עבודה זו נתמכה על ידי מימון ממרדוק הילדים מכון המחקר ותכנית התמיכה בתשתית התפעולית של הממשלה ויקטוריאני.

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

יש המחברים אין לחשוף.

חלק קריטי של assay זה הוא הוספת הריכוזים המתאימים של ס salivarius וpneumococci בסעיפי 3.1.7 ו3.1.12. ריכוזים מחושבים באמצעות קריאות OD אבל inocula המדויק לא נקבעו עד צלחות נספרות ביום המחרת. מסיבה זו, אנו ממליצים על ביצוע עקומות גדילה למדידת OD וספירת קיימא (CFU / מיליליטר) לאורך זמן עבור כל זני החיידקים משמשים assay כדי לזהות את שלב אמצע היומן ולסייע בהערכת ריכוז על ידי OD. בנוסף, זני ריאות יכולים להיות שונים באופן משמעותי בדבקות המאפיינים שלהם. זנים עם דבקות טובה (&gt; 10% מinocula הקפדה על תאי האפיתל לאחר דגירה 3 שעות) מומלצים למבחנים חוקרים את היכולת של פרוביוטיקה לעכב היצמדות ריאות. גם כאשר היא מבוצעת על ידי מפעיל מנוסה, רמות הדבקות יכולות להשתנות assay לassay, כפי שמעידה על ידי הברים שגיאה הגדולים יחסית ניתן לראות באיור 5. למסיבה זו אנו ממליצים על מינימום של שלוש חזרות לכל ניסוי, עם בארות כפולות עבור כל תנאי assay. השתנות דומה דווחה במבחני דבקות באמצעות חיידקי Escherichia 18. בפרוטוקול זה, תאים טופחו במשך 3 שעות הבאות התוספת של pneumococci. זמן הדגירה עשוי להתקצר אם ניסויים כמובן זמן דבקות מבוצעים ומראים כי רוב החיידקים לדבוק בשעה הראשונה של דגירה. פרוטוקול זה מציג שתי שיטות לכימות דבקות pneumococcal, qPCR וספירה בת קיימא. שני השיטות מתאימות, והבחירה תלויה בציוד של מפעיל העדפה ומעבדה זמינה (למשל גישה למכונה ה-PCR בזמן אמת). כימות על ידי ספירת קיימא היא שיטת עלות נמוכה שאינו דורשת חומרים כימיים נוספים או מכונה ה-PCR בזמן אמת. עם זאת, הוא משתמש בצלחות רבות (בדרך כלל 80 צלחות עבור assay 12 גם) וחייבת להתבצע באופן מיידיly בסוף assay, וספירת מושבות ריאות יכולה להיות קשה על צלחות המכילות כמות גדולה של ס salivarius. כימות על ידי qPCR היא יקרות יותר ודורשת צעד מיצוי DNA ארוך, אבל יכולות להיות מאוחסנות דגימות קפואות ומעובד בקבוצות, הגברת יעילות. ה-DNA שחולץ יכול לשמש גם למטרות אחרות, כגון זיהוי qPCR של ס &#39;חסיד salivarius. אם חוקר ס דבקות salivarius, מומלץ לכלול בארות עם CCL-23 תאים בתוספת ס salivarius (ללא pneumococci) ובארות עם CCL-23 תאים בתוספת ס פקדים נוספים כsalivarius והפרין. Assay הבסיסי גם יכול להיות מותאם כדי לחקור היבטים מדעיים אחרים של קולוניזציה. לדוגמא, ההשפעה של פרוביוטיקה על ייצור ציטוקינים יכולה להיות מוערכת על ידי אחסון ומנסה לאמוד supernatants תא. Assay יכול גם להיות שונה כדי לבחון פלישת חיידקים ולא על ידי דבקותדוגרים תאים עם אנטיביוטיקה בלתי חדירה קרום תא כדי להרוג חיידקים תאיים לפני קצירה ותאי lysing. כפי שתואר כאן, assay אינו מבחין בין pneumococci חסיד ופולשנית (מופנם). עם זאת, מחקרים קודמים מצאו הרמות של pneumococci הפנים להיות קטנות מאוד (בדרך כלל ≤ 0.01% מinocula) 10 לכן עבור רוב מבודד (כולל PMP843), רובם המכריע של pneumococci הקשורים הסלולרי הם חסיד ולא הפנים. יישומים נוספים כוללים בדיקת זנים פרוביוטיים אחרים ליכולת לעכב קולוניזציה, ו / או מסתכל על זני חיידקים שעברו מוטציה כדי לחקור את תפקידם של גנים ספציפיים של עניין. מגבלה ברורה של assay זה במבחנה היא שהיא אינה כוללת את האפיתל הוקם, תאי מערכת החיסון, צמחייה רגילה, או גורמים אחרים המשפיעים על סיכוי קולוניזציה pneumococcal in vivo. כדי להעריך באופן מלא אם cou פרוביוטיקהld להועיל במניעת קולוניזציה הפתוגן בדרכי הנשימה, במחקרי vivo תוך שימוש במודלים של בעלי חיים וניסויים קליניים בבני אדם הם ערובה. עם זאת, מבחני דבקות במבחנה לשמש כמסך שימושי לזיהוי פרוביוטיקה עם הפוטנציאל לעכב היצמדות לדלקת ריאות ויכולים לספק מידע על אסטרטגיות מינון מועדפים, כמו גם מתן מודל ניסיוני שיכול לשמש למחקרים מכניסטית.

pneumoniae Streptococcus (pneumococcus) הוא חיידק גראם חיובי שיכול לגרום לזיהומים כוללים דלקת ריאות, דלקת אוזן תיכונה, ודלקת קרום מוח. זה גורם עיקרי למחלות אצל ילדים במדינות בעלות הכנסה נמוכה ואחראים למותם משוער של 800,000 ילדים מתחת לגיל חמש בשנה 1. Pneumococci לעתים קרובות נשא בלוע אפם של ילדים צעירים. למרות התישבות זו נחשבת בדרך כלל ללא תסמינים, הוא מקדים את זיהום pneumococcal ומשמש כמאגר לחיידקים באוכלוסיות אנושיות 2. חיסון המצומד דלקת ריאות ביעילות מפחית את הכרכרה של קפסיד הכלולים בתוך החיסון. עם זאת, ישנם מעל 90 זנים אל ריאות, וחיסון יכול להוביל להחלפת סרוטיפ, לפיה החיסול של זנים אל חיסון ואחריו עלייה בכרכרה ומחלה הנגרמת על ידי זנים אל nonvaccine 3. כמו כן, בחלק מאוכלוסיות בסיכון גבוה, דלקת ריאותהתישבות מתרחשת לעתים קרובות בשלב מוקדם מאוד בחיים, לפני מתן מנת החיסון הראשונה 4,5. לאחרונה, השימוש בפרוביוטיקה הוצע כאסטרטגיה נוספת כדי לעכב 6,7 קולוניזציה pneumococcal. במבחני חוץ גופית דבקות שנוצלו כדי לבחון דבקות pneumococcal 8,9. מבחני אלה הותאמו כדי לחקור את ההשפעה של לקטובצילוס GG rhamnosus פרוביוטיים (LGG) על דבקות pneumococcal 10. בנוסף לLGG וחיידקים חומצה לקטית אחרים, סטרפטוקוקוס salivarius, תושב נפוץ של חלל הפה, נחקר כפרוביוטיים פוטנציאל לדרכי הנשימה עקב קולוניזציה את הפוטנציאל שלה והיכולת לעכב pneumococci ופתוגנים אחרים בדרכי הנשימה במבחנה 11 - 13. הפרוטוקול המובא כאן מתאר assay דבקות בשימוש כדי לחקור את השפעותיו של ס &#39; salivarius K12 על דבקות pneumococcalלשורת תאי אפיתל האנושית CCL-23. לפני השימוש בassay, מבודד pneumococcal הוערכו על יכולות דבקות, כמו צמיחה ודבקות מאפיינים יכולים להשתנות באופן משמעותי בין מבודד 10,14. עקומות גדילה של pneumococci וס salivarius בוצע כדי לקבוע שלב אמצע יומן וריכוז אומדן (יחידות מושבה להרכיב או CFU / מיליליטר) על ידי צפיפות אופטית (OD, איור 1). מומלץ לבחון את הצמיחה על ידי ספירה וOD קיימא עבור כל בודד לפני השימוש בassay. assay זה יכול להתבצע בכל מעבדה עם מתקני תרבות תקן רקמות וציוד. בפרוטוקול זה, את ההשפעות של שלוש מנות של ס salivarius מנוהל 1 שעות לפני התוספת של pneumococci על דבקותו של ס &#39; pneumoniae PMP843, 19F בודד מרכבת סרוטיפ נגזר מספוגית האף והלוע, נבחנים. שתי דרכים שונות כדי לכמת pneumococci חסיד מוצגות: ציפוי על אגר דם כדי להרתיעשלי ספירות קיימא, ומיצוי DNA וזיהוי של גן lytA pneumococcal ידי 15 qPCR. פרוטוקול assay הדבקות הבסיסי ניתן לשנות בקלות כדי לבדוק מינונים או זמן של ממשל של פרוביוטיקה שונים ויכול לשמש גם עם זני חיידקים אחרים או מין.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

היצמדות של Streptococcus pneumoniae (pneumococcus) לאפיתל רירית לוע האף יכולה לגרום לקולוניזציה, והוא נחשב תנאי לדלקות ריאות כגון דלקת ריאות ודלקת אוזן תיכונה. ניתן להשתמש במבחני חוץ גופית דבקות ללמוד את הקובץ המצורף של pneumococci לאפיתל תא monolayers ולחקור התערבויות פוטנציאליות, כגון השימוש בפרוביוטיקה, לעכב קולוניזציה ריאות. הפרוטוקול המתואר כאן משמש כדי לחקור את ההשפעות של salivarius סטרפטוקוקוס פרוביוטיים על הדבקות של pneumococci לשורת תאי אפיתל האנושי CCL-23 (המכונה לעתים הפ-2 תאים). Assay כרוך בשלושה שלבים עיקריים: 1) הכנה של תאי האפיתל וחיידקים, 2) תוספת של חיידקים לאפיתל monolayers תא, ו3) זיהוי של pneumococci חסיד ידי ספירת קיימא (דילול סדרתי וציפוי) או כמוני בזמן אמת PCR (qPCR ). טק זוhnique הוא פשוט יחסית ולא דורש ציוד מיוחד מלבד התקנה בתרבית רקמה. Assay יכול לשמש כדי לבדוק את המינים פרוביוטיים אחרים ו / או מעכבים פוטנציאליים של קולוניזציה דלקת ריאות וניתן לשנות בקלות כדי לענות על שאלות מדעיות אחרות בנוגע לדבקות ופלישת ריאות.

תוצאות מניסוי נציג שבי pneumococci (ס דלקת ריאות PMP843, בודד מיישבים 19F) נוספו לCCL-23 תאים 1 שעות לאחר התוספת של ס &#39; salivarius, ודבקות pneumococcal הייתה לכמת ידי שתי ספירת קיימא וlytA qPCR מוצגים בטבלה 2. תוצאות היו עקביות בין שתי השיטות הן למספר המוחלט של חיידקים (שהוצג כCFU / מיליליטר) ואת דבקות%, מנורמל למספר pneumococci של חסיד בבארות המכילות pneumococci לבד. הפארין משמש כביקורת כפי שהוא ידוע לעכב היצמדות לדלקת ריאות ולכן העמידה מופחתת בpneumococci + מצב הפרין (בדרך כלל &lt;40% בהשוואה לpneumococci לבד) מעידה על assay מוצלח. ס salivarius מעכב היצמדות pneumococcal באופן תלוי מינון, כפי שמוצג בטבלה 2, שבו הריכוז הגבוה של ס salivarius (בקירובly 10 ס salivarius: pneumococci 1) הביא לדבקות pneumococcal הנמוכה ביותר. איור 5 מראה את הדבקות של pneumococci לCCL-23 תאים כאשר ס salivarius הוא הוסיף 1 שעות לפני pneumococci (preaddition), במקביל (coaddition), או 1 שעות לאחר pneumococci (הודעה בנוסף-). ס salivarius הוא יעיל יותר בעיכוב היצמדות pneumococcal כאשר הוסיף לפני pneumococci, כמו גם את המינון הגבוה ובינוני של ס &#39; salivarius מופחת באופן משמעותי דבקות pneumococcal בassay preaddition (איור 5 א), ואילו במינון הגבוה רק של ס &#39; salivarius עכבות דבקות pneumococcal בcoaddition ומבחני הודעה בנוסף-(5B דמויות ו5C). הנתונים מוצגים בטבלה 2 ואיורים 4 ו -5 התקבלו באמצעות גרסה קודמת של פריימרים lytA qPCR ו<html> לחקור 17. הפרוטוקול הנוכחי מתאר assay qPCR המעודכן. <img alt="איור 1" fo:content-width="6in" fo:src="/files/ftp_upload/51069/51069fig1highres.jpg" src="/files/ftp_upload/51069/51069fig1.jpg" width="500px" /> איור 1. עקומות גדילת נציגו של ס &#39; pneumoniae PMP843 () וס salivarius K12 (ב &#39;). לכל מין, CFU / מיליליטר, כפי שנקבע על ידי ספירת קיימא מוצג ב( ציר y שמאל) שחור, וצפיפות אופטית (OD) ב600 ננומטר מוצגת ב( ציר y מימין) אפור. אמצע יומן השלב הוערך על ידי ספירת קיימא להיות 3 שעות לס pneumoniae PMP843 ושעה 2 לס salivarius K12. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51069/51069fig1highres.jpg" target="_blank">לחץ כאן לצפייה בתמונה גדולה יותר.</a> &quot;Width =&quot; fig2highres.jpg &quot;src =&quot; / files/ftp_upload/51069/51069fig2.jpg &quot;/&gt; 500px איור 2. דוגמאות לCCL-23 תאים בריאים וCCL-23 תאים עם אפקטי cytopathic (CPE). א) דוגמא של monolayer בריא, ומחוברות של CCL-23 תאים. B) תאי CCL-23 עם אפקטי cytopathic. שים לב עיגול של תאים, אזורים תאיים בהירים, ובאזורים של monolayer שיבש בו תאים שהרימו את הצלחת. תמונות צולמו באמצעות מיקרוסקופ אור הפוך בהגדלה 200X. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51069/51069fig2highres.jpg" target="_blank">לחץ כאן לצפייה בתמונה גדולה יותר.</a> <img alt="איור 3" fo:content-width="5in" src="/files/ftp_upload/51069/51069fig3highres.jpg" width="500px" /> איור 3. ס salivarius ומושבות pneumococcal על אגר דם סוס. ס מושבות salivarius הם קטנות ולבנים, כפי שצוינו על ידי לבניםחץ ומושבות מכתב א &#39;דלקת ריאות (ס דלקת ריאות) הן בדרך כלל גדולות יותר, שטוח יותר, וירקרקים בצבע, כפי שצוינו על ידי ב&#39; חץ ומכתב הלבן <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51069/51069fig3highres.jpg" target="_blank">לחצו כאן לצפייה בתמונה גדולה יותר.</a> <img alt="איור 4" fo:content-width="3in" src="/files/ftp_upload/51069/51069fig4highres.jpg" width="300" /> איור 4. דוגמא ס עקומת סטנדרט pneumoniae לqPCR. חישובי הדנ&quot;א הגנומי מוצגים יחד עם ערכי ה-CT (* ממוצע של בארות עקומת סטנדרט כפולות מassay qPCR נציג), עם הערך כתוצאה הסטנדרטי עקום, משוואה, ו-R 2 המוצג על הגרף. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51069/51069fig4highres.jpg" target="_blank">לחץ כאן כדי להציג תמונה גדולה יותר.</a> <img alt="איור 5" fo:<html> רוחב תוכן-width = &quot;6in&quot; src = &quot;/ files/ftp_upload/51069/51069fig5highres.jpg&quot; = &quot;600&quot; /&gt; איור 5. השפעת ס salivarius על דבקות pneumococcal לCCL-23 תאי דבקות דלקת ריאות לCCL-23 monolayers תא כאשר תאים הודגרו עם pneumococci לבד. (PNC; מנורמלת ל100%), עם pneumococci ו100 U / ml הפרין (heparin), או עם pneumococci ו ס salivarius הוסיף ביחס של ~ 10: ס salivarius: pneumococci 1 (גבוה), ~ 1 ס salivarius: pneumococci 1 (בינוני), או ~ 1 ס salivarius:. 10 pneumococci (נמוך) ס salivarius נוספה 1 שעות לפני (א &#39;), באותו הזמן כ( ב&#39;), או 1 שעות לאחר pneumococci (C). n ≥ 3, * מציין P &lt;0.05 בהשוואה לpneumococci לבד (של סטודנטים מבחן t). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51069/51069fig5highres.jpg" target="_blank">לחץ כאן לצפייה בתמונה גדולה יותר.</a> &quot;עבור: לשמור-together.within-page =&quot; תמיד &quot;&gt; <table style=";text-align:right;direction:rtl"><tbody><tr><td> קבוצה </td><td> מצב assay </td><td> הערות </td></tr><tr><td> </td><td> CCL-23 תאים לבד </td><td></td></tr><tr><td> ב &#39; </td><td> CCL-23 תאים + pneumococci </td><td></td></tr><tr><td> C </td><td> CCL-23 תאים + pneumococci + הפרין </td><td> דבקות pneumococcal לוקי הפרין לתא שטח glycosylaminoglycans 16, והוא משמש כביקורת </td></tr><tr><td> D </td><td> CCL-23 תאים + pneumococci + S. salivarius [גבוה] </td><td> כ 1 pneumococcus: 10 ס salivarius </td></tr><tr><td> E </td><td> CCL-23 תאים + pneumococci + S. salivarius [מד] </td><td> כ 1 pneumococcus: 1 ס salivarius </td></tr><tr><td> F </td><td> CCL-23 תאים + pneumococci + S. salivarius [נמוך] </td><td> כ 10 pneumococcus: 1 ס salivarius </td></tr></tbody></table> טבלת 1. תנאים שנבדקו בassay דבקות pneumococcal. שישה תנאי assay בסיסיים שתוארו כאן. <table style=";text-align:right;direction:rtl"><tbody><tr><td> מצב assay * </td><td> CFU / מיליליטר PNC (qPCR) </td><td> % דבקות (qPCR) </td><td> CFU / מיליליטר PNC (ספירת קיימא) </td><td> % דבקות (ספירת קיימא) </td></tr><tr><td> PNC לבד </td><td> 1.1 x 10 7 </td><td> 100 </td><td> 9.1 x 10 6 </td><td> 100 </td></tr><tr><td> PNC + הפרין </td><td> 1.5 x 10 6 </td><td> 14 </td><td> 7.6 x 10 5 </td><td> 8 </td></tr><tr><td> PNC + סאל [גבוה] </td><td> 6.1 x 10 5 </td><td> 6 </td><td> 3.2 x 10 5 </td><td> 4 </td></tr><tr><td> PNC + סאל [מד] </td><td> 3.6 x 10 6 </td><td> 33 </td><td> 2.7 x 10 6 </td><td> 29 </td></tr><tr><td> PNC + סאל </td><td> 9.8 x 10 6 </td><td> 92 </td><td&gt; 8.2 x 10 6 </td><td> 90 </td></tr></tbody></table> טבלה 2: דבקות דלקת ריאות לCCL-23 תאים בעקבות התוספת של ס &#39; salivarius כפי שנקבע על ידי lytA qPCR ושיטת ספירת קיימא * PNC = pneumococci.; סאל = ס salivarius; [גבוה] = כ 10 סאל: 1 PNC; = סאל [מד] כ 1: 1 PNC; [נמוך] = כ 1 סאל: 10 PNC.

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

במבחנה יכולים לשמש מבחני דבקות ללמוד את הקובץ המצורף של Streptococcus pneumoniae לאפיתל monolayers תא ולחקור התערבויות פוטנציאליות כגון השימוש בפרוביוטיקה לעיכוב קולוניזציה ריאות.

חוקר את ההשפעות של פרוביוטיקה על דלקת ריאות התיישבות שימוש<em&gt; במבחנה</em&gt; Assay דבקות

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

investigating-effects-probiotics-on-pneumococcal-colonization-using

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

12.5K Views.  Murdoch Childrens Research Institute.  במבחנה יכולים לשמש מבחני דבקות ללמוד את הקובץ המצורף של Streptococcus pneumoniae לאפיתל monolayers תא ולחקור התערבויות פוטנציאליות כגון השימוש בפרוביוטיקה לעיכוב קולוניזציה ריאות. 

Video: Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. Biofilms are community-associated bacteria attached to a surface and encased in a matrix. The role of the extracellular matrix is multifaceted, including facilitating nutrient acquisition, and offers significant protection against environmental stresses (e.g. host immune responses). In an effort to acquire a better understanding as to how the bacteria within a biofilm respond to environmental stresses we have used a protocol wherein we visualize bacterial biofilms which have formed in an 8-well chamber slide. The biofilms were stained with the BacLight Live/Dead stain and examined using a confocal microscope to characterize the relative biofilm size, and structure under varying incubation conditions. Z-stack images were collected via confocal microscopy and analyzed by COMSTAT. This protocol can be used to help elucidate the mechanism and kinetics by which biofilms form, as well as identify components that are important to biofilm structure and stability.

In vitro Biofilm Formation in an 8-well Chamber Slide

This article describes the procedure for the formation and visualization of a bacterial biofilm grown within an 8-well chamber slide

ב גיבוש biofilm חוץ גופית ב 8-Slide גם לשכת

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a process that results in the exocytosis of allergic mediators. Modulation of mast cell degranulation by drugs and toxicants may have positive or adverse effects on human health. Mast cell function has been dissected in detail with the use of rat basophilic leukemia mast cells (RBL-2H3), a widely accepted model of human mucosal mast cells3-5. Mast cell granule component and the allergic mediator &#946;-hexosaminidase, which is released linearly in tandem with histamine from mast cells6, can easily and reliably be measured through reaction with a fluorogenic substrate, yielding measurable fluorescence intensity in a microplate assay that is amenable to high-throughput studies1. Originally published by Naal et al.1, we have adapted this degranulation assay for the screening of drugs and toxicants and demonstrate its use here.
Triclosan is a broad-spectrum antibacterial agent that is present in many consumer products and has been found to be a therapeutic aid in human allergic skin disease7-11, although the mechanism for this effect is unknown. Here we demonstrate an assay for the effect of triclosan on mast cell degranulation. We recently showed that triclosan strongly affects mast cell function2. In an effort to avoid use of an organic solvent, triclosan is dissolved directly into aqueous buffer with heat and stirring, and resultant concentration is confirmed using UV-Vis spectrophotometry (using &#949;280 = 4,200 L/M/cm)12. This protocol has the potential to be used with a variety of chemicals to determine their effects on mast cell degranulation, and more broadly, their allergic potential.

Mast cell degranulation, the release of allergic mediators, is important in allergy, asthma, and parasite defense. Here we demonstrate techniques1 for assessing effects of drugs and toxicants on degranulation, methodology recently utilized to exhibit the powerful inhibitory effect of antibacterial agent triclosan2.

Assay Microplate כדי להעריך את ההשפעות כימיות על degranulation תא התורן RBL-2H3: השפעות של Triclosan ללא שימוש בממס אורגני

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

במבחנה Assay כדי להעריך את ההשפעה של immunoregulatory מסלולים על פונקצית Effector הנייד HIV-ספציפית T מסוג CD4

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

בעקבות בזמן אמת השפעת גורמי דלקת ריאות ארסיים בעכבר דלקת ריאות דגם אקוטי באמצעות חיידקי Bioluminescent

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; שימוש תגובת Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; על ידי לאטקס התלכדות

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms. We have shown that bacterially produced antimicrobial peptides (bacteriocins) dictate the outcome of these competitive interactions. All fully-sequenced pneumococcal strains harbor a bacteriocin-like peptide (blp) locus. The blp locus encodes for a range of diverse bacteriocins and all of the highly conserved components needed for their regulation, processing, and secretion. The diversity of the bacteriocins found in the bacteriocin immunity region (BIR) of the locus is a major contributor of pneumococcal competition. Along with the bacteriocins, immunity genes are found in the BIR and are needed to protect the producer cell from the effects of its own bacteriocin. The overlay assay is a quick method for examining a large number of strains for competitive interactions mediated by bacteriocins. The overlay assay also allows for the characterization of bacteriocin-specific immunity, and detection of secreted quorum sensing peptides. The assay is performed by pre-inoculating an agar plate with a strain to be tested for bacteriocin production followed by application of a soft agar overlay containing a strain to be tested for bacteriocin sensitivity. A zone of clearance surrounding the stab indicates that the overlay strain is sensitive to the bacteriocins produced by the pre-inoculated strain. If no zone of clearance is observed, either the overlay strain is immune to the bacteriocins being produced or the pre-inoculated strain does not produce bacteriocins. To determine if the blp locus is functional in a given strain, the overlay assay can be adapted to evaluate for peptide pheromone secretion by the pre-inoculated strain. In this case, a series of four lacZ-reporter strains with different pheromone specificity are used in the overlay.

Competition in Streptococcus pneumoniae is mediated by bacteriocins, small antimicrobial peptides with inhibitory activity towards pneumococcus and other related species.&#160; Here we describe an optimized bacterial overlay assay that allows for the characterization of bacteriocin activity and inhibitory spectrum, bacteriocin-specific immunity, and detection of secreted quorum sensing peptides.

באמצעות assay הכיסוי למדוד את הייצור בקטריאלי ורגישות לדלקת הריאות Bacteriocins איכותי

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

<em&gt; במבחנה</em&gt; דגם של מחסום דם-מוח באמצעות ספקטרוסקופיית עכבה: התמקדות T Cell-אנדותל אינטראקציה תא

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in diameter. In addition to a characterization of forward and sideward scatter properties, it enables the use of fluorescent labeled markers like antibodies to detect respective structures. Using indirect antibody staining, flow cytometry is employed here to quantify birch pollen allergen (precisely Bet v 1)-loaded particles of 0.5 to 10 &#181;m in diameter in inhalable particulate matter (PM10, particle size &#8804;10 &#181;m in diameter). PM10 particles may act as carriers of adsorbed allergens possibly transporting them to the lower respiratory tract, where they could trigger allergic reactions.
So far the allergen content of PM10 has been studied by means of enzyme linked immunosorbent assays (ELISAs) and scanning electron microscopy. ELISA measures the dissolved and not the particle-bound allergen. Compared to scanning electron microscopy, which can visualize allergen-loaded particles, flow cytometry may additionally quantify them. As allergen content of ambient air can deviate from birch pollen count, allergic symptoms might perhaps correlate better with allergen exposure than with pollen count. In conjunction with clinical data, the presented method offers the opportunity to test in future experiments whether allergic reactions to birch pollen antigens are associated with the Bet v 1 allergen content of PM10 particles &#62;0.5 &#181;m.

Here, we present a protocol to quantify allergen-loaded particles by flow cytometry. Ambient particulate matter particles may act as carriers of adsorbed allergens. We show here that flow cytometry, a method widely used to characterize suspended solids &#62;0.5 &#181;m in diameter, can be used to measure these allergen-loaded particles.

ניתוח תזרים Cytometric נ בית נכנס חלקיקים 1 האלרגנים PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the development and persistence of many health related infections. One of the most well described and studied biofilms in human disease occurs in chronic pulmonary infection of cystic fibrosis patients. When studying biofilms in the context of the host, many factors can impact biofilm formation and development. In order to identify how host factors may affect biofilm formation and development, we used a static chambered coverglass method to grow biofilms in the presence of host-derived factors in the form of sputum supernatants. Bacteria are seeded into chambers and exposed to sputum filtrates. Following 48 hr of growth, biofilms are stained with a commercial biofilm viability kit prior to confocal microscopy and analysis. Following image acquisition, biofilm properties can be assessed using different software platforms. This method allows us to visualize key properties of biofilm growth in presence of different substances including antibiotics.

This protocol describes the visualization of biofilm development following exposure to host-factors using a slide chamber model. This model allows for direct visualization of biofilm development as well as analysis of biofilm parameters using computer software programs.

לדמיין את ההשפעות של כיח על פיתוח biofilm באמצעות מודל תאיים coverglass

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...