We are grateful to all staff members of the Oral and Maxillofacial Surgery (MKA) of UZ Leuven, as well as the patients, for their invaluable help in collecting freshly extracted third molars. We would also like to thank Dr. Reinhilde Jacobs and Dr. Elisabeth Tijskens for their help with the sample collection. This work was supported by grants from KU Leuven (BOF) and FWO-Flanders (G061819N). L.H. is an FWO Ph.D. Fellow (1S84718N).

<ol>
	<li>Yu, T., Klein, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+and+cellular+mechanisms+of+tooth+development,+homeostasis+and+repair.">Molecular and cellular mechanisms of tooth development, homeostasis and repair.</a> Development (Cambridge). 147 (2), (2020).</li><li>Arrow, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+enamel+defects,+caries+experience+and+oral+health-related+quality+of+life:+a+cohort+study.">Dental enamel defects, caries experience and oral health-related quality of life: a cohort study.</a> Australian Dental Journal. 62 (2), 165-172 (2017).</li><li>Mitsiadis, T. A., Orsini, G., Jimenez-Rojo, L., Zavan, B., Bressan, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+Stem+Cells+for+Tooth+Regeneration.">Dental Stem Cells for Tooth Regeneration.</a> Dental Stem Cells: Regenerative Potential. Stem Cell Biology and Regenerative Potential. Stem Cell Biology and Regenerative Medicine. , (2016).</li><li>Mitsiadis, T. A., Orsini, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editorial:+a+new+era+in+dentistry:+stem+cell-based+approaches+for+tooth+and+periodontal+tissue+regeneration.">Editorial: a new era in dentistry: stem cell-based approaches for tooth and periodontal tissue regeneration.</a> Frontiers in Physiology. 7, 357 (2016).</li><li>Miran, S., Mitsiadis, T. A., Pagella, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innovative+dental+stem+cell-based+research+approaches:+the+future+of+dentistry.">Innovative dental stem cell-based research approaches: the future of dentistry.</a> Stem Cells International. 2016, 7231038 (2016).</li><li>Shinmura, Y., Tsuchiya, S., Hata, K. I., Honda, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quiescent+epithelial+cell+rests+of+malassez+can+differentiate+into+ameloblast-like+cells.">Quiescent epithelial cell rests of malassez can differentiate into ameloblast-like cells.</a> Journal of Cellular Physiology. 217 (3), 728-738 (2008).</li><li>Davis, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+epithelial+cell+rests+of+Malassez+on+the+bicentennial+of+their+description.">A review of the epithelial cell rests of Malassez on the bicentennial of their description.</a> Journal of Veterinary Dentistry. 35 (4), 290-298 (2018).</li><li>Athanassiou-Papaefthymiou, M., Papagerakis, P., Papagerakis, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+human+adult+epithelial+stem+cells+from+the+periodontal+ligament.">Isolation and characterization of human adult epithelial stem cells from the periodontal ligament.</a> Journal of Dental Research. 94 (11), 1591-1600 (2015).</li><li>Kim, G. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+establishment+of+dental+epithelial-like+stem+cells+derived+from+human+ESCs+and+iPSCs.">Differentiation and establishment of dental epithelial-like stem cells derived from human ESCs and iPSCs.</a> International Journal of Molecular Sciences. 21 (12), 1-16 (2020).</li><li>Nam, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+Hertwig's+epithelial+root+sheath/+epithelial+rests+of+malassez+cell+line+from+human+periodontium.">Establishment of Hertwig's epithelial root sheath/ epithelial rests of malassez cell line from human periodontium.</a> Molecules and Cells. 37 (7), 562-567 (2014).</li><li>Nam, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+profile+of+the+stem+cell+markers+in+human+hertwig's+epithelial+root+sheath/Epithelial+rests+of+Malassez+cells.">Expression profile of the stem cell markers in human hertwig's epithelial root sheath/Epithelial rests of Malassez cells.</a> Molecules and Cells. 31 (4), 355-360 (2011).</li><li>Tsunematsu, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+odontogenic+epithelial+cells+derived+from+epithelial+rests+of+Malassez+possess+stem+cell+properties.">Human odontogenic epithelial cells derived from epithelial rests of Malassez possess stem cell properties.</a> Laboratory Investigation; A Journal of Technical Methods and Pathology. 96 (10), 1063-1075 (2016).</li><li>Artegiani, B., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+and+application+of+3D-organoid+technology.">Use and application of 3D-organoid technology.</a> Human Molecular Genetics. 27 (2), 99-107 (2018).</li><li>Boretto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+from+endometrial+disease+capture+clinical+heterogeneity+and+are+amenable+to+drug+screening.">Patient-derived organoids from endometrial disease capture clinical heterogeneity and are amenable to drug screening.</a> Nature Cell Biology. 21 (8), 1041-1051 (2019).</li><li>Cox, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids+from+pituitary+as+a+novel+research+model+toward+pituitary+stem+cell+exploration.">Organoids from pituitary as a novel research model toward pituitary stem cell exploration.</a> Journal of Endocrinology. 240 (2), 287-308 (2019).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Boretto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+organoids+from+mouse+and+human+endometrium+showing+endometrial+epithelium+physiology+and+long-term+expandability.">Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability.</a> Development (Cambridge). 144 (10), 1775-1786 (2017).</li><li>Schutgens, F., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+organoids:+tools+for+understanding+biology+and+treating+diseases).">Human organoids: tools for understanding biology and treating diseases).</a> Annual Review of Pathology. 15, 211-234 (2020).</li><li>Hemeryck, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids+from+human+tooth+showing+epithelial+stemness+phenotype+and+differentiation+potential.">Organoids from human tooth showing epithelial stemness phenotype and differentiation potential.</a> Cellular and Molecular Life Sciences. 79 (3), 153 (2022).</li><li>Gao, X., Wu, Y., Liao, L., Tian, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+organoids:+progress+and+challenges.">Oral organoids: progress and challenges.</a> Journal of Dental Research. 100 (5), 454-463 (2021).</li><li>Binder, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+strategies+for+expansion+of+tooth+epithelial+stem+cells+and+ameloblast+generation.">Novel strategies for expansion of tooth epithelial stem cells and ameloblast generation.</a> Scientific Reports. 10 (1), 4963 (2020).</li><li>Xiong, J., Mrozik, K., Gronthos, S., Bartold, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+cell+rests+of+malassez+contain+unique+stem+cell+populations+capable+of+undergoing+epithelial-mesenchymal+transition.">Epithelial cell rests of malassez contain unique stem cell populations capable of undergoing epithelial-mesenchymal transition.</a> Stem Cells and Development. 21 (11), 2012-2025 (2012).</li><li>Luan, X., Ito, Y., Diekwisch, T. G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+and+development+of+Hertwig's+epithelial+root+sheath.">Evolution and development of Hertwig's epithelial root sheath.</a> Developmental Dynamics. 235 (5), 1167-1180 (2006).</li><li>Fukumoto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+insights+into+the+functions+of+enamel+matrices+in+calcified+tissues.">New insights into the functions of enamel matrices in calcified tissues.</a> Japanese Dental Science Review. 50 (2), 47-54 (2014).</li><li>Consolaro, A., Consolaro, M. F. M. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERM+functions,+EGF+and+orthodontic+movement+or+Why+doesn't+orthodontic+movement+cause+alveolodental+ankylosis.">ERM functions, EGF and orthodontic movement or Why doesn't orthodontic movement cause alveolodental ankylosis.</a> Dental Press Journal of Orthodontics. 15 (2), 24-32 (2010).</li><li>Guajardo, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunohistochemical+localization+of+epidermal+growth+factor+in+cat+paradental+tissues+during+tooth+movement.">Immunohistochemical localization of epidermal growth factor in cat paradental tissues during tooth movement.</a> American Journal of Orthodontics and Dentofacial Orthopedics. 118 (2), 210-219 (2000).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li><li>Gon&#231;alves, J., Sasso-Cerri, E., Cerri, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+death+and+quantitative+reduction+of+rests+of+Malassez+according+to+age.">Cell death and quantitative reduction of rests of Malassez according to age.</a> Journal of Periodontal Research. 43 (4), 478-481 (2008).</li><li>Kim, J., Koo, B. -. K., Knoblich, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+organoids:+Model+systems+for+human+biology+and+medicine.">Human organoids: Model systems for human biology and medicine.</a> Nature Reviews. Molecular Cell Biology. 21 (10), 571-584 (2020).</li><li>Razmi, M. T., Narang, T., Handa, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ADULT+(acro-dermato-ungual-lacrimal-tooth)+syndrome:+a+case+report+from+India.">ADULT (acro-dermato-ungual-lacrimal-tooth) syndrome: a case report from India.</a> Indian Dermatology Online Journal. 9 (3), 194 (2018).</li><li>. Future Health Biobank Available from: <a target="_blank" href="https://futurehealthbiobank.com/ch-en/">https://futurehealthbiobank.com/ch-en/</a> (2022)</li><li>Schreurs, R. R. C. E., Baumdick, M. E., Drewniak, A., Bunders, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+co-culture+of+human+intestinal+organoids+and+lamina+propria-derived+CD4++T+cells.">In vitro co-culture of human intestinal organoids and lamina propria-derived CD4+ T cells.</a> STAR Protocols. 2 (2), 100519 (2021).</li><li>Fiorini, E., Veghini, L., Corbo, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+cell+communication+in+cancer+with+organoids:+Making+the+complex+simple.">Modeling cell communication in cancer with organoids: Making the complex simple.</a> Frontiers in Cell and Developmental Biology. 8, 166 (2020).</li><li>Gjorevski, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+matrices+for+intestinal+stem+cell+and+organoid+culture.">Designer matrices for intestinal stem cell and organoid culture.</a> Nature. 539 (7630), 560-564 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyisocyanide+hydrogels+as+a+tunable+platform+for+mammary+gland+organoid+formation.">Polyisocyanide hydrogels as a tunable platform for mammary gland organoid formation.</a> Advanced Science. 7 (18), 2001797 (2020).</li><li>Mollaki, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethical+challenges+in+organoid+use.">Ethical challenges in organoid use.</a> BioTech. 10 (3), 12 (2021).</li></ol>

The corresponding author ensures that all authors have disclosed any and all conflicts of interest.

This protocol describes the efficient and reproducible generation of organoids starting from the human tooth. To our knowledge, this is the first methodology for establishing current-concept (epithelial) organoids starting from human dental tissue. The organoids are long-term expandable and display a tooth epithelial stemness phenotype, duplicating DESCs previously reported in the ERM compartment of the DF7. Moreover, the organoids replicate functional DESC/ERM characteristics, including the unfolding of an ameloblast differentiation process7,25,26. Findings are robust since comparable results were found with independent patient organoid lines19.
When executing this tooth organoid protocol, several critical points need to be taken into account. First, the addition of Rho-associated kinase (ROCK) inhibitor Y-27632 at initial seeding and immediately after each passaging is essential to prevent the single cells from undergoing anoikis27. In addition, Amphotericin B is required in all media refreshments during P0 to avoid (oral) fungal outgrowth. Second, it is advised to immediately process the freshly isolated DF tissues for the optimal organoid formation and growth efficiency, rather than to start from cryopreserved tissue, which results in lower efficiency. Third, when thawing a cryopreserved organoid line for culturing, perform steps as rapidly as possible and avoid too long thawing time as well as too long intervals between the steps as time prolongation decreases cell survival. Fourth, it should be noted that the number of organoids at early passage (P0-P3) may remain limited, also because only limited numbers of ERM (stem) cells may be present in the specific isolated DF tissue samples. Hence, the organoid cultures at early passage should be handled with care and consideration. Therefore, it is recommended to (i) avoid rapid expansion of the organoid culture (i.e., only start to split at 1:3 or more starting from P3-4, and before at 1:0.5 or 1:1); (ii) use the appropriate splitting method (low passage - higher passage) as described. Within this context, it is advised to collect unerupted wisdom teeth of young adolescent patients (15 to 19 years old) since ERM cells decrease in number with tooth development and age28. Fifth, remaining undispersed hard tissue fragments from the DF tissue in the cell suspension (even after filtering) cause the BMM drop to be less stable and more likely to dislodge during culture. A higher percentage of BMM (such as 80%) is recommended if multiple undispersed hard tissue fragments are observed in the dissociated DF cell suspension. Sixth, it is strongly advised to passage the organoids between day 10 and day 14 of culture since longer culture will negatively affect organoid expandability because of less optimal dissociation. If for one or the other reason, organoids are cultured longer than 14 days, TryplE Express quantity and incubation time for organoid dissociation could be extended for efficient dissociation, although 15 min of enzymatic exposure should not be surpassed. Within the same context, the culture medium must be refreshed every 2-3 days to prevent nutrient and growth factor exhaustion. In case organoids do not expand properly, regardless of the critical points mentioned above, one should focus on keeping all tools (BMM, ice-cold SFDM for pre-coating tip, microcentrifuge tubes) used during passaging on ice. In addition, it is crucial to correctly apply the distinct passaging methods (low passage and higher passage method) for efficient passaging of the organoids.
Before, other groups have reported in vitro growth of primary human DESC/ERM tissue8,9,10,11,12,21. However, cultures were mainly 2D (monolayers) and not 3D, such as this organoid model, moreover only showing short-term growth and phenotype retention. Alternatively, often (spontaneously) immortalized cells were used, which, however, are not physiological and show only limited resemblance to the tissue or cells of origin. Moreover, these cell lines were derived from embryonic tissue and/or from animals. Furthermore, ameloblast differentiation is either not described or only limitedly documented. Thus, the organoid model presented here offers several advantages, being (i) faithful recapitulation of the tissue/cells of origin, (ii) long-term expandable, (iii) cultured in 3D more closely representing the in vivo configuration, (iv) of human origin and postnatal age, and (v) capable of differentiating into mature dental cells (ameloblast cell type) (see19).
Thus, we generated a valuable research tool, not reported before, holding several interesting applications (Figure 1B). The organoids can be applied to study human DESC/ERM stemness and plasticity. It provides the opportunity to gain further insight into the biology of the still enigmatic ERM cell population by means of immunofluorescent, gene expression, and (single-cell) transcriptomic analyses. In addition, organoids are particularly suited for human disease modeling to decipher pathogenetic mechanisms, identify (new) therapeutic targets and generate drug discovery and screening tools29. More specifically, this model can be applied to odontogenic cysts (for which no reliable research model is available), which can be compared to healthy tooth-derived organoids. In addition, this tooth organoid approach may be harnessed to model and study tooth diseases ranging from the impact of bacteria to genetic mutations associated with tooth anomalies (such as mutations in P63, which could be introduced using cutting-edge gene-editing methods such as CRISPR-Cas)30, eventually leading to potential, and novel, therapeutic targets, and treatments. Other applications of the tooth organoid protocol may include biobanking (currently already available for dental pulp, such as the Future Health Biobank)31 to collect organoid lines from manifold persons and diseases (e.g., for basic and translational research such as drug screening). Furthermore, several reports on composite organoid models containing not only epithelial but also other cell types of the tissue of origin have recently been published32,33. As tooth composition is rather complex, accommodating mesenchymal, immune, and endothelial cells, applying this epithelial organoid model in combination with these cell types to more in detail represent their in vivo counterpart is an appealing perspective. Also, this system allows to explore amelogenesis in the human tooth, at present only poorly understood, but certainly relying on epithelial-mesenchymal interactions. Deciphering ameloblast development is expected to represent an important leap forward in the dental scientific and clinical world since the production of enamel, the quintessential component of our teeth, is a highly chased goal in dental tissue repair. Moreover, the organoid modeling detailed in this study may signify the start toward the formation of mineralized tissues in vitro and pave the way toward developing a bioengineered tooth (or at least parts) for replacement therapy.
One of the limitations of the organoid model is that it solely represents the epithelial component of tissue. However, as described in detail above, this shortcoming could be solved by the addition of other cell/tissue types, such as the dental mesenchyme19. Another aspect that may be recognized as a limitation is the origin of the BMM used here (Matrigel). This BMM is derived from a sarcoma (Engelbrecht-Holm-Swarm) of a mouse and therefore must be replaced before translating the organoid approach to the clinic. Recently, several efforts have been made to replace Matrigel with synthetic hydrogels34,35. However, more research is needed to successfully grow organoids in such non-natural gels. Although the organoid technology provides an interesting approach for future dental regenerative therapy - for instance, the development of a bioengineered tooth - ethical questions should be raised regarding the privacy of cell donors as well as the commercialization of human organoids and tissues derived thereof. So far, no conclusions regarding organoid commercialization for regenerative purposes have been reached36. Dental pulp biobanks have been on the rise31, as well as organoid biobanks from several, mainly cancerous tissues, for drug screening purposes. Given that organoids cannot be categorized as cells, gametes, tissues, or organs (which all are regulated by law), there is an urgent need for depicting its juridical status for its use in clinical, scientific, or commercial settings. Even though the organoids have shown to deposit mineralized tissue when subcutaneously transplanted in vivo19, further studies are required to analyze their potential to deposit enamel similar to that of a natural human tooth.
Altogether, the new organoid model developed presents a promising, valuable tool to study human tooth (stem cell) biology and amelogenesis, both at present only poorly explored, with future perspectives toward tooth disease modeling and regenerative therapies.

Teeth have essential roles in food mastication, speech, and psychological well-being (self-image). The human tooth consists of highly mineralized tissues of varying density and hardness1. Dental enamel, the main component of the tooth crown, is the highest mineralized tissue in the human body. During enamel formation (amelogenesis), when teeth develop, dental epithelial stem cells (DESCs) differentiate into enamel-forming cells (ameloblasts). Once formed, the enamel is rarely repaired or renewed due to the apoptotic loss of the ameloblasts at the onset of tooth eruption1. Restoration of damaged enamel tissue, as caused by trauma or bacterial disease, is currently accomplished using synthetic materials; however, these are troubled with important shortcomings such as microleakage, inferior osseointegration and anchorage, finite life span, and lack of fully functional repair2. Hence, a robust and reliable culture of human DESCs with the capacity to generate ameloblasts and the potential to produce mineralized tissue would be a major step forward in the dental regenerative field.
Knowledge on human DESC phenotype and biological function are scarce3,4,5. Interestingly, DESCs of human teeth have been proposed to exist in the Epithelial Cell Rests of Malassez (ERM), cell clusters present within the dental follicle (DF), which surrounds unerupted teeth, and remains present in the periodontal ligament around the root once the tooth erupts1. ERM cells co-cultured with dental pulp have been found to differentiate into ameloblast-like cells and generate enamel-like tissue6. However, profound studies of the specific role of ERM cells in enamel (re-) generation have been limited due to the lack of reliable study models7. Current ERM in vitro culture systems are hampered by limited life span and quick loss of phenotype in the 2D conditions standardly used8,9,10,11,12. Hence, a tractable in vitro system to faithfully expand, study, and differentiate human DESCs is strongly needed.
During the last decade, a powerful technique to grow epithelial stem cells in vitro has been successfully applied to several types of (human) epithelial tissues to study their biology as well as disease13,14,15,16. This technology enables the tissue epithelial stem cells to self-develop into 3D cell constructions (i.e., organoids) when seeded into an extracellular matrix (ECM)-mimicking scaffold (typically, Matrigel) and cultured in a defined medium replicating the tissue&#39;s stem cell niche signaling and/or embryogenesis. Typical growth factors needed for organoid development include epidermal growth factor (EGF) and wingless-type MMTV integration site (WNT) activators14,15,16. The resultant organoids are characterized by lasting fidelity in mimicking the tissue&#39;s original epithelial stem cells, as well as high expandability while retaining their phenotype and functional properties, thereby overcoming the often-limited primary human tissue availability as acquired from the clinic. To establish organoids, isolation of the epithelial stem cells from the heterogeneous tissue (i.e., comprising other cell types such as mesenchymal cells) prior to culturing is not required as mesenchymal cells do not attach to, or thrive in, the ECM, eventually resulting in purely epithelial organoids13,16,17,18,19. This promising and versatile technology has led to the development of manifold organoid models from various human epithelial tissues. However, human tooth-derived organoids, valuable for deep study of tooth development, regeneration and disease, were not established yet20,21. We recently succeeded in developing such a new organoid model starting from DF tissue from third molars (wisdom teeth) extracted from adolescent patients19.
Here, we describe the protocol to develop epithelial organoid cultures from the adult human tooth (i.e., from the DF of third molars) (Figure 1A). The resultant organoids express ERM-associated stemness markers while being long-term expandable. Intriguingly, opposite to most other organoid models, the typically needed EGF is redundant for robust organoid development and growth. Interestingly, the stemness organoids show ameloblast differentiation properties, thereby mimicking ERM/DESC features and processes occurring in vivo. The new and unique organoid model described here allows exploring DESC biology, plasticity, and differentiation capacity and opens the door for taking the first steps toward tooth-regenerative approaches.

<table><tbody><tr><td>1.5 mL Microcentrifuge tube</td><td>Eppendorf</td><td>30120.086</td><td></td></tr><tr><td>15 mL Centrifuge tube</td><td>Corning</td><td>430052</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-Aldrich</td><td>M-6250</td><td></td></tr><tr><td>48-well flat bottom plates</td><td>Corning</td><td>3548</td><td></td></tr><tr><td>50 mL Centrifuge tube</td><td>Corning</td><td>430290</td><td></td></tr><tr><td>A83-01</td><td>Sigma-Aldrich</td><td>SML0788</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Albumin Bovine (cell culture grade)</td><td>Serva</td><td>47330.03</td><td></td></tr><tr><td>AMELX antibody</td><td>Santa Cruz</td><td>sc-365284</td><td></td></tr><tr><td>Amphotericin B</td><td>Gibco</td><td>15200018</td><td></td></tr><tr><td>B27 (without vitamin A)</td><td>Gibco</td><td>12587-010</td><td></td></tr><tr><td>Cassette</td><td>VWR</td><td>7202191</td><td></td></tr><tr><td>Catalase from bovine liver</td><td>Sigma-Aldrich</td><td>C100</td><td></td></tr><tr><td>CD44 antibody</td><td>Abcam</td><td>ab34485</td><td></td></tr><tr><td>Cell strainer, 40 &amp;micro;m</td><td>Falcon</td><td>352340</td><td></td></tr><tr><td>Cholera Toxin</td><td>Sigma-Aldrich</td><td>C8052</td><td></td></tr><tr><td>Citric acid</td><td>Sigma-Aldrich</td><td>C0759</td><td></td></tr><tr><td>CK14 antibody</td><td>Thermo Fisher Scientific</td><td>MA5-11599</td><td></td></tr><tr><td>Collagenase IV</td><td>Gibco</td><td>17104-019</td><td></td></tr><tr><td>Cover glass</td><td>VWR</td><td>6310146</td><td></td></tr><tr><td>Cryobox</td><td>Thermo Scientific</td><td>5100-0001</td><td></td></tr><tr><td>Cryovial</td><td>Thermo Fisher Scientific</td><td>375353</td><td></td></tr><tr><td>Dimethylsulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D2650</td><td></td></tr><tr><td>Dispase II</td><td>Sigma-Aldrich</td><td>D4693</td><td></td></tr><tr><td>DMEM 1:1 F12 without Fe</td><td>Invitrogen</td><td>074-90715A</td><td></td></tr><tr><td>DMEM powder high glucose</td><td>Gibco</td><td>52100039</td><td></td></tr><tr><td>Dnase</td><td>Sigma-Aldrich</td><td>D5025-15KU</td><td></td></tr><tr><td>Donkey serum</td><td>Sigma-Aldrich</td><td>D9663 - 10ML</td><td></td></tr><tr><td>Embedding workstation, 220 to 240 Vac</td><td>Thermo Fisher Scientific</td><td>12587976</td><td></td></tr><tr><td>Ethanol absolute, &amp;ge;99.8% (EtOH)</td><td>Fisher Chemical</td><td>E/0650DF/15</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Sigma-Aldrich</td><td>F7524</td><td></td></tr><tr><td>FGF10</td><td>Peprotech</td><td>100-26</td><td></td></tr><tr><td>FGF2 (= basic FGF)</td><td>R&amp;amp;D Systems</td><td>234-FSE-025</td><td></td></tr><tr><td>FGF8</td><td>Peprotech</td><td>AF-100-25</td><td></td></tr><tr><td>GenElute Mammaliam Total RNA Miniprep Kit</td><td>Sigma-Aldrich</td><td>RTN350-1KT</td><td>Includes 1% &amp;beta;-mercaptoethanol dissolved in lysis buffer</td></tr><tr><td>Glass Pasteur pipette</td><td>Niko Mechanisms</td><td>170-40050</td><td></td></tr><tr><td>Glycine</td><td>VWR</td><td>101194M</td><td></td></tr><tr><td>HEPES</td><td>Sigma-Aldrich</td><td>H4034</td><td></td></tr><tr><td>IGF-1</td><td>PeproTech</td><td>100-11</td><td></td></tr><tr><td>InSolution Y-27632 (ROCK inhibitor, RI)</td><td>Sigma-Aldrich</td><td>688001</td><td></td></tr><tr><td>Insulin from bovine pancreas</td><td>Sigma-Aldrich</td><td>I6634</td><td></td></tr><tr><td>ITGA6 antibody</td><td>Sigma-Aldrich</td><td>HPA012696</td><td></td></tr><tr><td>L-Glutamine</td><td>Gibco</td><td>25030024</td><td></td></tr><tr><td>Matrigel (growth factor-reduced; phenol red-free)</td><td>Corning</td><td>15505739</td><td></td></tr><tr><td>Microscope slide</td><td>Thermo Fisher Scientific</td><td>J1800AMNZ</td><td></td></tr><tr><td>Millex-GV Syringe Filter Unit, 0.22&amp;nbsp;&amp;mu;m</td><td>Millipore</td><td>SLGV033R</td><td></td></tr><tr><td>Minimum essential medium eagle (&amp;alpha;MEM)</td><td>Sigma-Aldrich</td><td>M4526</td><td></td></tr><tr><td>mouse IgG (Alexa 555) secondary antibody</td><td>Thermo Fisher Scientific</td><td>A-31570</td><td></td></tr><tr><td>N2</td><td>Gibco</td><td>17502-048</td><td></td></tr><tr><td>N-acetyl L-cysteine</td><td>Sigma-Aldrich</td><td>A7250</td><td></td></tr><tr><td>Nicotinamide</td><td>Sigma-Aldrich</td><td>N0636</td><td></td></tr><tr><td>Noggin</td><td>PeproTech</td><td>120-10C</td><td></td></tr><tr><td>P63 antibody</td><td>Abcam</td><td>ab124762</td><td></td></tr><tr><td>Pap Pen</td><td>Sigma-Aldrich</td><td>Z377821-1EA</td><td>Marking pen</td></tr><tr><td>Paraformaldehyde (PFA), 16%</td><td>Merck</td><td>8.18715</td><td></td></tr><tr><td>Penicillin G sodium salt</td><td>Sigma-Aldrich</td><td>P3032</td><td></td></tr><tr><td>Penicillin-streptomycin (Pen/Strep)</td><td>Gibco</td><td>15140-122</td><td></td></tr><tr><td>Petri dish</td><td>Corning</td><td>353002</td><td></td></tr><tr><td>Phosphate buffered saline (PBS)</td><td>Gibco</td><td>10010-015</td><td></td></tr><tr><td>Pipette (P20, P200, P1000)</td><td>Eppendorf or others</td><td>2231300006</td><td></td></tr><tr><td>Plastic transfer pipette (3.5&amp;nbsp;mL)</td><td>Sarstedt</td><td>86.1171.001</td><td></td></tr><tr><td>Rabbit IgG (Alexa 488) secondary antibody</td><td>Thermo Fisher Scientific</td><td>A21206</td><td></td></tr><tr><td>RSPO1</td><td>PeproTech</td><td>120-38</td><td></td></tr><tr><td>SB202190 (p38i)</td><td>Biotechne (Tocris)</td><td>1264</td><td></td></tr><tr><td>Scalpel (surgical blade)</td><td>Swann-Morton</td><td>207</td><td></td></tr><tr><td>SHH</td><td>R&amp;amp;D Systems</td><td>464-SH-200</td><td></td></tr><tr><td>Silicone molds (Heating block)</td><td>VWR</td><td>720-1918</td><td></td></tr><tr><td>Sodium Chloride (NaCl)</td><td>BDH</td><td>102415K</td><td></td></tr><tr><td>Sodium Hydrogen Carbonate (NaHCO3)</td><td>Merck</td><td>106329</td><td></td></tr><tr><td>Sodium-pyruvate (C&lt;sub&gt;3&lt;/sub&gt;H&lt;sub&gt;3&lt;/sub&gt;NaO&lt;sub&gt;3&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>P-5280</td><td></td></tr><tr><td>SOX2 antibody</td><td>Abcam</td><td>ab92494</td><td></td></tr><tr><td>StepOnePlus</td><td>Thermo Fisher Scientific</td><td></td><td>Real-Time PCR System</td></tr><tr><td>Stericup-GP, 0.22 &amp;micro;m</td><td>Millipore</td><td>SCGPU02RE</td><td></td></tr><tr><td>Steriflip-GP Sterile Centrifuge Tube Top Filter Unit, 0.22 &amp;mu;m</td><td>Millipore</td><td>SCGP00525</td><td></td></tr><tr><td>Sterile 1000 &amp;mu;L pipette tips with filter</td><td>Greiner</td><td>740288</td><td></td></tr><tr><td>Sterile 20 &amp;mu;L pipette tips with filter</td><td>Greiner</td><td>774288</td><td></td></tr><tr><td>Sterile 200 &amp;mu;L pipette tips with and without filter</td><td>Greiner</td><td>739288</td><td></td></tr><tr><td>Sterile H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Fresenius</td><td>B230531</td><td></td></tr><tr><td>Streptomycin sulfate salt</td><td>Sigma-Aldrich</td><td>S6501</td><td></td></tr><tr><td>Superscript III first-strand synthesis supermix</td><td>Invitrogen</td><td>11752-050</td><td>Reverse transcription kit</td></tr><tr><td>Tissue processor</td><td>Thermo Scientific</td><td>12505356</td><td></td></tr><tr><td>Transferrin</td><td>Serva</td><td>36760.01</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma</td><td>T8787-50ML</td><td></td></tr><tr><td>TrypLE express</td><td>Gibco</td><td>12605-010</td><td></td></tr><tr><td>Vectashield mounting medium+DAPI</td><td>Labconsult NV</td><td>H-1200</td><td>Antifade mounting medium with DAPI</td></tr><tr><td>WNT3a</td><td>Biotechne (Tocris)</td><td>5036-WN-500</td><td></td></tr><tr><td>Xylenes, 99%, for biochemistry and histology</td><td>VWR</td><td>2,89,75,325</td><td></td></tr></tbody></table>

establishing organoids from human tooth as a powerful tool toward mechanistic research and regenerative therapy

Teeth are of key importance in life not only for food mastication and speech but also for psychological well-being. Knowledge on human tooth development and biology is scarce. In particular, not much is known about the tooth's epithelial stem cells and their function. We succeeded in developing a novel organoid model starting from human tooth tissue (i.e., dental follicle, isolated from extracted wisdom teeth). The organoids are robustly and long-term expandable and recapitulate the proposed human tooth epithelial stem cell compartment in terms of marker expression as well as functional activity. In particular, the organoids are capable to unfold an ameloblast differentiation process as occurring in vivo during amelogenesis. This unique organoid model will provide a powerful tool to study not only human tooth development but also dental pathology, and may pave the way toward tooth-regenerative therapy. Replacing lost teeth with a biological tooth based on this new organoid model could be an appealing alternative to the current standard implantation of synthetic materials.

Tooth organoid development 
We provide a detailed protocol to establish organoid cultures from human DF tissue acquired following wisdom tooth extraction (Figure 1A). Isolated DF is enzymatically and mechanically dissociated. The obtained cells are cultured within BMM in media that were empirically defined for optimal organoid development and growth (tooth organoid medium; TOM)19.
The organoids typically develop within 2 weeks after DF cell seeding (P0; Figure 2A). The organoids are long-term expandable (up to 11 passages so far) (Figure 2B, shown at P4). Seeding around 20,000 cells per BMM droplet (at both P0 and further passages) yields an optimal density of organoids (Figure 2C), whereas seeding higher cell numbers leads to suboptimal organoid outgrowth (i.e., smaller organoids at too high density) as there is insufficient space to grow (Figure 2D). The eventually optimized culture conditions allow the development of organoids from DF samples at 100% efficiency19.
Tooth organoid characterization and validation 
The developed organoids show a dense appearance and contain cells displaying a high nucleo-cytoplasmic ratio, as similarly observed in ERM cells7 (Figure 3A). Moreover, and in further analogy, the organoids express the ERM marker cytokeratin 14 (CK14)22, thereby confirming their epithelial origin (Figure 3B), as well as other proposed ERM markers (such as P63, CD44 and ITG&#945;612,22,23 (Figure 3B). Moreover, organoids express SOX2, a well-known DESC marker in mice and also present in the epithelium of developing human teeth (Figure 3B)1. Interestingly, amelogenin (AMELX), the main component of the enamel matrix, also found expressed in the organoids, is also detected in the ERM24 (Figure 3C). Expression of still other ERM/stemness markers is described in our recent study19 and can be used to further certify the obtained organoids. Furthermore, the organoids retain their ERM/stemness phenotype during passaging, among others shown by stable expression of ERM/stem cell markers (Figure 3D). Finally, the tooth-derived organoids show differentiation capacity to ameloblast(-like) cells, which can also be applied to validate the obtained organoid cultures, showing expression of mature ameloblast markers such as odontogenic-ameloblast associated protein (ODAM) and amelotin (AMTN) after transfer to differentiation medium (see19).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63671/63671fig01.jpg" /> 
Figure 1: Schematic workflow of tooth organoid development, characterization, and applications. (A) Tooth organoid development from dental follicle (DF) tissue isolated from unerupted third molars. (B) Amplification, characterization, and application potential of tooth organoids. d, day; P, passage. Created with BioRender.com. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63671/63671fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63671/63671fig02.jpg" /> 
Figure 2: Tooth organoid development. (A)&#160;Organoid development from DF tissue. Representative brightfield images shown at different days (d) after seeding (P0; P, passage; 2.5x). (B) Brightfield images showing robust passageability of a tooth organoid line (2.5x). (C) Brightfield images showing a tooth organoid line immediately at passaging (d0; left; 2.5x) seeded at a density of 20,000 cells per well, and the resultant confluent organoid culture ready to be passaged (d14; right; 2.5x). (D) Brightfield images showing a tooth organoid line, which had been seeded at a density of &#62;20,000 cells, leading to smaller organoids at too high density at d14 (2.5x). Scale bars: 200 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63671/63671fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63671/63671fig03.jpg" /> 
Figure 3: Tooth organoid characterization. (A) Brightfield images of DF-derived organoid cultures at different magnifications showing dense structures developed at 14 days in TOM (P4; 5-20x)). Hematoxylin and eosin staining of an organoid (P1, day 11). Box is enlarged. Arrows indicate cells with a high nucleo-cytoplasmic ratio. (B) Immunofluorescent staining for epithelial/ERM/stemness markers in TOM-grown organoids (20x). (C) Immunofluorescent staining for amelogenin (AMELX) in TOM-grown organoid (20x). DAPI (blue) was used to label nuclei. (D) Gene expression levels (relative to GAPDH) of ERM/stemness markers in P1 and P5 TOM-grown organoids at day 14 of culture (mean &#177; SEM; n = 3 biological replicates). Scale bars: 50 &#181;m, unless indicated otherwise. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63671/63671fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Dental follicle (DF) collection medium</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>Minimum essential medium eagle (&#945;MEM)</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>10%</td>
		</tr>
		<tr>
			<td>Amphotericin B</td>
			<td>0.5%</td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen/Strep)</td>
			<td>1%</td>
		</tr>
	</tbody>
</table>
Table 1: Dental follicle (DF) collection medium. The table lists the constituents of the DF collection medium.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Tooth organoid medium (TOM)</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>Serum-free defined medium (SFDM)</td>
			<td>See Table 3 for composition</td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>0.5 &#181;M</td>
		</tr>
		<tr>
			<td>B27 (without vitamin A)</td>
			<td>2%</td>
		</tr>
		<tr>
			<td>Cholera Toxin</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>FGF2 (= basic FGF)</td>
			<td>20 ng/mL</td>
		</tr>
		<tr>
			<td>FGF8</td>
			<td>200 ng/mL</td>
		</tr>
		<tr>
			<td>FGF10</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>2 mM</td>
		</tr>
		<tr>
			<td>IGF-1</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>N2</td>
			<td>1%</td>
		</tr>
		<tr>
			<td>N-acetyl L-cysteine</td>
			<td>1.25 mM</td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>Noggin</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>RSPO1</td>
			<td>200 ng/mL</td>
		</tr>
		<tr>
			<td>SB202190 (p38i)</td>
			<td>10 &#181;M</td>
		</tr>
		<tr>
			<td>SHH</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>WNT3a</td>
			<td>200 ng/mL</td>
		</tr>
	</tbody>
</table>
Table 2: Tooth organoid medium (TOM). The table lists the constituents and their respective concentrations required to prepare the tooth organoid medium.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Serum-free defined medium (SFDM) (pH 7.3)</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>Sterile H2O</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM 1:1 F12 without Fe</td>
			<td>16.8 g/L</td>
		</tr>
		<tr>
			<td>Transferrin</td>
			<td>5 mg/L</td>
		</tr>
		<tr>
			<td>Insulin from bovine pancreas</td>
			<td>5 mg/L</td>
		</tr>
		<tr>
			<td>Penicillin G sodium salt</td>
			<td>35 mg/L</td>
		</tr>
		<tr>
			<td>Streptomycin sulfate salt</td>
			<td>50 mg/L</td>
		</tr>
		<tr>
			<td>Ethanol absolute, &#8805;99.8% (EtOH)</td>
			<td>600 &#181;L/L</td>
		</tr>
		<tr>
			<td>Catalase from bovine liver</td>
			<td>50 &#181;L/L</td>
		</tr>
		<tr>
			<td>Sodium Hydrogen Carbonate (NaHCO3)</td>
			<td>1 g/L</td>
		</tr>
		<tr>
			<td>Albumin Bovine (cell culture grade)</td>
			<td>5 g/L</td>
		</tr>
	</tbody>
</table>
Table 3: Serum-free defined medium (SFDM) (pH 7.3). The table lists the composition of the serum-free defined medium.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Dissociation medium</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase IV</td>
			<td>3 mg/mL</td>
		</tr>
		<tr>
			<td>Dispase II</td>
			<td>4 mg/mL</td>
		</tr>
	</tbody>
</table>
Table 4: Dissociation medium. List of constituents and their required concentrations for preparing the dissociation medium.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Medium A (pH 7.3)</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>Sterile H2O</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM powder high glucose</td>
			<td>13.38 g/L</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>5.958 g/L</td>
		</tr>
		<tr>
			<td>Sodium-pyruvate (C3H3NaO3)</td>
			<td>110 mg/L</td>
		</tr>
		<tr>
			<td>Penicillin G sodium salt</td>
			<td>35 mg/L</td>
		</tr>
		<tr>
			<td>Streptomycin sulfate salt</td>
			<td>50 mg/L</td>
		</tr>
		<tr>
			<td>Sodium Chloride (NaCl)</td>
			<td>0.5 g/L</td>
		</tr>
		<tr>
			<td>Sodium Hydrogen Carbonate (NaHCO3)</td>
			<td>1 g/L</td>
		</tr>
		<tr>
			<td>Albumin Bovine (cell culture grade)</td>
			<td>3 g/L</td>
		</tr>
		<tr>
			<td>Dnase*</td>
			<td>0.2 mg/mL</td>
		</tr>
		<tr>
			<td>*add when mentioned</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 5: Medium A (pH 7.3). The table lists the concentration of the constituents used to prepare Medium A.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Primary Antibodies</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Host</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>AMELX</td>
			<td>mouse</td>
			<td>1:100</td>
		</tr>
		<tr>
			<td>CD44</td>
			<td>mouse</td>
			<td>1:200</td>
		</tr>
		<tr>
			<td>CK14</td>
			<td>mouse</td>
			<td>1:200</td>
		</tr>
		<tr>
			<td>ITGA6</td>
			<td>rabbit</td>
			<td>1:200</td>
		</tr>
		<tr>
			<td>P63</td>
			<td>rabbit</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>SOX2</td>
			<td>rabbit</td>
			<td>1:2000</td>
		</tr>
		<tr>
			<td colspan="3">Secundary Antibodies</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Host</td>
			<td>Concentration</td>
		</tr>
		<tr>
			<td>mouse IgG (Alexa 555)</td>
			<td>donkey</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>rabbit IgG (Alexa 488)</td>
			<td>donkey</td>
			<td>1:1000</td>
		</tr>
	</tbody>
</table>
Table 6: List of antibodies and their dilutions. The table lists the antibodies and their respective dilutions used in this study.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gene</td>
			<td>Forward primer</td>
			<td>Reverse primer</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td>GGTATCGTGGAAGGACTCATGAC</td>
			<td>ATGCCAGTGAGCTTCCCGTTCAG</td>
		</tr>
		<tr>
			<td>P63</td>
			<td>CAACGCAGTAGACACCATTTCC</td>
			<td>CCCAAAACCTTCTCGCTTGTT</td>
		</tr>
		<tr>
			<td>ITGA6</td>
			<td>GGCGGTGTTATGTCCTGAGTC</td>
			<td>AATCGCCCATCACAAAAGCTC</td>
		</tr>
		<tr>
			<td>SOX2</td>
			<td>GCTGGGACATGTGAAGTCTG</td>
			<td>CCCTGTGGTTACCTCTTCCT</td>
		</tr>
		<tr>
			<td>PITX2</td>
			<td>CAGCGGACTCACTTTACCAG</td>
			<td>ATTCTTGAACCAAACCCGGAC</td>
		</tr>
	</tbody>
</table>
Table 7: List of primers. The table lists the primers of GAPDH, P63, ITGA6, SOX2, and PITX2 used in this study.

Watch this Scientific Journal Video about Establishing Organoids from Human Tooth as a Powerful Tool Toward Mechanistic Research and Regenerative Therapy at JoVE.com

Establishing Organoids from Human Tooth as a Powerful Tool Toward Mechanistic Research and Regenerative Therapy

We present a protocol to develop epithelial organoid cultures starting from human tooth. The organoids are robustly expandable and recapitulate the tooth's epithelial stem cells, including their ameloblast differentiation capacity. The unique organoid model provides a promising tool to study human dental (stem cell) biology with perspectives for tooth-regenerative approaches.

Teeth are of key importance in life not only for food mastication and speech but also for psychological well-being. Knowledge on human tooth development ...

establishing-organoids-from-human-tooth-as-powerful-tool-toward

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

3.2K Views.  KU Leuven (University of Leuven). We present a protocol to develop epithelial organoid cultures starting from human tooth. The organoids are robustly expandable and recapitulate the tooth's epithelial stem cells, including their ameloblast differentiation capacity. The unique organoid model provides a promising tool to study human dental (stem cell) biology with perspectives for tooth-regenerative approaches.

Video: Establishing Organoids from Human Tooth as a Powerful Tool Toward Mechanistic Research and Regenerative Therapy

Isolation, Characterization and MicroRNA-based Genetic Modification of Human Dental Follicle Stem Cells

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such as initial massive cell death and low therapeutic effects, impaired their broad clinical translation. Genetic engineering of stem cells prior to transplantation emerged as a promising method to optimize therapeutic stem cell effects. However, safe and efficient gene delivery systems are still lacking. Therefore, the development of suitable methods may provide an approach to resolve current challenges in stem cell-based therapies.
The present protocol describes the extraction and characterization of human dental follicle stem cells (hDFSCs) as well as their non-viral genetic modification. The postnatal dental follicle unveiled as a promising and easily accessible source for harvesting adult multipotent stem cells possessing high proliferation potential. The described isolation procedure presents a simple and reliable method to harvest hDFSCs from impacted wisdom teeth. Also this protocol comprises methods to define stem cell characteristics of isolated cells. For genetic engineering of hDFSCs, an optimized cationic lipid-based transfection strategy is presented enabling highly efficient microRNA introduction without causing cytotoxic effects. MicroRNAs are suitable candidates for transient cell manipulation, as these small translational regulators control the fate and behavior of stem cells without the hazard of stable genome integration. Thus, this protocol represents a safe and efficient procedure for engineering of hDFSCs that may become important for optimizing their therapeutic efficacy.

This protocol describes the transient genetic engineering of dental stem cells extracted from the human dental follicle. The applied non-viral modification strategy may become a basis for the improvement of therapeutic stem cell products.

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such ...

Genetics

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Medicine

A Co-Culture Method to Study Neurite Outgrowth in Response to Dental Pulp Paracrine Signals

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. Without sensory innervation, daily oral activities would cause irreparable damage. Despite its importance, the roles of innervation in tooth development and maintenance have been largely overlooked. Several studies have demonstrated that DP cells secrete extracellular matrix proteins and paracrine signals to attract and guide TG axons into and throughout the tooth. However, few studies have provided detailed insight into the crosstalk between the DP mesenchyme and neuronal afferents. To address this gap in knowledge, researchers have begun to utilize co-cultures and a variety of techniques to investigate these interactions. Here, we demonstrate the multiple steps involved in co-culturing primary DP cells with TG neurons dispersed on an overlying transwell filter with large diameter pores to allow axonal growth through the pores. Primary DP cells with the gene of interest flanked by loxP sites were utilized to facilitate gene deletion using an Adenovirus-Cre-GFP recombinase system. Using TG neurons from the Thy1-YFP mouse allowed for precise afferent imaging, with expression well above background levels by confocal microscopy. The DP responses can be investigated via protein or RNA collection and analysis, or alternatively, through immunofluorescent staining of DP cells plated on removable glass coverslips. Media can be analyzed using techniques such as proteomic analyses, although this will require albumin depletion due to the presence of fetal bovine serum in the media. This protocol provides a simple method that can be manipulated to study the morphological, genetic, and cytoskeletal responses of TG neurons and DP cells in response to the controlled environment of a co-culture assay.

We describe the isolation, dispersion and plating of dental pulp (DP) primary cells with trigeminal (TG) neurons cultured atop overlying transwell filters. Cellular responses of DP cells can be analyzed with immunofluorescence or RNA/protein analysis. Immunofluorescence of neuronal markers with confocal microscopy permits the analysis of neurite outgrowth responses.

Tooth innervation allows teeth to sense pressure, temperature and inflammation, all of which are crucial to the use and maintenance of the tooth organ. ...

Use of Trowell-Type Organ Culture to Study Regulation of Dental Stem Cells

Organ development, function, and regeneration depend on stem cells, which reside within discrete anatomical spaces called stem cell niches. The continuously growing mouse incisor provides an excellent model to study tissue-specific stem cells. The epithelial tissue-specific stem cells of the incisor are located at the proximal end of the tooth in a niche called the cervical loop. They provide a continuous influx of cells to counterbalance the constant abrasion of the self-sharpening tip of the tooth. Presented here is a detailed protocol for the isolation and culture of the proximal end of the mouse incisor that houses stem cells and their niche. This is a modified Trowell-type organ culture protocol that enables in vitro culture of tissue pieces (explants), as well as the thick tissue slices at the liquid/air interface on a filter supported by a metal grid. The organ culture protocol described here enables tissue manipulations not feasible in vivo, and when combined with the use of a fluorescent reporter(s), it provides a platform for the identification and tracking of discrete cell populations in live tissues over time, including stem cells. Various regulatory molecules and pharmacological compounds can be tested in this system for their effect on stem cells and their niches. This ultimately provides a valuable tool to study stem cell regulation and maintenance.

The Trowell-type organ culture method has been used to unravel complex signaling networks that govern tooth development and, more recently, for studying regulation involved in stem cells of the continuously growing mouse incisor. Fluorescent-reporter animal models and live-imaging methods facilitate in-depth analyses of dental stem cells and their specific niche microenvironment.

Organ development, function, and regeneration depend on stem cells, which reside within discrete anatomical spaces called stem cell niches. The ...

Live Tracking of Dental Cells via Two-Photon Microscopy

Using Ex Vivo Live Imaging to Investigate Cell Divisions and Movements During Mouse Dental Renewal

The continuously growing mouse incisor is emerging as a highly tractable model system to investigate the regulation of adult epithelial and mesenchymal stem cells and tooth regeneration. These progenitor populations actively divide, move, and differentiate to maintain tissue homeostasis and regenerate lost cells in a responsive manner. However, traditional analyses using fixed tissue sections could not capture the dynamic processes of cellular movements and interactions, limiting our ability to study their regulations. This paper describes a protocol to maintain whole mouse incisors in an explant culture system and live-track dental epithelial cells using multiphoton timelapse microscopy. This technique adds to our existing toolbox for dental research and allows investigators to acquire spatiotemporal information on cell behaviors and organizations in a living tissue. We anticipate that this methodology will help researchers further explore mechanisms that control the dynamic cellular processes taking place during both dental renewal and regeneration.

Author Spotlight: Understanding Dynamic Cellular Behaviors in Adult Mouse Dental Tissue Renewal and Repairment 

Ex vivo live imaging is a powerful technique for studying the dynamic processes of cellular movements and interactions in living tissues. Here, we present a protocol that implements two-photon microscopy to live track dental epithelial cells in cultured whole adult mouse incisors.

The continuously growing mouse incisor is emerging as a highly tractable model system to investigate the regulation of adult epithelial and mesenchymal ...

Development of a Direct Pulp-capping Model for the Evaluation of Pulpal Wound Healing and Reparative Dentin Formation in Mice

Dental pulp is a vital organ of a tooth fully protected by enamel and dentin. When the pulp is exposed due to cariogenic or iatrogenic injuries, it is often capped with biocompatible materials in order to expedite pulpal wound healing. The ultimate goal is to regenerate reparative dentin, a physical barrier that functions as a "biological seal" and protects the underlying pulp tissue. Although this direct pulp-capping procedure has long been used in dentistry, the underlying molecular mechanism of pulpal wound healing and reparative dentin formation is still poorly understood. To induce reparative dentin, pulp capping has been performed experimentally in large animals, but less so in mice, presumably due to their small sizes and the ensuing technical difficulties. Here, we present a detailed, step-by-step method of performing a pulp-capping procedure in mice, including the preparation of a Class-I-like cavity, the placement of pulp-capping materials, and the restoration procedure using dental composite. Our pulp-capping mouse model will be instrumental in investigating the fundamental molecular mechanisms of pulpal wound healing in the context of reparative dentin in vivo by enabling the use of transgenic or knockout mice that are widely available in the research community.

We describe a step-by-step method of performing direct pulp capping on mice teeth for the evaluation of pulpal wound healing and reparative dentin formation in vivo.

Dental pulp is a vital organ of a tooth fully protected by enamel and dentin. When the pulp is exposed due to cariogenic or iatrogenic injuries, it is ...

Propagation of Dental and Respiratory Cells and Organs in Microgravity

Gravity is one of the key determinants of human cell function, proliferation, cytoskeletal architecture and orientation. Rotary bioreactor systems (RCCSs) mimic the loss of gravity as it occurs in space and instead provide a microgravity environment through continuous rotation of cultured cells or tissues. These RCCSs ensure an un-interrupted supply of nutrients, growth and transcription factors, and oxygen, and address some of the shortcomings of gravitational forces in motionless 2D (two dimensional) cell or organ culture dishes. In the present study we have used RCCSs to co-culture cervical loop cells and dental pulp cells to become ameloblasts, to characterize periodontal progenitor/scaffold interactions, and to determine the effect of inflammation on lung alveoli. The RCCS environments facilitated growth of ameloblast-like cells, promoted periodontal progenitor proliferation in response to scaffold coatings, and allowed for an assessment of the effects of inflammatory changes on cultured lung alveoli. This manuscript summarizes the environmental conditions, materials, and steps along the way and highlights critical aspects and experimental details. In conclusion, RCCSs are innovative tools to master the culture and 3D (three dimensional) growth of cells in vitro and to allow for the study of cellular systems or interactions not amenable to classic 2D culture environments.

This protocol presents a method for the culture and 3D growth of ameloblast-like cells in microgravity to maintain their elongated and polarized shape as well as enamel-specific protein expression. Culture conditions for the culture of periodontal engineering constructs and lung organs in microgravity are also described.

Gravity is one of the key determinants of human cell function, proliferation, cytoskeletal architecture and orientation. Rotary bioreactor systems (RCCSs) ...

Bioengineering

Isolation and Culture of Dental Epithelial Stem Cells from the Adult Mouse Incisor

Understanding the cellular and molecular mechanisms that underlie tooth regeneration and renewal has become a topic of great interest1-4, and the mouse incisor provides a model for these processes. This remarkable organ grows continuously throughout the animal&#39;s life and generates all the necessary cell types from active pools of adult stem cells housed in the labial (toward the lip) and lingual (toward the tongue) cervical loop (CL) regions. Only the dental stem cells from the labial CL give rise to ameloblasts that generate enamel, the outer covering of teeth, on the labial surface. This asymmetric enamel formation allows abrasion at the incisor tip, and progenitors and stem cells in the proximal incisor ensure that the dental tissues are constantly replenished. The ability to isolate and grow these progenitor or stem cells in vitro allows their expansion and opens doors to numerous experiments not achievable in vivo, such as high throughput testing of potential stem cell regulatory factors. Here, we describe and demonstrate a reliable and consistent method to culture cells from the labial CL of the mouse incisor.

The continuously growing mouse incisor provides a model for studying renewal of dental tissues from dental epithelial stem cells (DESCs). A robust system for consistently and reliably obtaining these cells from the incisor and expanding them in vitro is reported here.

Understanding the cellular and molecular mechanisms that underlie tooth regeneration and renewal has become a topic of great interest1-4, and the mouse ...

Biology

hiPSC-Derived Vascular Organoids for Drug Screening and Disease Modeling

Vascular Organoid Generation from Human-Induced Pluripotent Stem Cells

Vascular organoids derived from human induced pluripotent stem cells (hiPSCs) recapitulate the cell type diversity and complex architecture of human vascular networks. This three-dimensional (3D) model holds substantial potential for vascular pathology modeling and in vitro drug screening. Despite recent advances, a key technical challenge remains in reproducibly generating organoids with consistent quality, which is crucial for downstream assays and applications. Here, a modified protocol is presented that improves both the homogeneity and reproducibility of vascular organoid generation. The modified protocol incorporates the use of microwells and the CEPT cocktail (chroman 1, emricasan, polyamines, and the integrated stress response inhibitor, trans-ISRIB) to improve embryoid body formation and cell survival. Differentiated, mature vascular organoids generated using this protocol are characterized by whole-mount 3D immunofluorescence microscopy to analyze their morphology and complex vasculature. This protocol enables the production of high-quality vascular organoids in a scalable manner, potentially facilitating their use in disease modeling and drug screening applications.

Author Spotlight: Improving Reproducibility in Vascular Organoids Using ROCK Inhibitors and Microwell Confinement

This protocol presents a method for generating vascular organoids using human pluripotent stem cells.

Vascular organoids derived from human induced pluripotent stem cells (hiPSCs) recapitulate the cell type diversity and complex architecture of human ...

Isolation of Epithelial Cells from Human Dental Follicle

The dental follicle (DF) was harvested during the removal of an impacted third molar by an oral maxillofacial surgeon. Epithelial cell isolation was performed on the day of DF harvest. The DF was washed three times with DPBS and then dissected with tissue scissors until the tissue had a pulpy or squishy consistency. Single-cell populations were pelleted by centrifugation and washed with keratinocyte serum-free medium. Heterogeneous cell populations were distributed in a culture dish. Keratinocyte serum-free medium was used to select the epithelial cells. The culture medium was changed daily until no floating debris or dead cells were observed. Epithelial cells appeared within 7-10 days after cell population distribution. Epithelial cells survived in serum-free medium, while &#945;-modification minimal essential medium supplemented with 10% fetal bovine serum allowed the proliferation of mesenchymal-type cells. The DF is a tissue source for the isolation of dental epithelial cells.
The purpose of this study was to establish a method for the isolation of epithelial cells from human DF. Periodontal ligament (PDL) was used for the isolation of human dental epithelial cells. Procuring epithelial cells from human PDL is not always successful due to the small tissue volume, leading to low numbers of epithelial cells. DF has a larger volume than PDL and contains more cells. DF can be a tissue source for the primary culture of human dental epithelial cells. This protocol is easier and more efficient than the isolation method using PDL. Procuring human dental epithelial cells may facilitate further studies of dental epithelial-mesenchymal interactions.

The dental follicle contains an epithelial population and mesenchymal cells. The epithelial population was selected from the heterogeneous dental follicle cell population by providing a distinct culture medium. Epithelial cells survived and formed colonies in a serum-free medium.

The dental follicle (DF) was harvested during the removal of an impacted third molar by an oral maxillofacial surgeon. Epithelial cell isolation was ...