השקף בסוגר של צלחת הבמה. </li><li style=";text-align:right;direction:rtl"> שים לב לחלבון Aip1p-GFP עם הקרינה כוללת פנימית השתקפות מיקרוסקופ (TIRF) (488 ננומטר) באמצעות טבילת שמן 100X TIRF אובייקטיבית ומצלמת CCD דיגיטלית. באמצעות תוכנת SlideBook 5.0, להשיג תמונות ל20 שניות בקצב של 5 פריימים / שנייה (מסגרות בודדות של תמונות שנרכשו מוצגות באיור 2 א). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להתמקד בגאמות, תוכנת SlideBook 5.0 פתוחה ולחצו על לחצן פוקוס החלון בסרגל הכלים כדי לגשת לפקדי המיקוד. בחר בכרטיסייה היקף ובחר את מטרת 100X-TIRF. כבה את המנורה ובהחלק את סרגל המנורה 15%. לשנות את הגדרת סל ל2 x 2. שינוי מסנן לשדה בהיר. </li><li style=";text-align:right;direction:rtl"> במיקרוסקופ, להשתמש בחיוג להתמקד בסדר להביא את התאים אל מוקד כפי שניתן לראות על מסך המחשב. </li><li style=";text-align:right;direction:rtl"> שימוש בפקדים בתוך חלון הפוקוס, להפוך את המנורה כבויה, לשנות את המסנן לחיות, ולחץ על לחצן TIRFM. </li><li style=";text-align:right;direction:rtl"> נורת ה TIRFM המחובר לצד הנמל הנכון של המיקרוסקופ, להפוך את פליטת הלייזר לאון. </li><li style=";text-align:right;direction:rtl"> בחר בכרטיסייה הזרם בתוך חלון הפוקוס, סמן את התיבה הבאה כדי להתחיל בהקלטה ולאחר מכן לחץ על לחצן שדה בהיר. </li><li style=";text-align:right;direction:rtl"> נורת ה TIRFM, להפוך מיקרומטר כדי להתאים את זווית האירוע של הלייזר. זה משמש כדי לייעל את פליטת הקרינה ממוקדי Aip1-GFP ולמזער את הקרינה רקע מתאים ושקופיות. </li><li style=";text-align:right;direction:rtl"> כאשר התמונה הרצויה מוצגת, לחץ על &#39;התחל&#39;. אחרי 20 שניות, עצירה לעיתונות. שמור את התמונות. בכרטיסיית הקובץ בשורת התפריט הראשית, בחר שקופיות שמירה ובלהזין את מיקום קובץ ואת השם. </li></ol></li><li style=";text-align:right;direction:rtl"> השתמש בתוכנת ImageJ לנתח את התמונות. השתמש בתוסף מאקרו &quot;Tracker הידני&quot; כדי לעקוב אחר התנועה ושיעור מוקדי Aip1p ניאון. שנה את פרמטר מרווח הזמן ל0.2 שניות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות בחירת מסלול תוספת, בחר ולעקוב אחר חלבון פלואורסצנטי פרט באמצעות ארבעה עד שמונה מסגרות חיבור. השתמש בפקודת מסלול הסוף ואת מהירות תנועה של חלבון בין כל מסגרת תציג בחלון תוצאות. </li><li style=";text-align:right;direction:rtl"> לקבוע את השיעור הממוצע בין כל מסגרת באמצעות גיליון אלקטרוני של Microsoft Excel. השתמש בערכים כדי לחשב את המהירות של תנועת Aip1p הממוצעת עבור כל זן תא של עניין. הערה: עלילת פיזור של קצב תנועת Aip1p והמהירות שאינו ליניארי הממוצע מוצגת בfiguמחדש 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

יש המחברים אין לחשוף.

אסטרטגיה יעילה כדי להמחיש את הדינמיקה של שלד התא והשירות בחקירות על מוטציות פתוגניים שתוארה כאן. שיטות הדמיה מתקדמות יצרו הזדמנויות חדשות כדי להבין את התנועה תאית של חלבונים ליד קרום התא. מיקרוסקופיה סך הקרינה השתקפות הפנימית (TIRF) היא טכניקה רגישה ללימודים תפקודיים בתאים חיים. TIRF משתמש בליזר עירור זווית שיוצר שדה חלוף בשל ההבדל במדדי שבירה של coverslip והבינוני מימיים. האנרגיה של שדה חלוף מרגשת fluorophores אבל יורדת באופן אקספוננציאלי עם המרחק של הממשק בין coverslip והמים. התוצאה היא אות גבוהה יחס רעש והרזולוציה עוצמה 50-250 ננומטר מעל לממשק coverslip / בינוני. תכונות אלו הופכות מיקרוסקופיה TIRF כלי רב עוצמה כדי להמחיש חלבוני cytoskeletal ברמת המולקולה בודדת בתאים חיים עם פחותphototoxicity ומשופר לעומת זאת, ביחס לטכניקות אחרות 24-26. שלד התא כרוך בחלבונים רבים הפועלים בתיאום כדי להתאים לצרכים של סלולריים. ההשפעה של כלי דם, מחלה גורמת מוטציות בתקטנה ברגולציה על ידי cofilin נחקרה לאחרונה על ידי הקבוצה שלנו 27. בהתבסס על הממצאים הראשוניים שלנו, Aip1p, אקטין חלבון מחייב המאפשר ניתוק אקטין cofilin תלוי, נחקר. במחקרים ראשוניים, תאים המבטאים את המוטציה אקטין R256H לגדול בצורה גרועה בהעדר Aip1p, במיוחד בתנאי לחץ. הדבר מצביע על כך הרגולציה Aip1p של שלד התא אקטין המוטציה משתנה. הניתוחים של התנועה והלוקליזציה של Aip1p במתח R256H באמצעות תיוג הניאון ומיקרוסקופיה TIRF שלנו מאשש את הדינמיקה חריגה. בעתיד, אנו מתכננים לתייג חלבונים נוספים, כגון cofilin, עם fluorophores שונה כדי לחזות את תנועתם של חלבונים רביםבו זמנית כדי להבין טוב יותר את החלבון: אינטראקציות חלבון. ישנן מספר מגבלות ליצירת חלבון מתויג fluorescently וכמה מקרים שבם הטכניקה היא לא ריאלי. תג ניאון יכול לשבש את פעילותו של החלבון או לשנות את האינטראקציה עם שותפים מחייבים. זה כבר נתקל בניסיונות לתייג cofilin, אקטין עוד חלבון מחייב. ביטוי של המבנה מתויג כבר לא מוצלח בשמרי הפלואידים בשל תפקוד cofilin משובש. Cofilin הוא חלבון חיוני בשמרים. לפיכך, מחיקה של cofilin בלי מחדש הכנסה במקביל היא קטלנית; חסימת כניסתה הבאה על פלסמיד. אחת דרכים להימנע ממגבלה זו היא להשתמש בשמרי דיפלואידי. עותק אחד של גן cofilin הודחה מ, גרסה מתויגת הוצגה אקסוגני על פלסמיד, ולאחר מכן בחירה לתאים בת שאין לי cofilin הגנומי אבל מכילים פלסמיד 22 היכולת לתייג את חלבון fluorescently הייתהשנרכש על ידי הוספת התג לשאריות פנימיות בחלבון שהראו בעבר שיש מעט השפעה על האינטראקציות בין חלבונים שלה. N-או C-הסופית הם אתרים עדיפים להוסיף התג אלא אם האזורים ידועים להשפיע על חלבון רלוונטי: אינטראקציות חלבון. אם זה לא יניב חלבון פונקציונלי, יכולה להיות ניסיון הסופית החלופית או השאריות פנימיות. יש כמה שלבים קריטיים ביישום הטכניקות מתוארות. אחת הוא לקבוע את המיקום המתאים כדי לתייג את החלבון שחוסך בתפקוד. בקרות חזקות חייבים להיות כלולות כדי לאמת שתפקוד חלבון נשמר. שנית, השקופיות חייבים להיות במעקב כדי להבטיח את התאים לא לייבש במהלך הדמיה. שעווה ניתן להשתמש בקצוות של להחליק את המכסה כדי למנוע התייבשות במידת צורך. צעדים אלה כדי להבטיח את ההצלחה הם פשוט קבלת גישה זו צייתנית ויתרון למבני תמונה ליד קרום הפלזמה. היכולת באשרלוקליזציה ntify חלבון ותנועה בתאי חיים יכולים לשפר את ההבנה של תפקודים תאיים. כמוטציות המשפיעות על חלבוני cytoskeletal מזוהים, ביטוי של חלבונים מתויגים fluorescently ומיקרוסקופיה TIRF יכולה להיות שימושית כדי לחקור את המחלה האנושית הבסיסית הפתופיזיולוגיה.

אקטין הוא החלבון הדומיננטי המרכיב את שלד התא, ומשתתף בתהליכים תאיים קריטיים, כולל חלוקת תא, תנועת אברון, תנועתיות תא, התכווצות, ואיתות. במהלך העשור האחרון, מוטציות הגורמות למחלות בתקטנה התגלו בכל אחד מששת isoforms אקטין האדם המוביל למגוון של הפרעות, מmyopathies למחלת לב כלילית 1-7. התהליכים שבאמצעותם מוטציות אקטין להוביל למחלות ימשיכו להיות הובהר. שמרי המודל נשאר סטנדרטי כדי לחקור את ההשפעות ביוכימיות של מוטציות על תפקוד אקטין בשל היתרונות של איזופורם אחת החיוני אקטין, עקיבות גנטיות וגבוה שימור רצף אקטין ותפקוד זהב. מחקרים מראים כי מוטציות אקטין פרט להוביל לתפקוד ספציפי מולקולרי עם השפעות שליליות דומיננטיות 8. לדוגמא, מוטציות הגורמות לחירשות ביקטין γ הלא שרירים המשפיעות על השאריות ליס-118 לשנות רגולציה על ידיהחלבון אקטין מחייב Arp2 / 3 9. מחקרים לעתים קרובות להעסיק במבחנה ניתוחים של חלבון: אינטראקציות חלבון. חקירות ההשפעה יקטין מוטציות בביולוגיה של תא, ובפרט, יקטין לוקליזציה חלבון מחייבת בתא מוגבלות. מחקרים של שלד תא שמרי in vivo מסתמכים כמקובל בתמונות של תאים קבועים ממיקרוסקופ פלואורסצנטי הפוך 10. ניסויים אלה סיפקו נתונים בסיסיים על המורפולוגיה של שלד התא אקטין. חקירות שכן שולבו שלוש הדמיה confocal ממדים כדי להמחיש את הרשת המורכבת cytoskeletal 11, 12. הדמיה זו מאפשרת כימות של השפע ומיקום יחסי של תיקונים אקטין וחוטים. טומוגרפיה אלקטרון סעיף דקה שמשה לתמונה את המורפולוגיה של רשתות פילמנטיות הצפופים ביחס למבני subcellular השתמרו 13. ים סלולארי צפוףצעדים עם חתך קטן יכולים להיבחן בפרטים עדינים עם טכניקה זו. מחקרי הדמיה שהורחבו לתאים חיים באמצעות מיקרוסקופ פלואורסצנטי זמן לשגות. כאשר ניתן להקהות הלבנת צילום וקרינת רקע, זמן לשגות הדמיה מאפשרת חקירה באשר לדינמיקה של חלבוני cytoskeletal והתגובה לתנאים סביבתיים 11, 14. בנפרד, להדמיה של הדינמיקה של סיבי אקטין במבחנה הייתה מתקדמת על ידי ההקדמה של הקרינה השתקפות הפנימית המוחלטת מיקרוסקופיה (TIRF). בהשוואה למיקרוסקופ שדה רחב, יש TIRF היתרון של הקרינה רקע ירידה ולעומת זאת משופר לפקח חוטים בודדים 15, 16. עם התכונות האלה, מיקרוסקופיה TIRF הותאמה על ידי ביולוגים תא כדי לפקח על מבנים הסלולר בקרום הפלזמה 17, 18. אירועים הסלולר, לרבות שינויים בשלד התא, יכוללהיות דמיינו בזמן אמת עם phototoxicity הנמוך, לעומת זאת מקסימאלי, ותפרחת רקע מינימאלית 19. כדי להבין טוב יותר את ההשפעה של מוטציות אקטין בתנועה, לוקליזציה, ומחזור של חלבוני cytoskeletal בתיוג תא, מיקרוסקופיה TIRF והחלבון היו בשימוש. בזאת, שיטות כדי לחקור את ההשפעות של מוטציה רלוונטית קליני ביקטינו על דינמיקת cytoskeletal בשמר אפייה מתוארות. באופן ספציפי, הלוקליזציה והתנועה של החלבון קושר אקטין, Aip1p, הייתה דמיינו ולכמת בתאים המבטאים את המוטציה R256H ביקטין. טכניקות אלה משלימים במחקרים ביוכימיים מבחנה ולאפשר הבנה טובה יותר של אינטראקציות חלבון ופונקציות.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

מוטציות בתקטנה לגרום למגוון של מחלות בבני אדם כתוצאה משינויים מולקולריים ספציפיים, כי לעתים קרובות לשנות את תפקוד cytoskeletal. במחקר זה, הדמיה של חלבונים מתויגים fluorescently באמצעות הקרינה כוללת פנימית (TIRF) מיקרוסקופיה משמשת כדי לחזות ולכמת את השינויים בדינמיקת cytoskeletal. מיקרוסקופיה TIRF והשימוש בתגי ניאון גם מאפשר כימות של השינויים בדינמיקת cytoskeletal נגרמים על ידי מוטציות בתקטנה. באמצעות טכניקה זו, כימות של פונקצית cytoskeletal בתאים חיים באופן מועיל משלימה במחקרי מבחנה של תפקוד חלבון. כדוגמא, מוטציות missense משפיעות על השאריות אקטין R256 זוהו בשלושה isoforms אקטין אדם המצביע על חומצה אמינית זו משחקת תפקיד חשוב באינטראקציות רגולציה. ההשפעות של המוטציה R256H אקטין בתנועות cytoskeletal נחקרו תוך שימוש בשמרי המודל. החלבון, Aip1, אשר ידוע לסייע cofilin בdepolymerization אקטין, היהמתויג עם חלבון פלואורסצנטי ירוק (GFP) בN-הסופית ומעקב in vivo באמצעות מיקרוסקופיה TIRF. קצב תנועת Aip1p סוג שני בר וזנים מוטנטים היה לכמת. בתאים המבטאים אקטין מוטציה R256H, תנועת Aip1p מוגבלת וקצב תנועה הוא כמעט מחצית מהמהירות שנמדדה בתאים מסוג בר (0.88 ± 0.30 מיקרומטר / sec בתאי R256H לעומת 1.60 ± 0.42 מיקרומטר / sec בתאים מסוג בר, עמ &#39; &lt;0.005).

שיטה לתמונת הדינמיקה של חלבוני cytoskeletal בתא מוצגת. החלבון אקטין מחייב, Aip1p, היה מתויג עם GFP. העיצוב לפלסמיד קידוד המוצר המתויג מוצג באיור 1. פלסמיד שהפך לאחר מכן לתאי שמרים. ביטוי של מתויג fluorescently Aip1p אפשר להדמיה של חלבון ההתנהגות בתא. Aip1p בדרך כלל localizes לתיקונים אקטין באתרים של אנדוציטוזה 22. כדי לכמת תנועת Aip1p, יותר מ 50 מוקדי Aip1p ניאון היו במעקב בלמעלה מ 10 תאים, כפי שמוצגים באיור 2 א. המהירות הממוצעת חושב לכל אזור Aip1p ניאון (ראה איור 2). בתאים מסוג בר, תנועות Aip1p נעות על פני תא, ולאחר מכן נעלמות. המהירות הממוצעת של תנועת Aip1p בתאים מסוג בר היא 1.60 ± 0.42 מיקרומטר / sec. תאים המבטאים את המוטציה אקטין R256H, ידועות כבעלי מורפולוגיה לא תקינה של CY אקטיןtoskeleton 23, יש פנוטיפ Aip1p השתנה. בזן מוטנטי, תנועת Aip1p היא מוגבלת ואיטית יותר. המהירות הממוצעת של תנועת Aip1p היא 0.88 ± 0.30 מיקרומטר / שניות (p &lt;0.005). הגירת Aip1p מוגבלת לאזור המיידי, עם המוקדים שחגו סביב זה ולא חוצים את התא. בנוסף, Aip1p גלוי יותר המצביע על תחלופה איטית יותר של חלבון Aip1. <img alt="איור 1" fo:content-width="5in" fo:src="/files/ftp_upload/51551/51551fig1highres.jpg" src="/files/ftp_upload/51551/51551fig1.jpg" /> איור 1. תרשים של בניית פלסמיד.) שבר Aip1 המוגבר באמצעות PCR מוצג להיות מתעכל על ידי אנזימי הגבלה (ברגים צהובים). B) פלסמיד, PB1996, מתעכל עם הגבלת אנזימים כדי להסיר את גן Abp140. C) מתעכל ברי Aip1 וPB1996 הם ligated to יוצר פלסמיד PB1996 Aip1. ד) פלסמיד PB1996 Aip1 הוא לינארית ולהפוך לתאי שמרים שבו את ה-DNA משולב בכרומוזום. <img alt="איור 2" fo:content-width="6in" fo:src="/files/ftp_upload/51551/51551fig2highres.jpg" src="/files/ftp_upload/51551/51551fig2.jpg" /> איור 2. תרשים של בניית מתח אקטין שמרים שעברו מוטציה. קידוד פלסמיד איזופורם אקטין המוטציה הופך לאחר מכן לקו סלולרי ונבחר על סמך היכולת לגדול על טריפטופן תקשורת הלוקה בחסר. הקווים הירוקים מצביעים על הדנ&quot;א בכרומוזומים. העיגול השחור הוא פלסמיד. העיגול בצבע חום מייצג תא שמרים. התיבות כל מצביעות גן ספציפי: צהוב היא אקטין, כתום הוא לאוצין, חום הוא אורציל, וורוד הוא טריפטופן. X על התיבה מצביע גן נמחק מהדנ&quot;א בכרומוזומים. בצעדים 2.3 ו2.4, הכוכב השחור על i הגן אקטיןndicates המוטציה R256H. <img alt="איור 3" fo:content-width="5in" fo:src="/files/ftp_upload/51551/51551fig3highres.jpg" src="/files/ftp_upload/51551/51551fig3.jpg" /> איור 3. תנועת Aip1p-GFP בתאי שמרים חיים.) תמונות מסוג פרוע ותאי R256H להביע Aip1p GFP-tagged מוצגות. תאים נמצאים בצמיחה בשלב מוקדם יומן ותמונות נרכשו בכל שנייה 0.2 15 שניות. החיצים מציינים את מיקומו של מוקד ניאון בודד לאורך זמן, הכחול לסוג בר ואדום לזנים אקטין מוטציה. המסגרת האחרונה מציגה את הנתיב של מוקדי Aip1 כקו ירוק. סרגל קנה מידה שמוצג הוא 5 מיקרומטר. B) קצב תנועת Aip1p נמדד באמצעות ImageJ. גרף עלילת הפיזור מציג את השיעור למוקדי ניאון בודדים. הפס האופקי מציין את המהירות הממוצעת לסוג בר (כחול) ומוטציה (אדום) יקטין זנים.Aip1p נע ב1.60 ± 0.42 מיקרומטר / sec בתאים מסוג בר השוואה ל0.88 ± 0.30 מיקרומטר / שניות לתאים לבטא אקטין המוטציה R256H (p &lt;0.005).

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

מוטציות הגורמות למחלות ביקטינו יכולות לשנות את תפקוד cytoskeletal. דינמיקת Cytoskeletal הם לכמת באמצעות הדמיה של חלבונים מתויגים fluorescently באמצעות כולל מיקרוסקופ פלואורסצנטי הפנימי. כדוגמא, חלבון cytoskeletal, Aip1p, שינה לוקליזציה ותנועה בתאים המבטאים את איזופורם אקטין המוטציה, R256H.

Aip1p Dynamics שונה על ידי מוטצית R256H ביקטין

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Nanyang Technological University

Research

JoVE Journal

Biology

7.9K Views.  University of Iowa.  מוטציות הגורמות למחלות ביקטינו יכולות לשנות את תפקוד cytoskeletal. דינמיקת Cytoskeletal הם לכמת באמצעות הדמיה של חלבונים מתויגים fluorescently באמצעות כולל מיקרוסקופ פלואורסצנטי הפנימי. כדוגמא, חלבון cytoskeletal, Aip1p, שינה לוקליזציה ותנועה בתאים המבטאים את איזו...

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

אקטין Co-Assay שקיעה, כי ניתוח של חלבון מחייב את ה-F-אקטין

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

דימות של תא חי F-אקטין Dynamics באמצעות פלורסנט מיקרוסקופית רבב (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

מעקב דינמיקה של engraftment שריר בבעלי חיים קטנים על ידי In vivo פלורסנט הדמיה

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP & FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

מבחני photobleaching (FRAP &amp; FLIP) כדי למדוד Dynamics חלבון הכרומטין בתוך החיים בתאי גזע עובריים

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

עיון cytoskeleton אקטין ב לתאי אנדותל חיים הבעת GFP-אקטין

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

לכידה סלקטיבית של 5-hydroxymethylcytosine מהדנ&quot;א הגנומי

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

דגי ה-DNA 3D חזקים באמצעות בדיקות שכותרתו ישירות

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

במעקב 4 ממדי Vivo של תאי גזע ואבות היווצרות דם במבוגרי עכבר calvarial מח עצם

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

ניתוח Glucocorticoid צואה: לא פולשני ניטור הכליה ב Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

זמן לשגות הדמיה ברזולוציה גבוהה וניתוח אוטומטי של Dynamics microtubule In Living האדם טבורי וריד לתאי אנדותל

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...