Wir danken den Mitgliedern des Wan Labors und dem Nagarajan Labor für informative Diskussionen. N.Nagarajan wird durch die Finanzierung von A * STAR unterstützt. Y.Wan wird unterstützt durch die Förderung von A * STAR und Society in Science-Branco Weiss Fellowship.

<ol>
	<li>Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+transcriptome+through+RNA+structure.">Understanding the transcriptome through RNA structure.</a> Nat.Rev.Genet. 12 (9), 641-655 (2011).</li><li>Kertesz, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+measurement+of+RNA+secondary+structure+in+yeast.">Genome-wide measurement of RNA secondary structure in yeast.</a> Nature. 467 (7311), 103-107 (2010).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+Measurement+of+RNA+Folding+Energies.">Genome-wide Measurement of RNA Folding Energies.</a> Mol.Cell. 48 (2), 169-181 (2012).</li><li>Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+RNA+structure+using+nuclease+digestion+and+high-throughput+sequencing.">Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing.</a> Nat.Protoc. 8 (5), 849-869 (2013).</li><li>Wan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+and+variation+of+RNA+secondary+structure+across+the+human+transcriptome.">Landscape and variation of RNA secondary structure across the human transcriptome.</a> Nature. 505 (7485), 706-709 (2014).</li><li>Spitale, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+imprints+in+vivo+decode+RNA+regulatory+mechanisms.">Structural imprints in vivo decode RNA regulatory mechanisms.</a> Nature. 519 (7544), 486-490 (2015).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome-wide+profiling+of+RNA+secondary+structure+reveals+novel+regulatory+features.">In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.</a> Nature. 505 (7485), 696-700 (2014).</li><li>Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+probing+of+RNA+structure+reveals+active+unfolding+of+mRNA+structures+in+vivo.">Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo.</a> Nature. 505 (7485), 701-705 (2014).</li><li>Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-linking,+ligation,+and+sequencing+of+hybrids+reveals+RNA-RNA+interactions+in+yeast.">Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast.</a> Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).</li><li>Sugimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hiCLIP+reveals+the+in+vivo+atlas+of+mRNA+secondary+structures+recognized+by+Staufen+1.">hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1.</a> Nature. 519 (7544), 491-494 (2015).</li><li>Engreitz, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-RNA+interactions+enable+specific+targeting+of+noncoding+RNAs+to+nascent+Pre-mRNAs+and+chromatin+sites.">RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites.</a> Cell. 159 (1), 188-199 (2014).</li><li>Ramani, V., Qiu, R., Shendure, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+determination+of+RNA+structure+by+proximity+ligation.">High-throughput determination of RNA structure by proximity ligation.</a> Nat.Biotechnol. , (2015).</li><li>Lu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+Duplex+Map+in+Living+Cells+Reveals+Higher-Order+Transcriptome+Structure.">RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.</a> Cell. 165 (5), 1267-1279 (2016).</li><li>Sharma, E., Sterne-Weiler, T., O'Hanlon, D., Blencowe, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+Mapping+of+Human+RNA-RNA+Interactions.">Global Mapping of Human RNA-RNA Interactions.</a> Mol.Cell. 62 (4), 618-626 (2016).</li><li>Aw, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Mapping+of+Eukaryotic+RNA+Interactomes+Reveals+Principles+of+Higher-Order+Organization+and+Regulation.">In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation.</a> Mol.Cell. 62 (4), 603-617 (2016).</li></ol>

Die Autoren haben keine konkurrierenden finanziellen Interessen.

Hier beschreiben wir im Detail den experimentellen und rechnerischen Workflow für SPLASH, eine Methode, die es uns ermöglicht, paarweise RNA-Interaktionen genomweit zu identifizieren. Wir haben erfolgreich SPLASH in Bakterien-, Hefe- und menschlichen Kulturen eingesetzt und erwarten, dass die Strategie weitgehend auf verschiedene Organismen unter verschiedenen zellulären Zuständen angewendet werden kann. Einer der kritischen Schritte im Protokoll ist, mit mindestens 20 μg vernetzten RNA zu beginnen, um ausreichend Material für nachgeschaltete Prozesse zu haben. Die RNA wird dann auf 100 Basen und PAGE-Größe ausgewählt. Diese Schritte sind für uns wichtig, um bevorzugt für ligierte Chimären anstelle von Monomeren während des Bibliothekserzeugungsprozesses zu bereichern. Normalerweise erholen wir nach der Fragmentierung etwa 1,5 μg RNA und die erste Größenauswahl, und die RNA wird dann nach dem SPLASH-Workflow in eine cDNA-Bibliothek umgewandelt. Wir finden, dass diese Menge an Start-RNA uns erlaubt, genügend Material für h zu erzeugenIgh Durchsatz Sequenzierung mit weniger als 15 Zyklen der PCR-Amplifikation. Da die Anzahl der PCR-Duplizierungsereignisse mit erhöhten PCR-Zyklen dramatisch zunimmt, ist es wichtig, dass die Anzahl der Amplifikationszyklen niedrig ist, um in der nachgeschalteten Analyse nützliche und einzigartige Chimären zu extrahieren. Im Gegensatz zu den anderen genomweiten Psoralen-basierten Strategien nutzt SPLASH eine biotinylierte Version von Psoralen, um basengepaarte RNA-Fragmente miteinander zu vernetzen. Da wir die Vernetzungsmenge auf etwa eine Vernetzung pro hundert und fünfzig Basen titrierten, können wir mit vernetzten RNA-Regionen unter Verwendung von Streptavidinperlen nach RNA-Fragmentierung angereichern. Darüber hinaus ermöglichten wir es, enzymatische Reaktionen durchzuführen, während die RNAs auf Perlen gebunden sind, auch, um Pufferaustausche und Waschungen zweckmäßigerweise durchzuführen. Eine der Einschränkungen der Strategie ist jedoch, dass biotinyliertes Psoralen bei der Durchdringung in Zellen weniger effizient ist als Psoralen oder 4&#39;-AminomethyltriOxsalen (AMT). Als solches ist es entscheidend, sicherzustellen, dass biotinyliertes Psoralen in die Zellen eingetreten ist und die RNAs effizient vernetzt hat. Wir führen routinemäßig Dot-Blots auf vernetzten, extrahierten RNAs zusammen mit biotinylierten Oligos als Positivkontrollen durch, um sicherzustellen, dass unsere RNAs richtig vernetzt sind. Für den Fall, dass die Vernetzung schwach ist, können Strategien zur Durchdringung der Zellmembran, wie z. B. das Hinzufügen geringer Konzentrationen von Digitonin (auf 0,01%) für 5 min, verwendet werden, um zu ermöglichen, dass biotinyliertes Psoralen effizient in die Zellen eintritt. Wenn Psoralen bei der gleichen Wellenlänge wie Nukleinsäuren (UV 260 nm) absorbiert, verwenden wir in der Regel fluorometrische Quantifizierungssysteme anstelle der UV-Absorption zur Quantifizierung von vernetzten RNAs. Eine Einschränkung von Psoralen-basierten Vernetzungsstrategien ist, dass Psoralen bevorzugt bei Uridinen (U) vernetzt. Als solche können Basenpaarungsbereiche, die U schlecht sind, während der Vernetzung verpasst werden. Während des Erkennens eines Vernetzungsereignisses bZwischen zwei Strängen beweisen, dass eine Wechselwirkung auftritt, ein Mangel an Vernetzung nicht gleichbedeutend mit einem Mangel an Interaktion ist. In unserem SPLASH-Protokoll erfassen wir sehr wenig microRNA-mRNA-Wechselwirkungen und geringe Mengen an lncRNA-Wechselwirkungen. Da microRNA-gebundene mRNAs wahrscheinlich in der Genexpression herunterreguliert werden und lncRNAs typischerweise gering ausgedrückt werden, ist ihre schlechte Darstellung in unseren Daten primär auf eine unzureichende Sequenztiefe zurückzuführen. Wir regeln typischerweise mindestens 200 Millionen gepaarte Endlesungen pro menschlicher Transkriptom-Bibliothek für jedes Replikat. In dieser Tiefe fallen die meisten unserer Sequenzierungslücken auf ziemlich reiche RNAs. Wir gehen davon aus, dass die Verwendung von Anreicherungsstrategien für spezifische Populationen von RNAs das Signal für diese relativ niedrigen reichen RNAs stark erhöhen wird. Eine weitere Herausforderung, die wir bei der Analyse chimärer Daten beobachteten, besteht darin, zwischen echten interaktiven chimären Ereignissen und Chimären zu unterscheiden, die aus dem Spleißen entstehen. Zur Vermeidung von Kontaminationen oF Spleißen liest in unserer chimären Liste, wir filtern alle Liest, die in der Nähe von bekannten annotierten Spleißstellen im Transkriptom sind. Wir erwarten, dass mit vollständiger Spleißanmerkungen die endgültige Liste der Chimären noch genauer wird. Anders als bei früheren Strategien, die sich auf RNA-Wechselwirkungen konzentrierten, die für eine einzelne RNA-Spezies oder ein einzelnes RNA-bindendes Protein spezifisch sind, ermöglicht die Fähigkeit von SPLASH, RNA-RNA-Interaktionen in einer genomweiten Weise für alle RNAs abzubilden, große RNA zu untersuchen Interaktionsnetzwerken und zum ersten Mal neue intramolekulare und intermolekulare RNA-Wechselwirkungen zu identifizieren. Mit SPLASH erhielten wir Tausende von intramolekularen und intermolekularen Wechselwirkungen in den menschlichen und Hefe-Transkriptomen, so dass wir in die Organisation und Dynamik des RNA-Interaktoms in vivo einblicken können. Fortschritte bei der Integration dieser Langstrecken-RNA-Interaktionsdaten in RNA-Strukturmodellierungsalgorithmen ist wahrscheinlichVerfeinern unsere aktuellen Modelle der RNA-Organisation in vivo . Die Einbindung von SPLASH in intermolekulare RNA-Vorhersagealgorithmen, wie z. B. snoRNA-Vorhersageprogramme, kann auch die Genauigkeit dieser Vorhersagen verbessern. Wir gehen davon aus, dass die zukünftige Nutzung von SPLASH auf anderen komplexen Organismen und dynamischen Systemen weiterhin die Komplikationen der RNA-basierten Genregulation in der Biologie beleuchten wird.

Das Studium, wie Makromoleküle falten und miteinander interagieren, ist der Schlüssel zum Verständnis der Genregulation in der Zelle. Während in den vergangenen zehn Jahren viel Aufwand fokussiert wurde, um zu verstehen, wie DNA und Proteine ​​zur Genregulation beitragen, ist relativ wenig über die posttranskriptionelle Regulation der Genexpression bekannt. RNA trägt sowohl in ihrer linearen Sequenz als auch in ihrer sekundären und tertiären Struktur 1 Information. Seine Fähigkeit, sich mit sich selbst und mit anderen zu paaren, ist für seine Funktion in vivo wichtig. Jüngste Fortschritte bei der Hochdurchsatz-RNA-Sekundärstruktur-Sondierung lieferten wertvolle Einblicke in die Orte von Doppel- und Einzelstrangbereichen im Transkriptom 2 , 3 , 4 , 5 , 6 , 7 , 8 , HoweDie Information über die Paarungs-Interaktionspartner fehlt noch weitgehend. Um zu bestimmen, welche RNA-Sequenz mit einer anderen RNA-Region im Transkriptom interagiert ist, benötigen wir globale paarweise Informationen. Die Abbildung von Paar-weise RNA-Interaktionen in einer globalen, unvoreingenommenen Weise war traditionell eine große Herausforderung. Während frühere Ansätze, wie CLASH 9 , hiCLIP 10 und RAP 11 , verwendet werden, um RNA-Wechselwirkungen in einer großen Skala zu identifizieren, weisen diese Techniken typischerweise die RNA-Basenpaarung für eine Untergruppe von RNAs auf, die entweder mit einem bestimmten Protein oder einer RNA-Spezies interagieren. Zu den jüngsten Entwicklungen beim Studium globaler RNA-Wechselwirkungen gehören die Methode RPL 12 , die RNA-Wechselwirkungen nicht in vivo stabilisiert und daher nur eine Untermenge von in vivo- Wechselwirkungen erfassen kann. Um diese Herausforderungen zu bewältigen, entwickelten wir und andere genomweite, unvoreingenommene Strategien für maP-RNA-Interactome in vivo unter Verwendung modifizierter Versionen des Vernetzers Psoralen 13 , 14 , 15 . In diesem Protokoll beschreiben wir die Details für die Durchführung von S- Zentren von P- Soralen-vernetzten, l- igierten und S- gewählten H- Ybriden (SPLASH), die biotinylierte Psoralen verwenden, um Basenpaarungs-RNAs in vivo zu vernetzen, gefolgt von einer Näherungsligatur und einer hohen Durchsatzsequenzierung zu Identifizieren RNA-Basenpaarungspartner genomweit ( Abbildung 1 ) 15 . In diesem Manuskript beschreiben wir die Schritte zur Durchführung von SPLASH unter Verwendung von kultivierten adhärenten Zellen, in diesem Fall HeLa-Zellen. Das gleiche Protokoll kann leicht an Suspensions-Säugetierzellen und an Hefe- und Bakterienzellen angepasst werden. Kurz gesagt werden HeLa-Zellen mit biotinyliertem Psoralen behandelt und bei 365 nm bestrahlt, um interagierende RNA-Basenpaare in vivo zu vernetzen. Die RNAs werden dann aus den Zellen extrahiert, zersplittert und angereichert für Vernetzungsregionen unter Verwendung von Streptavidinperlen. Interagierende RNA-Fragmente werden dann unter Verwendung von Proximity-Ligation miteinander ligiert und zu einer cDNA-Bibliothek zur tiefen Sequenzierung gebracht. Nach der Sequenzierung werden die chimären RNAs auf das Transkriptom / Genom abgebildet, um die RNA-interagierenden Regionen zu identifizieren, die miteinander gepaart sind. Wir haben SPLASH erfolgreich genutzt, um Tausende von RNA-Wechselwirkungen in vivo in Hefe und verschiedenen menschlichen Zellen zu identifizieren, einschließlich intramolekularer und intermolekularer RNA-Basenpaarung in verschiedenen Klassen von RNAs wie SnoRNAs, lncRNAs und mRNAs, um in die Strukturorganisation und Interaktionsmuster einzutauchen Von RNAs in der Zelle.

<table border="0" cellpadding="0" cellspacing="0" width="1136">
	<colgroup>
		<col />
		<col span="3" />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:284px;">1 Kb Plus DNA Ladder</td>
			<td style="width:284px;">Life Technologies Holdings Pte Ltd</td>
			<td style="width:284px;">10787026</td>
			<td style="width:284px;">DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 bp DNA ladder</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10821-015</td>
			<td>DNA ladder</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20 % SDS solution</td>
			<td>First BASE</td>
			<td>BUF-2052-1L&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20x SSC</td>
			<td>First BASE</td>
			<td>BUF-3050-20X1L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3.0 M Sodium Acetate Solution</td>
			<td>First BASE</td>
			<td>BUF-1151-1L-pH5.2&#160;&#160;</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40% Acrylamide/Bis Solution, 19:1</td>
			<td>Bio-Rad</td>
			<td>1610145</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ambion Buffer Kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM9010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium Persulfate, Molecular Grade&#160;&#160;</td>
			<td>Promega</td>
			<td>V3131&#160;</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bromophenol Blue</td>
			<td>Sigma-Aldrich</td>
			<td>B0126-25G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Merck</td>
			<td>1.02445.1000</td>
			<td>RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Single strand DNA ligase</td>
			<td>Epicentre</td>
			<td>CL9025K</td>
			<td>CircLigase II ssDNA Ligase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge tube filters</td>
			<td>Sigma-Aldrich</td>
			<td>CLS8160-96EA</td>
			<td>Costar Spin-X centrifuge tube filters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D5628-1G DIGITONIN CRYSTALLINE</td>
			<td>Sigma-Aldrich</td>
			<td>D5628-1G</td>
			<td>For cell treatment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dark Reader Transilluminator&#160;</td>
			<td>Clare Chemical Research</td>
			<td>Dark Reader DR89X Transilluminator</td>
			<td>Blue light transilluminator</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Loading Dye (6X)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>R0611</td>
			<td>Required for agarose gel electroporation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Pan BioTech</td>
			<td>P04-03500</td>
			<td>For Hela cell culture</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin magnetic beads</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>65002</td>
			<td>Dynabeads MyOne Streptavidin C1&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>12301D</td>
			<td>DynaMag-15</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand for 15ml tubes</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>&#160;12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ThermoMixer</td>
			<td>Eppendorf</td>
			<td>5382 000.015</td>
			<td>Eppendorf ThermoMixer&#160;C</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotinylated psoralen</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>29986</td>
			<td>EZ-Link Psoralen-PEG3-Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">F8T5/BL&#160;</td>
			<td>Hitachi</td>
			<td>F8T5/BL&#160;</td>
			<td>365 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fetal Bovine Serum</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10270106&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Formamide</td>
			<td>Promega</td>
			<td>H5052&#160;&#160;</td>
			<td>Component in hybridization buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">G8T5</td>
			<td>Sankyo-Denki</td>
			<td>G8T5</td>
			<td>254 nm UV bulb</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>10814010</td>
			<td>Required for nucleic acid precipitation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Nanodrop 2000</td>
			<td>Spectrophotometer for nucleic acidquantification</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nuclease free water&#160;</td>
			<td>First BASE</td>
			<td>BUF-1180-500ml&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin Streptomycin&#160;&#160;</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15140122&#160;&#160;</td>
			<td>Components of Hela medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-Fidelity DNA polymerase (2x)</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>F531L&#160;</td>
			<td>Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers Set 1</td>
			<td>New England Biolabs</td>
			<td>E7335L&#160;</td>
			<td>PCR primers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Gel Extraction Kit</td>
			<td>QIAgen</td>
			<td>28106</td>
			<td>QIAquick Gel Extraction Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorometric Quantification kit</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>Q32854</td>
			<td>Qubit dsDNA HS Assay Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA clean up kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td>RNeasy Mini Kit Silica-membrane column</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Rnase Inhibitor</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>AM2696</td>
			<td>SUPERase In</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Reverse transcriptase</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>18080400</td>
			<td>SuperScript III First-Strand Synthesis SuperMix</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nucleic Acid Gel Stain</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>S11494</td>
			<td>SYBR GOLD NUCLEIC ACID 500 UL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201L</td>
			<td>End repair enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 1</td>
			<td>New England Biolabs</td>
			<td>M0204L</td>
			<td>Enzyme for proximity ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">T4 RNA Ligase 2, truncated KQ</td>
			<td>New England Biolabs</td>
			<td>M0373L</td>
			<td>Enzyme for adaptor ligation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Temed</td>
			<td>Bio-Rad</td>
			<td>1610801</td>
			<td>TBE Urea gel component</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol-chloroform</td>
			<td>Life Technologies Holdings Pte Ltd</td>
			<td>15596018</td>
			<td>TRIzol&#174; Reagent for RNA extraction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Urea</td>
			<td>First BASE</td>
			<td>BIO-2070-5kg&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV crosslinker</td>
			<td>Stratagene</td>
			<td>400072</td>
			<td>UV Stratalinker 1800</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UV Transilluminator</td>
			<td>UVP</td>
			<td>95-0417-01</td>
			<td>For visualizing of bands</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Xylene Cyanol FF</td>
			<td>Sigma-Aldrich</td>
			<td>X4126-10G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA cleanup it</td>
			<td>Zymo Research&#160;</td>
			<td>D4004</td>
			<td>Zymo DNA concentrator-5&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">List of software required</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastQC software</td>
			<td>0.11.4</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqPrep software</td>
			<td>1.0.7</td>
			<td>https://github.com/jstjohn/SeqPrep</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BWA software</td>
			<td>0.7.12</td>
			<td>http://bio-bwa.sourceforge.net/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SAMTOOLS software</td>
			<td>1.2.1</td>
			<td>http://www.htslib.org/</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PULLSEQ software</td>
			<td>1.0.2</td>
			<td>https://github.com/bcthomas/pullseq</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">STAR software</td>
			<td>2.5.0c</td>
			<td>https://github.com/alexdobin/STAR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rem_dups.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">find_chimeras.py PYTHON script</td>
			<td>PYTHON 2.7.11</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pickJunctionReads.awk AWK script</td>
			<td>AWK GNU 4.1.2</td>
			<td>https://github.com/CSB5/splash/tree/master/src</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Buffer composition</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Elution buffer:&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.3 M sodium acetate</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lysis Buffer:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use except when washing beads</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Buffer&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10 mM TrisCl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hybridization Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">750 mM NaCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50 mM Tris-Cl pH 7.0</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM EDTA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% formamide (store in the dark at 4 &#176;C)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Always add Superase-in fresh before use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x SSC Wash Buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2X RNA fragmentation buffer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">18mM MgCl2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">450mM KCl</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">300mM Tris-CL pH 8.3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2x RNA loading Dye:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">95% Formamide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% SDS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.02% bromophenol blue</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.01% Xylene Cyanol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1mM EDTA&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3&#39; RNA adapter sequence</td>
			<td>5rAppCTGTAGGCACCATCAAT/3ddC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT primer sequence</td>
			<td>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

mapping rna-rna interactions globally using biotinylated psoralen

Zu wissen, wie RNAs mit sich selbst und mit anderen interagieren, ist der Schlüssel zum Verständnis der RNA-basierten Genregulation in der Zelle. Während Beispiele für RNA-RNA-Wechselwirkungen wie microRNA-mRNA-Wechselwirkungen gezeigt wurden, um die Genexpression zu regulieren, ist das volle Ausmaß, in dem RNA-Wechselwirkungen in der Zelle auftreten, noch unbekannt. Bisherige Methoden zur Untersuchung von RNA-Wechselwirkungen haben sich primär auf Teilmengen von RNAs konzentriert, die mit einem bestimmten Protein oder einer RNA-Spezies interagieren. Hier beschreiben wir eine Methode namens S equencing von P soralen vernetzt, L igated und S gewählt H ybrids (SPLASH), die genomweites Erfassen von RNA-Wechselwirkungen in vivo in einer unvoreingenommenen Weise ermöglicht. SPLASH nutzt in vivo- Vernetzung, Proximity-Ligation und High-Throughput-Sequenzierung, um intramolekulare und intermolekulare RNA-Basenpaarungspartner weltweit zu identifizieren. SPLASH kann auf verschiedene Organismen angewendet werden, einschließlich Bakterien, Hefe und menschliche Zellen, sowie aS vielfältige zelluläre Bedingungen, um das Verständnis der Dynamik der RNA-Organisation unter verschiedenen zellulären Kontexten zu erleichtern. Das gesamte experimentelle SPLASH-Protokoll dauert ca. 5 Tage und der rechnerische Workflow dauert ca. 7 Tage.

Abbildung 1 zeigt den Schema des SPLASH-Workflows. Bei der Zugabe von biotinyliertem Psoralen in Gegenwart von 0,01% Digitonin und UV-Vernetzung wird die Gesamt-RNA aus den Zellen extrahiert und ein Punkt-Blot wird durchgeführt, um sicherzustellen, dass die Vernetzung von biotinyliertem zu der RNA effizient erfolgt ist (Abbildung 2 ). Wir verwenden biotinylierte 20-Basen-Oligos als positive Kontrollen, um die Menge an biotinyliertem Psoralen zu titrieren, um den Zellen zugesetzt zu werden, so dass etwa 1 in jeder 150 Basen vernetzt sind. Da mehr PCR-Duplikationsereignisse mit erhöhten PCR-Amplifikationszyklen auftreten, führen wir eine kleine PCR-Amplifikation unter Verwendung verschiedener PCR-Zyklen durch, um die niedrigste Anzahl von Amplifikationszyklen zu bestimmen, die genügend Material für eine tiefe Sequenzierung bereitstellen. In einem effizienten Bibliotheksvorbereitungsprozess sind wirIn der Lage, eine cDNA-Sequenzierungsbibliothek aus einer 1,5 μg Größe ausgewählten RNA-Input in weniger als 15 Zyklen der PCR-Amplifikation zu amplifizieren (Abbildung 3 ). Die Bibliothek wird dann unter Verwendung von 2 × 150 Basenpaar-Lesevorgängen auf einer Sequenziermaschine mit hohem Durchsatz sequenziert, und die Sequenzierungs-Lesevorgänge werden dann gemäß der Berechnungs-Pipeline in 4 verarbeitet. Das Endergebnis ist eine Liste von gefilterten chimären Wechselwirkungen, die sowohl intramolekulare als auch intermolekulare RNA-RNA-Wechselwirkungen im Transkriptom enthalten ( Tabelle 11 ). <img alt="Abbildung 1" class="xfigimg" src="/files/ftp_upload/55255/55255fig1.jpg" /> Abbildung 1 : Schematische Darstellung des experimentellen Arbeitsablaufs von SPLASH 15 . Pair-weise RNA-Wechselwirkungen innerhalb der Zelle werden unter Verwendung von biotinyliertem Psoralen unter UV-Licht bei 365 nm vernetzt. Vernetzte RNA ist thEn extrahiert und auf etwa 100 Basen zersplittert. Interaktionsregionen, die die biotinylierten Psoralen-Vernetzungen enthalten, werden durch Bindung an Streptavidin-Kügelchen angereichert und miteinander ligiert. Bei umgekehrter Vernetzung unter UV-Licht bei 265 nm werden die chimären RNAs dann in eine cDNA-Bibliothek zur tiefen Sequenzierung kloniert. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55255/55255fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" class="xfigimg" src="/files/ftp_upload/55255/55255fig2.jpg" /> Abbildung 2 : Prüfung der biotinylierten Vernetzungswirksamkeit durch Punktblotting 15 . Dot-Blot von biotinylierter Psoralen-vernetzten RNA in vivo in Gegenwart von 1% Digitonin. Verschiedene Konzentrationen von vernetzten RNA (20-2.000 ng) werden auf der Membran entdeckt. Verschiedene Konzentrationen der biotinylierten 20 BaseOligo werden als Positivkontrolle entdeckt. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55255/55255fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 3" class="xfigimg" src="/files/ftp_upload/55255/55255fig3.jpg" /> Abbildung 3: Kleinskalen-Bibliotheksverstärkung für SPLASH. 1 &amp; mgr; l cDNA aus der RT-Reaktion wird für die PCR mit kleinem Maßstab verwendet. Die Reaktionen werden bei 10, 15 und 20 Zyklen herausgenommen und laufen auf einem 3% Agarosegel, um die minimale Anzahl von Amplifikationszyklen zu bestimmen, die für die Bibliothekserzeugung erforderlich sind. In diesem speziellen Beispiel erzeugen 10 Zyklen der Amplifikation unter Verwendung von 10 &amp; mgr; l cDNA in einer PCR-Reaktion in großem Maßstab genügend Amplifikate für eine tiefe Sequenzierung. <img alt="Abbildung 4" class="xfigimg" src="/files/ftp_upload/55255/55255fig4.jpg" /> <strongClass = &quot;xfig&quot;&gt; Abbildung 4: Schema des rechnerischen Arbeitsablaufs von SPLASH. Sequenzierungs-Lesevorgänge von der Hochdurchsatz-Sequenzierung werden dem Transkriptom zugeordnet und gefiltert gegen schlechte Qualität liest, PCR-Duplikate, Duplikat-Mapping und Splicing-Junction-Lesungen mit der Analyse-Pipeline. Die endgültige Ausgabe ist eine Liste von Chimären, die sowohl intra- als auch intermolekulare Wechselwirkungen im Transkriptom repräsentieren. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55255/55255fig4large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <table fo:keep-together.within-page="1"><tbody><tr><td> Reagenzien </td><td> Volumen (μL) </td><td> Finale </td></tr><tr><td> Nuklease freies Wasser </td><td> 64 </td><td></td></tr><tr><td> 10x T4 PNK Puffer </td><td> 8 </td><td> 1x </td></tr><tr><td> Rnase-Inhibitor (20 U / &amp; mgr; l) </td><td> 4 </td><td> 1 U / &amp; mgr; l </td></tr><tr><td> T4 PNK (10 U / &amp; mgr; l) </td><td> 4 </td><td> 0,5 U / &amp; mgr; l </td></tr><tr><td> Gesamt </td><td> 80 </td><td></td></tr></tbody></table> Tabelle 1: Reagenzien für 3 &#39;Endreparaturen <table fo:keep-together.within-page="1"><tbody><tr><td> Reagenzien </td><td> Volumen (μL) </td><td> Finale </td></tr><tr><td> PNK-Reaktion </td><td> 80 </td><td></td></tr><tr><td> Nuklease freies Wasser </td><td> 3 </td><td></td></tr><tr><td> 10x T4 PNK Puffer </td><td> 2 </td><td> 1x </td></tr><tr><td> 10 mM ATP </td><td> 10 </td><td> 1 mM </td></tr><tr><td> T4 PNK (10 U / &amp; mgr; l) </stronG&gt; </td><td> 5 </td><td> 0,5 U / &amp; mgr; l </td></tr><tr><td> Gesamt </td><td> 100 </td><td></td></tr></tbody></table> Tabelle 2: Reagenzien für 5 &#39;Ende Reparatur. <table fo:keep-together.within-page="1"><tbody><tr><td> Reagenzien </td><td> Volumen (μL) </td><td> Finale </td></tr><tr><td> PNK-Reaktion </td><td> 100 </td><td></td></tr><tr><td> 10x T4 RNA-Ligasepuffer </td><td> 6 </td><td> 1x </td></tr><tr><td> 10 mM ATP </td><td> 6 </td><td> 1 mM </td></tr><tr><td> Rnase-Inhibitor (20 U / μL) </td><td> 4 </td><td> 0,5 U / &amp; mgr; l </td></tr><tr><td> T4 Rnl1 (10 U / &amp; mgr; l) </td><td> 40 </td><td> 2,5 U / &amp; mgr; l </td></tr><tr><td> Nuclease freE Wasser </td><td> 4 </td><td></td></tr><tr><td> Gesamt </td><td> 160 </td><td></td></tr></tbody></table> Tabelle 3: Reagenzien zur Näherungsligatur. <table fo:keep-together.within-page="1"><tbody><tr><td> Komponente </td><td> Menge pro Reaktion (μL) </td><td> Finale </td></tr><tr><td> RNA und Linker </td><td> 5 </td><td></td></tr><tr><td> T4 Rnl2 Puffer (10x) </td><td> 1 </td><td> 1x </td></tr><tr><td> PEG 8000 (50%, wt / vol) </td><td> 3 </td><td> 15% (wt / vol) </td></tr><tr><td> Rnase-Inhibitor (20 U / μL) </td><td> 0,5 </td><td> 1 U / &amp; mgr; l </td></tr><tr><td> T &amp; sub4; Rnl &amp; sub2; (tr) (200U / &amp; mgr; l) </td><td> 0,5 </td><td> 10 U / &amp; mgr;L; </td></tr><tr><td> Gesamt </td><td> 10 </td><td></td></tr></tbody></table> Tabelle 4: Reagenzien für die Adapterligatur. <table fo:keep-together.within-page="1"><tbody><tr><td> Komponente </td><td> Menge pro Reaktion (μL) </td><td> Finale </td></tr><tr><td> Ligation und Grundierung </td><td> 6 </td><td></td></tr><tr><td> First-Strang-Puffer (5x) </td><td> 2 </td><td> 1x </td></tr><tr><td> DNTPs (10 mM) </td><td> 0,5 </td><td> 0,5 mM </td></tr><tr><td> DTT (0,1 M) </td><td> 0,5 </td><td> 5 mM </td></tr><tr><td> Rnase-Inhibitor (20 U / μL) </td><td> 0,5 </td><td> 1 U / &amp; mgr; l </td></tr><tr><td> Reverse Transkriptase (200 U / μL) </sTrong&gt; </td><td> 0,5 </td><td> 10 U / &amp; mgr; l </td></tr><tr><td> Gesamt </td><td> 10 </td><td></td></tr></tbody></table> Tabelle 5: Reagenzien für reverse Transkription. <table fo:keep-together.within-page="1"><tbody><tr><td> Komponente </td><td> Menge pro Reaktion (μL) </td><td> Finale </td></tr><tr><td> First-Strang-cDNA </td><td> 6 </td><td></td></tr><tr><td> Einzelstrang-DNA-Ligasepuffer (10x) </td><td> 1 </td><td> 1x </td></tr><tr><td> Betaine (5 M) </td><td> 2 </td><td> 1 M </td></tr><tr><td> MnCl &amp; sub2 ; (50 mM) </td><td> 0,5 </td><td> 2,5 mM </td></tr><tr><td> Einzelstrang-DNA-Ligase (100U / μL) </td><td> 0,5 </td><td> 5U / &amp; mgr; l </td></tr><tr><td> Gesamt </td><td> 10 </td><td></td></tr></tbody></table> Tabelle 6: Reagenzien zur Zirkularisierung von cDNA. <table fo:keep-together.within-page="1"><tbody><tr><td> Komponente </td><td> Menge pro Reaktion (μL) </td><td> Finale </td></tr><tr><td> Ligiertes DNA-Produkt </td><td> 1 </td><td></td></tr><tr><td> Nuklease freies Wasser </td><td> 10.5 </td><td></td></tr><tr><td> High-Fidelity DNA-Polymerase 2x Master-Mix </td><td> 12.5 </td><td> 1x </td></tr><tr><td> Universal PCR Primer (10 μM) </td><td> 0,5 </td><td> 0,02 &amp; mgr; M </td></tr><tr><td> Index (X) Primer (10 μM) </td><td> 0,5 </td><td> 0,02 &amp; mgr; M </tD&gt; </tr><tr><td> Gesamt </td><td> 25 </td><td></td></tr></tbody></table> Tabelle 7: Reagenzien für kleine PCR verwendet. <table fo:keep-together.within-page="1"><tbody><tr><td> Schritt </td><td> Temperatur </td><td> Zeit </td><td> Fahrräder </td></tr><tr><td> Anfängliche Denaturierung </td><td> 98 ° C </td><td> 30 s </td><td> 1 </td></tr><tr><td> Denaturierung </td><td> 98 ° C </td><td> 10 s </td><td></td></tr><tr><td> Glühende </td><td> 65 ° C </td><td> 30 s </td><td> 25 </td></tr><tr><td> Erweiterung </td><td> 72 ° C </td><td> 30 s </td><td></td></tr><tr><td> Endgültige Erweiterung </td><td> 72 ° C </td><td> 5 Minuten </td><tD&gt; 1 </td></tr><tr><td> Halt </td><td> 4 ° C </td><td> ∞ </td><td></td></tr></tbody></table> Tabelle 8: Bedingungen für die PCR mit kleinem Maßstab. <table fo:keep-together.within-page="1"><tbody><tr><td> Komponente </td><td> Menge pro Reaktion (μL) </td><td> Finale </td></tr><tr><td> Ligiertes DNA-Produkt </td><td> 5 </td><td></td></tr><tr><td> Nuklease freies Wasser </td><td> 6.5 </td><td></td></tr><tr><td> High-Fidelity DNA-Polymerase 2x Master-Mix </td><td> 12.5 </td><td> 1x </td></tr><tr><td> Universal PCR Primer (10 μM) </td><td> 0,5 </td><td> 0,02 &amp; mgr; M </td></tr><tr><td> Index (X) Primer (10 μM) </td><td> 0,5 </td><td> 0,02 &amp; mgr; M </tD&gt; </tr><tr><td> Gesamt </td><td> 25 </td><td></td></tr></tbody></table> Tabelle 9: Reagenzien, die für PCR mit großem Maßstab verwendet werden. <table fo:keep-together.within-page="1"><tbody><tr><td> Schritt </td><td> Temperatur </td><td> Zeit </td><td> Fahrräder </td></tr><tr><td> Anfängliche Denaturierung </td><td> 98 ° C </td><td> 30 s </td><td> 1 </td></tr><tr><td> Denaturierung </td><td> 98 ° C </td><td> 10 s </td><td></td></tr><tr><td> Glühende </td><td> 65 ° C </td><td> 30 s </td><td> Y </td></tr><tr><td> Erweiterung </td><td> 72 ° C </td><td> 30 s </td><td></td></tr><tr><td> Endgültige Erweiterung </td><td> 72 ° C </td><td> 5 Minuten </td><td&gt; 1 </td></tr><tr><td> Halt </td><td> 4 ° C </td><td> ∞ </td><td></td></tr></tbody></table> Tabelle 10: Bedingungen für die PCR mit großem Maßstab. <img alt="Tabelle 11" src="/files/ftp_upload/55255/55255tbl11.jpg" /> Tabelle 11: Analyse der rechnerischen Pipeline. &quot;SAM-Flag-Split lesen 1&quot; = 0 zeigt an, dass das Lesen dem positiven Strang des Transkriptoms zugeordnet ist. &quot;RNA 1 Identität&quot; bezieht sich auf die Identität der RNA der linken Seite der Chimäre. &quot;RNA 1 Startposition&quot; bezieht sich auf die Startposition, auf die das Lesen entlang der RNA 1 abgebildet wird. &quot;RNA 1 Endposition&quot; bezieht sich auf die Endposition, auf die das Lesen entlang der RNA 1 abgebildet wird. &quot;Mapping score split read 1&quot; bezieht sich auf Zu der Mapping-Punktzahl des gelesenen, der auf RNA 1 abgebildet wurde. &quot;Zigarrensplit lesen 1&quot;Gibt die Anzahl der Basen an, die aus dem gelesenen &quot;S&quot; und der Anzahl der Basen, die dem gelesenen &quot;M&quot; zugeordnet wurden, abgeschnitten wurden. &quot;Split read 1&quot; gibt die Sequenz an, die auf RNA 1 abgebildet wurde. Die gleiche Nomenklatur wurde für die rechte Seite der Chimäre verwendet, die als RNA 2 bezeichnet wird. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55255/55255tbl11large.jpg" target="_blank">Klicken Sie hier, um eine größere Version dieser Tabelle</a> anzuzeigen <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55255/55255tbl11large.jpg" target="_blank">.</a>

Watch this Scientific Journal Video about Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen at JoVE.com

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Hier beschreiben wir die Methode des S- Zensierens von P- Soralen-vernetzten, l- igierten und S- gewählten H- Ybriden (SPLASH), die eine genomweite Abbildung von intramolekularen und intermolekularen RNA-RNA-Wechselwirkungen in vivo ermöglichen. SPLASH kann angewendet werden, um RNA-Interaktome von Organismen einschließlich Hefe, Bakterien und Menschen zu untersuchen.

Zuordnung von RNA-RNA-Wechselwirkungen unter Verwendung von biotinyliertem Psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

mapping-rna-rna-interactions-globally-using-biotinylated-psoralen

Nanyang Technological University

Research

JoVE Journal

Genetics

11.9K Aufrufe.  A*STAR.  Hier beschreiben wir die Methode des S- Zensierens von P- Soralen-vernetzten, l- igierten und S- gewählten H- Ybriden (SPLASH), die eine genomweite Abbildung von intramolekularen und intermolekularen RNA-RNA-Wechselwirkungen in vivo ermöglichen. SPLASH kann angewendet werden, um RNA-Interaktome von Organismen einschließlich Hefe, Bakterien und Menschen zu untersuchen. 

Serie: Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

Konjugative Mating Assays für sequenzspezifische Analyse der Übertragung beteiligten Proteine ​​in bakteriellen Konjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

Forschung

Genetik

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

QTL Mapping und CRISPR / Cas9 Bearbeitung zur Identifizierung eines Drug Resistance Gen in<em&gt; Toxoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Single Molecule Analysis of Laser Localized Psoralen Adducts

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live cells. The DDR to helix distorting covalent DNA modifications, including interstrand DNA crosslinks (ICLs), is not as well defined. We have studied the DDR stimulated by ICLs, localized by laser photoactivation of immunotagged psoralens, in the nuclei of live cells. In order to address fundamental questions about adduct distribution and replication fork encounters, we combined laser localization with two other technologies. DNA fibers are often used to display the progress of replication forks by immunofluorescence of nucleoside analogues incorporated during short pulses. Immunoquantum dots have been widely employed for single molecule imaging. In the new approach, DNA fibers from cells carrying laser localized ICLs are spread onto microscope slides. The tagged ICLs are displayed with immunoquantum dots and the inter-lesion distances determined. Replication fork collisions with ICLs can be visualized and different encounter patterns identified and quantitated.

Lasers are frequently used in studies of the cellular response to DNA damage. However, they generate lesions whose spacing, frequency, and collisions with replication forks are rarely characterized. Here, we describe an approach that enables the determination of these parameters with laser localized interstrand crosslinks.

Einzelmolekülanalyse von Laser Lokalisierte Psoralen Addukten

The DNA Damage Response (DDR) has been extensively characterized in studies of double strand breaks (DSBs) induced by laser micro beam irradiation in live ...

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident processes. Formaldehyde crosslinking followed by chromatin immunoprecipitation and high-throughput sequencing (X-ChIP-seq) has been used to gain many valuable insights into genome biology. However, X-ChIP-seq has notable limitations linked to crosslinking and sonication. Native ChIP avoids these drawbacks by omitting crosslinking, but often results in poor recovery of chromatin-bound proteins. In addition, all ChIP-based methods are subject to antibody quality considerations. Enzymatic methods for mapping protein-DNA interactions, which involve fusion of a protein of interest to a DNA-modifying enzyme, have also been used to map protein-DNA interactions. We recently combined one such method, chromatin endogenous cleavage (ChEC), with high-throughput sequencing as ChEC-seq. ChEC-seq relies on fusion of a chromatin-associated protein of interest to micrococcal nuclease (MNase) to generate targeted DNA cleavage in the presence of calcium in living cells. ChEC-seq is not based on immunoprecipitation and so circumvents potential concerns with crosslinking, sonication, chromatin solubilization, and antibody quality while providing high resolution mapping with minimal background signal. We envision that ChEC-seq will be a powerful counterpart to ChIP, providing an independent means by which to both validate ChIP-seq findings and discover new insights into genomic regulation.

Genome-wide Mapping of Protein-DNA Interactions with ChEC-seq in Saccharomyces cerevisiae

We describe chromatin endogenous cleavage coupled with high-throughput sequencing (ChEC-seq), a chromatin immunoprecipitation (ChIP)-orthogonal method for mapping protein binding sites genome-wide with micrococcal nuclease (MNase) fusion proteins.

Genom-weite Abbildung von Protein-DNA-Wechselwirkungen mit ChEC-seq in<em&gt; Saccharomyces cerevisiae</em

Genome-wide mapping of protein-DNA interactions is critical for understanding gene regulation, chromatin remodeling, and other chromatin-resident ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Retroviral Scanning: Mapping MLV Integration Sites zur Definition zellspezifischer Regulierungsregionen

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions of chromatin. These regions represent regulatory DNA elements (e.g., promoters, enhancers, locus control regions, insulators) to which transcription factors bind. Mapping the accessible chromatin landscape is a powerful approach for uncovering active regulatory elements across the genome. This information serves as an unbiased approach for discovering the network of relevant transcription factors and mechanisms of chromatin structure that govern gene expression programs. ATAC-seq is a robust and sensitive alternative to DNase I hypersensitivity analysis coupled with next-generation sequencing (DNase-seq) and formaldehyde-assisted isolation of regulatory elements (FAIRE-seq) for genome-wide analysis of chromatin accessibility and to the sequencing of micrococcal nuclease-sensitive sites (MNase-seq) to determine nucleosome positioning. We present a detailed ATAC-seq protocol optimized for human primary immune cells i.e. CD4+ lymphocytes (T helper 1 (Th1) and Th2 cells). This comprehensive protocol begins with cell harvest, then describes the molecular procedure of chromatin tagmentation, sample preparation for next-generation sequencing, and also includes methods and considerations for the computational analyses used to interpret the results. Moreover, to save time and money, we introduced quality control measures to assess the ATAC-seq library prior to sequencing. Importantly, the principles presented in this protocol allow its adaptation to other human immune and non-immune primary cells and cell lines. These guidelines will also be useful for laboratories which are not proficient with next-generation sequencing methods.

Assay for Transposase-Accessible Chromatin coupled with high-throughput sequencing (ATAC-seq) is a genome-wide method to uncover accessible chromatin. This is a step-by-step ATAC-seq protocol, from molecular to the final computational analysis, optimized for human lymphocytes (Th1/Th2). This protocol can be adopted by researchers without prior experience in next-generation sequencing methods.

Mapping genomweite zugänglich Chromatin in primären menschlichen T-Lymphozyten durch ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the spatio-temporal expression of their target genes through physical contact, often bridging considerable (in some cases hundreds of kilobases) genomic distances and bypassing nearby genes. The human genome harbors an estimated one million enhancers, the vast majority of which have unknown gene targets. Assigning distal regulatory regions to their target genes is thus crucial to understand gene expression control. We developed Promoter Capture Hi-C (PCHi-C) to enable the genome-wide detection of distal promoter-interacting regions (PIRs), for all promoters in a single experiment. In PCHi-C, highly complex Hi-C libraries are specifically enriched for promoter sequences through in-solution hybrid selection with thousands of biotinylated RNA baits complementary to the ends of all promoter-containing restriction fragments. The aim is to then pull-down promoter sequences and their frequent interaction partners such as enhancers and other potential regulatory elements. After high-throughput paired-end sequencing, a statistical test is applied to each promoter-ligated restriction fragment to identify significant PIRs at the restriction fragment level. We have used PCHi-C to generate an atlas of long-range promoter interactions in dozens of human and mouse cell types. These promoter interactome maps have contributed to a greater understanding of mammalian gene expression control by assigning putative regulatory regions to their target genes and revealing preferential spatial promoter-promoter interaction networks. This information also has high relevance to understanding human genetic disease and the identification of potential disease genes, by linking non-coding disease-associated sequence variants in or near control sequences to their target genes.

DNA regulatory elements, such as enhancers, control gene expression by physically contacting target gene promoters, often through long-range chromosomal interactions spanning large genomic distances. Promoter Capture Hi-C (PCHi-C) identifies significant interactions between promoters and distal regions, enabling the assignment of potential regulatory sequences to their target genes.

Promotor Capture Hallo-c: Hochauflösende, genomweite Profilierung der Promoter Interaktionen

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly being extended to integrative studies to enhance the understanding of molecular dynamics within cells. Current tools for the visualization and integration of proteomics with other omics datasets are inadequate for large-scale studies. Furthermore, they only capture basic sequence identify, discarding post-translational modifications and quantitation. To address these issues, we developed PoGo to map peptides with associated post-translational modifications and quantification to reference genome annotation. In addition, the tool was developed to enable the mapping of peptides identified from customized sequence databases incorporating single amino acid variants. While PoGo is a command line tool, the graphical interface PoGoGUI enables non-bioinformatics researchers to easily map peptides to 25 species supported by Ensembl genome annotation. The generated output borrows file formats from the genomics field and, therefore, visualization is supported in most genome browsers. For large-scale studies, PoGo is supported by TrackHubGenerator to create web-accessible repositories of data mapped to genomes that also enable an easy sharing of proteogenomics data. With little effort, this tool can map millions of peptides to reference genomes within only a few minutes, outperforming other available sequence-identity based tools. This protocol demonstrates the best approaches for proteogenomics mapping through PoGo with publicly available datasets of quantitative and phosphoproteomics, as well as large-scale studies.

Here we present the proteogenomic tool PoGo and protocols for fast, quantitative, post-translational modification and variant enabled mapping of peptides identified through mass spectrometry onto reference genomes. This tool is of use to integrate and visualize proteogenomic and personal proteomic studies interfacing with orthogonal genomics data.

Eine schnelle und Quantitative Methode für Post-translationale Modifikation und Variante aktiviert Mapping von Peptiden mit Genomen

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

Transcription Start Site Mapping Using Super-low Input Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). Accurate detection of TSSs enhances identification and discovery of core promoters. In addition, active enhancers can be detected through signatures of bidirectional transcription initiation. Described here is a protocol for performing super-low input carrier-CAGE (SLIC-CAGE). This SLIC adaptation of the CAGE protocol minimizes RNA losses by artificially increasing the RNA amount through use of an in vitro transcribed RNA carrier mix that is added to the sample of interest, thus enabling library preparation from nanogram-amounts of total RNA (i.e., thousands of cells). The carrier mimics the expected DNA library fragment length distribution, thereby eliminating biases that could be caused by the abundance of a homogenous carrier. In the last stages of the protocol, the carrier is removed through degradation with homing endonucleases and the target library is amplified. The target sample library is protected from degradation, as the homing endonuclease recognition sites are long (between 18 and 27 bp), making the probability of their existence in the eukaryotic genomes very low. The end result is a DNA library ready for next-generation sequencing. All steps in the protocol, up to sequencing, can be completed within 6 days. The carrier preparation requires a full working day; however, it can be prepared in large quantities and kept frozen at -80 &#176;C. Once sequenced, the reads can be processed to obtain genome-wide single-nucleotide resolution TSSs. TSSs can be used for core promoter or enhancer discovery, providing insight into gene regulation. Once aggregated to promoters, the data can also be used for 5&#8217;-centric expression profiling.

Cap Analysis of Gene Expression (CAGE) is a method for genome-wide quantitative mapping of mRNA 5&#8217;ends to capture RNA polymerase II transcription start sites at a single-nucleotide resolution. This work describes a low-input (SLIC-CAGE) protocol for generation of high-quality libraries using nanogram-amounts of total RNA.

Transkription Start Site Mapping mit Super-low Input Carrier-CAGE

Cap analysis of gene expression (CAGE) is a method used for single-nucleotide resolution detection of RNA polymerase II transcription start sites (TSSs). ...

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

In Vitro biochemische Assays mit Biotin-Etiketten zur Untersuchung von Protein-Nukleinsäure-Wechselwirkungen

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...