Extending the deepest gratitude for funding support provided by the National Institutes of Health (R01AR078551 and T32AR007411), the Dystrophic Epidermolysis Bullosa Research Association (DEBRA) Austria, the Gates Grubstake Fund and the Gates Frontiers Fund.

Detecting Off-Target CRISPR-Cas9 Cleavage Events with CIRCLE-Seq

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Frangoul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+gene+editing+for+sickle+cell+disease+and+beta-thalassemia.">CRISPR-Cas9 gene editing for sickle cell disease and beta-thalassemia.</a> N Engl J Med. 384 (3), 252-260 (2021).</li><li>Ledford, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+treatment+inserted+directly+into+the+body+for+first+time.">CRISPR treatment inserted directly into the body for first time.</a> Nature. 579 (7798), 185 (2020).</li><li>Gillmore, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+in+vivo+gene+editing+for+transthyretin+amyloidosis.">CRISPR-Cas9 in vivo gene editing for transthyretin amyloidosis.</a> N Engl J Med. 385 (6), 493-502 (2021).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat Biotechnol. 31 (9), 822-826 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat Biotechnol. 31 (9), 827-832 (2013).</li><li>Anzalone, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Search-and-replace+genome+editing+without+double-strand+breaks+or+donor+DNA.">Search-and-replace genome editing without double-strand breaks or donor DNA.</a> Nature. 576 (7785), 149-157 (2019).</li><li>Hong, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+base+editing+and+prime+editing+of+COL7A1+mutations+in+recessive+dystrophic+epidermolysis+bullosa.">Therapeutic base editing and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosa.</a> Mol Ther. 30 (8), 2664-2679 (2022).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+prime+editing+via+xrRNA+motif-joined+pegRNA.">Enhancement of prime editing via xrRNA motif-joined pegRNA.</a> Nat Commun. 13 (1), 1856 (2022).</li><li>Lee, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prime+editing+with+genuine+Cas9+nickases+minimizes+unwanted+indels.">Prime editing with genuine Cas9 nickases minimizes unwanted indels.</a> Nat Commun. 14 (1), 1786 (2023).</li><li>Howe, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertional+mutagenesis+combined+with+acquired+somatic+mutations+causes+leukemogenesis+following+gene+therapy+of+SCID-X1+patients.">Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.</a> J Clin Invest. 118 (9), 3143-3150 (2008).</li><li>Hacein-Bey-Abina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertional+oncogenesis+in+4+patients+after+retrovirus-mediated+gene+therapy+of+SCID-X1.">Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1.</a> J Clin Invest. 118 (9), 3132-3142 (2008).</li><li>Has, C., Kiritsi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapies+for+inherited+skin+fragility+disorders.">Therapies for inherited skin fragility disorders.</a> Exp Dermatol. 24 (5), 325-331 (2015).</li><li>Murnane, J. P., Yezzi, M. J., Young, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+events+during+integration+of+transfected+DNA+into+normal+human+cells.">Recombination events during integration of transfected DNA into normal human cells.</a> Nucleic Acids Res. 18 (9), 2733-2738 (1990).</li><li>Hsieh, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myelodysplastic+syndrome+unrelated+to+lentiviral+vector+in+a+patient+treated+with+gene+therapy+for+sickle+cell+disease.">Myelodysplastic syndrome unrelated to lentiviral vector in a patient treated with gene therapy for sickle cell disease.</a> Blood Advances. 4 (9), 2058-2063 (2020).</li><li>Tsai, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GUIDE-seq+enables+genome-wide+profiling+of+off-target+cleavage+by+CRISPR-Cas+nucleases.">GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.</a> Nat Biotechnol. 33 (2), 187-197 (2015).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors.">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nat Biotechnol. 33 (2), 175-178 (2015).</li><li>Lensing, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DSBCapture:+In+situ+capture+and+sequencing+of+DNA+breaks.">DSBCapture: In situ capture and sequencing of DNA breaks.</a> Nat Methods. 13 (10), 855-857 (2016).</li><li>Crosetto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide-resolution+DNA+double-strand+break+mapping+by+next-generation+sequencing.">Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing.</a> Nat Methods. 10 (4), 361-365 (2013).</li><li>Yan, W. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLISS+is+a+versatile+and+quantitative+method+for+genome-wide+profiling+of+DNA+double-strand+breaks.">BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.</a> Nat Commun. 8, 15058 (2017).</li><li>Kim, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digenome-seq:+Genome-wide+profiling+of+CRISPR-Cas9+off-target+effects+in+human+cells.">Digenome-seq: Genome-wide profiling of CRISPR-Cas9 off-target effects in human cells.</a> Nat Methods. 12 (3), 237-243 (2015).</li><li>Cameron, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+genomic+landscape+of+CRISPR-Cas9+cleavage.">Mapping the genomic landscape of CRISPR-Cas9 cleavage.</a> Nat Methods. 14 (6), 600-606 (2017).</li><li>Wienert, B., Wyman, S. K., Yeh, C. D., Conklin, B. R., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+off-target+detection+with+DISCOVER-seq.">CRISPR off-target detection with DISCOVER-seq.</a> Nat Protoc. 15 (5), 1775-1799 (2020).</li><li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+effects+in+CRISPR/Cas9+gene+editing.">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, 1143157 (2023).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> CRISPR J. 5 (1), 123-130 (2022).</li><li>Lazzarotto, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+CRISPR-Cas9+genome-wide+nuclease+activities+with+CIRCLE-seq.">Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq.</a> Nat Protoc. 13 (11), 2615-2642 (2018).</li><li>Butterfield, K. T., McGrath, P. S., Han, C. M., Kogut, I., Bilousova, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+an+induced+pluripotent+stem+cell+line+with+the+constitutive+EGFP+reporter.">Generation of an induced pluripotent stem cell line with the constitutive EGFP reporter.</a> Methods Mol Biol. 2155, 11-21 (2020).</li><li>Hayashi, H., Kubo, Y., Izumida, M., Matsuyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+viral+delivery+of+Cas9+into+human+safe+harbor.">Efficient viral delivery of Cas9 into human safe harbor.</a> Sci Rep. 10 (1), 21474 (2020).</li><li>Kogut, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+RNA-based+reprogramming+of+human+primary+fibroblasts.">High-efficiency RNA-based reprogramming of human primary fibroblasts.</a> Nat Commun. 9 (1), 745 (2018).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+The+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Bao, X. R., Pan, Y., Lee, C. M., Davis, T. H., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+experimental+and+computational+analyses+of+off-target+editing+by+programmable+nucleases.">Tools for experimental and computational analyses of off-target editing by programmable nucleases.</a> Nat Protoc. 16 (1), 10-26 (2021).</li><li>Cromer, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+CRISPR+off-target+discovery+tools+following+ex+vivo+editing+of+CD34(+)+hematopoietic+stem+and+progenitor+cells.">Comparative analysis of CRISPR off-target discovery tools following ex vivo editing of CD34(+) hematopoietic stem and progenitor cells.</a> Mol Ther. 31 (4), 1074-1087 (2023).</li></ol>

The authors have nothing to disclose.

Here, CIRCLE-seq is demonstrated to be an unbiased and highly sensitive technique for identifying nuclease-induced DSBs across the genome resulting from targeting the AAVS1 locus in gDNA derived from iPSCs. The AAVS1 site within iPSCs is well-known as a safe harbor locus that is often used as an integration site of exogenous genes using CRISPR-Cas928. Our recent report studied the potential of EGFP-labeled iPSCs by performing CRISPR-mediated integration of a constitutively expressed EGFP reporter into the AAVS1 site, which enables labeling and tracking of both iPSCs and differentiated iPSCs due to the persistence of EGFP throughout the cell&#39;s lineage27. This iPSC line can be used in vivo to evaluate the organismal distribution of iPSC-derived cells after transplantation. As this cell line has been CRISPR-modified and is also being used to test the clinical application of iPSCs, it is imperative that the potential AAVS1 off-target sites are known and interrogated to ensure safety and efficacy, making it an ideal locus to test CIRCLE-seq.
A notable difference between Butterfield et al., previously published&#160;study27 and this one was the use of a modified gRNA to target the AAVS1 locus. A gRNA can be designed to improve genome editing accuracy24. The guide sequence is the most critical factor that influences on- and off-target efficiencies. Therefore, the chosen gRNA was tested against several other guides and found to have superior fidelity. In addition, a methods article on reprogramming human fibroblasts substantiated the finding that synthetic capped mRNAs containing modified nucleobases benefit from low activation of antiviral responses29,30. While low immunogenicity might not be relevant in an in vitro assay, it becomes crucial when the ultimate goal is to develop a clinically relevant therapy that can be used in living cells.
CIRCLE-seq holds many advantages over similar methods. For instance, Digenome-seq sequences both nuclease-cleaved and uncleaved gDNA, using ~400 million reads21. This results in a high background, making it challenging to filter out low-frequency bona fide cut sites. CIRCLE-seq only uses ~3-5 million reads due to the enrichment of nuclease-cleaved gDNA, resulting in low background. Additionally, Digenome-seq and a similar method, SITE-seq, rely on sequencing a single nuclease-cleaved DNA end. In contrast, CIRCLE-seq reads include both ends of the cut site, enabling the identification of off-target sites without the need for a reference21,22,26.
An advantage of CIRCLE-seq is its greater sensitivity compared to the methods that rely on cell culture, such as GUIDE-seq. When the two methods were compared, CIRCLE-seq was able to capture all off-target sites detected by GUIDE-seq and uncovered additional unintended cleavage sites that GUIDE-seq had missed. However, a notable difference is that GUIDE-seq may be hindered by the epigenetic landscape, whereas CIRCLE-seq can access the entire genome.
As an in vitro assay, CIRCLE-seq presents several limitations, the first of which is the detection of false positives. Whereas epigenetics will impede nuclease activity at certain sites in vivo, ultrasonication removes these obstacles in vitro, allowing off-target activity at locations that may not normally be accessible in a cellular context. Furthermore, Cas9 is present at high concentrations in this in vitro assay, permitting cleavage that would not otherwise be possible in vivo. This assay also requires a relatively large amount of starting gDNA, which, depending on available resources, can negate the use of this protocol. Lastly, it is possible for some off-target sites to be undetectable due to the limitations of current next-gen sequencing technologies.
A recent study used an in silico approach whose algorithm identified a number of relevant parameters with which to compare different nuclease characterization methods, including CIRCLE-seq and GUIDE-seq31. Two of the relevant parameters were &#39;cut-site enrichment&#39; and &#39;% false positives&#39;. Interestingly, CIRCLE-seq&#39;s false-positive rate was calculated at 88%, but its cut-site enrichment was folds higher than the other in vitro methods. Comparative analyses of every method revealed that GUIDE-seq was the best performer, as it demonstrated the greatest on-target specificity with only a moderate false-positive rate32. This does not invalidate CIRCLE-seq, but rather hints at the possibility of utilizing CIRCLE-seq and GUIDE-seq in tandem, validating CIRCLE-seq&#39;s findings with GUIDE-seq since the former has higher sensitivity, while the latter is a cell-based method with high cut-site enrichment. Data also indicate that amplicon-based next-generation sequencing (NGS) should be the preferred method for identifying genuine off-target modifications at potential candidate sites31. This data suggests a potential strategy of using CIRCLE-seq, followed by GUIDE-seq, and then amplicon-based NGS to examine off-target effects.

Genome engineering has seen significant advancements over the past twenty years, with a major milestone being the discovery of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in 20121. Leveraging the programmable nature of bacterial DNA endonucleases, CRISPR-Cas9 technology enables precise targeting and modification of almost any DNA sequence. Since its inception, the system has been optimized to rely only on the Cas9 endonuclease and a guide RNA (gRNA) to edit specific genomic regions. CRISPR-Cas9&#39;s potential as a curative therapy has been demonstrated in clinical trials for various conditions such as Leber&#39;s congenital amaurosis, transthyretin amyloidosis, and sickle cell anemia, among others2,3,4.
CRISPR-Cas9 induces double-stranded breaks (DSBs), which are typically resolved by one of two mechanisms: the error-prone non-homologous end joining (NHEJ) or the more precise homology-directed repair (HDR), provided a template DNA is available. The tendency of CRISPR-Cas9 to cause NHEJ-associated insertions and deletions (indels), along with cleavage at unintended genomic sites, limits its application in clinical settings5,6,7,8,9,10. Additionally, unintended genomic modifications can create cryptic splice sites, nonsense or missense mutations, induce chromothripsis, or confer oncogenic potential to cells-outcomes that have been observed in several genome editing trials11,12,13,14,15. In conclusion, accurately identifying the off-target activity of CRISPR-Cas9 is crucial for its clinical applications, particularly in systemic gene therapies that may alter billions of cells.
Various methods can be employed to identify CRISPR-Cas9 off-target cleavage sites, including Genome-wide Unbiased Identification of Double-stranded breaks (GUIDE)-seq16, which uses double-stranded oligodeoxynucleotides to tag DSBs in living cells. Nevertheless, a criticism of this method is that false positives can arise from random DSBs or from PCR artifacts, which must be discarded by excluding captured sites that show poor similarity to the on-target sites. The method based on the use of Integrase-Defective Lentiviral Vector (IDLV) is less sensitive and likely to miss many off-target sites17. Other in situ methods like DSBCapture, BLESS, and BLISS18,19,20 involve fixed cells and label DSBs directly, however they are constrained by their dependency on immediate DSB capture and the absence of exogenous DNA. Digenome-seq21, an in vitro method, and Selective enrichment and Identification of Tagged genomic DNA Ends by sequencing (SITE-seq)22 both provide sequencing solutions but have their limitations in background noise and single-end analysis, respectively. Discovery of in situ Cas off-targets and verification by sequencing (Discover-Seq)23 offers in vivo and in situ identification of Cas9 activity via MRE11 binding, but only detects DSBs that exist at the time of sample preparation24. Lastly, Inference of CRISPR Edits (ICE) uses a bioinformatics approach to robustly analyze CRISPR edits using Sanger data25.
This article describes a detailed procedure for Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq): an in vitro&#160;technique that sensitively and impartially maps the genome-wide off-target activity of Cas9 nuclease in a complex with the gRNA of interest26. This approach begins with culturing the cells of interest and isolating DNA, followed by random shearing through focused ultrasonication, then exonuclease and ligase treatment. This process ultimately produces circular double-stranded DNA molecules, which are then purified through plasmid-safe DNase treatment. This circular DNA is then exposed to the Cas9-gRNA complex, which cleaves at both intended and unintended cleavage sites, leaving behind exposed DNA ends that act as substrates for Illumina adapter ligation. This process produces a diverse library of genomic DNA (gDNA) containing both ends of each nuclease-induced DSB, ensuring that each read has all the information necessary for each cleavage site. This allows for the use of Illumina sequencing with lower sequencing coverage requirements, setting CIRCLE-seq apart from other similar methods mentioned above. It is important to note that while CIRCLE-seq does have higher off-target sensitivity than other protocols as an in vitro method, this comes at the cost of higher false-positives due to the absence of the epigenetic landscape that is present in other methods such as GUIDE-seq16. Additionally, DSB DNA repair and its associated machinery are not present in CIRCLE-seq, abrogating indels or proper repair that would otherwise be observed.
In addition to describing the step-by-step protocol to perform CIRCLE-seq, the protocol is validated by identifying genome-wide unintended cleavage sites of CRISPR-Cas9 that occur during the modification of the AAVS1 locus, as an example. This easy-to-follow protocol provides detailed instructions, from the culture of induced pluripotent stem cells (iPSCs) and gDNA isolation to gDNA circularization, Cas9-gRNA cleavage, library preparation, sequencing, and pipeline analysis. Given the low sequencing coverage requirements, CIRCLE-seq is available to any lab with access to next-generation sequencing.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.2-mL Thin-walled Tubes and Flat Caps</td>
			<td>ThermoFisher Scientific</td>
			<td>AB1114</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5% PippinHT cassette</td>
			<td>Sage Science</td>
			<td>HTC1510</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL Serological Pipettes&#160;</td>
			<td>FisherScientific</td>
			<td>12567603</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL Conical Tube</td>
			<td>FisherScientific</td>
			<td>339651</td>
			<td></td>
		</tr>
		<tr>
			<td>150 x 25 mm Tissue Culture Dish&#160;</td>
			<td>FisherScientific</td>
			<td>877224</td>
			<td></td>
		</tr>
		<tr>
			<td>25 mL Reagent Reservoir&#160;</td>
			<td>FisherScientific</td>
			<td>2138127C</td>
			<td></td>
		</tr>
		<tr>
			<td>2x Kapa KiFi HotStart Ready Mix&#160;</td>
			<td>Kapa Biosystems</td>
			<td>KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Serological Pipettes&#160;</td>
			<td>FisherScientific</td>
			<td>170355</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL Conical Tube</td>
			<td>FisherScientific</td>
			<td>339653</td>
			<td></td>
		</tr>
		<tr>
			<td>50x TAE Electrophoresis Buffer&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>B49</td>
			<td></td>
		</tr>
		<tr>
			<td>6 Well Cell Culture Plate</td>
			<td>Corning</td>
			<td>3516</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP Reagent, 60 mL</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Benchtop Microcentrifuge&#160;</td>
			<td>Eppendorf</td>
			<td>5400002</td>
			<td></td>
		</tr>
		<tr>
			<td>BsaI-HF&#160;</td>
			<td>New England BioLabs</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Buffer QX1</td>
			<td>Qiagen</td>
			<td>20912</td>
			<td></td>
		</tr>
		<tr>
			<td>Cas9 nuclease, Streptococcus Pyogenes&#160;</td>
			<td>New England BioLabs</td>
			<td>M0386M</td>
			<td></td>
		</tr>
		<tr>
			<td>CIRCLE-seq Library Preparation and NGS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Matrigel hESC-Qualified Matrix</td>
			<td>Corning</td>
			<td>354277</td>
			<td>Extracellular matrix (ECM) for culturing iPSCs</td>
		</tr>
		<tr>
			<td>ddPCR SuperMix for Probes&#160;</td>
			<td>Bio-Rad</td>
			<td>1863010</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Cartridge Holder&#160;</td>
			<td>Bio-Rad</td>
			<td>1863051</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Cartridges&#160;</td>
			<td>Bio-Rad</td>
			<td>1864008</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Gaskets&#160;</td>
			<td>Bio-Rad</td>
			<td>1863009</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, no calcium, no magnesium</td>
			<td>ThermoFisher Scientific</td>
			<td>14190144</td>
			<td>Made by Invitrogen</td>
		</tr>
		<tr>
			<td>Droplet Generation Oil for Probes&#160;</td>
			<td>Bio-Rad</td>
			<td>1863005</td>
			<td></td>
		</tr>
		<tr>
			<td>Droplet Reader Oil&#160;</td>
			<td>Bio-Rad</td>
			<td>1863004</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M)</td>
			<td>ThermoFisher Scientific</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M), pH 8.0, RNase-free</td>
			<td>ThermoFisher Scientific</td>
			<td>AM9260G</td>
			<td>Made by Invitrogen</td>
		</tr>
		<tr>
			<td>Eppendorf&#160; ThermoMixer&#160;</td>
			<td>Eppendorf</td>
			<td>5384000020</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethyl Alcohol, Pure</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td></td>
		</tr>
		<tr>
			<td>Exonuclease I&#160;</td>
			<td>New England BioLabs</td>
			<td>M0293L</td>
			<td>E. coli</td>
		</tr>
		<tr>
			<td>Filter Unit&#160;</td>
			<td>FisherScientific</td>
			<td>FB0875713</td>
			<td></td>
		</tr>
		<tr>
			<td>Filtered Sterile Pipette Tips</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Focused Ultrasonicator&#160;</td>
			<td>Covaris</td>
			<td>ME220</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA Isolation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA Shearing</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gentra Puregene Cell Core Kit&#160;</td>
			<td>Qiagen</td>
			<td>158043</td>
			<td></td>
		</tr>
		<tr>
			<td>gRNAs</td>
			<td>Synthego</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HCl</td>
			<td>ThermoFisher Scientific</td>
			<td>A144500</td>
			<td></td>
		</tr>
		<tr>
			<td>Heracell VIOS Tri-gas Humidified Tissue Culture Incubator</td>
			<td>ThermoFisher Scientific</td>
			<td>51030411</td>
			<td>Need for culturing and expanding iPSCs (37 &#176;C/5% CO2/5% O2)</td>
		</tr>
		<tr>
			<td>High Sensitivity D1000 DNA ScreenTape</td>
			<td>Agilent</td>
			<td>5067-5584</td>
			<td></td>
		</tr>
		<tr>
			<td>High Sensitivity D1000 Reagents</td>
			<td>Agilent</td>
			<td>5067-5585</td>
			<td></td>
		</tr>
		<tr>
			<td>HTP Library Preparation Kit&#160;</td>
			<td>Kapa Biosystems</td>
			<td>KK8235</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Antibiotic Antimycotic Solution</td>
			<td>Cytiva</td>
			<td>SV30079.01</td>
			<td></td>
		</tr>
		<tr>
			<td>IDTE pH 8.0 (1x TE Solution)</td>
			<td>Integrated DNA Technologies</td>
			<td>11050204</td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted Microscope</td>
			<td></td>
			<td></td>
			<td>Need for imaging iPS colonies in bright-field and fluorescent channels</td>
		</tr>
		<tr>
			<td>iPSC Culture</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropanol</td>
			<td>Sigma-Aldrich</td>
			<td>190764</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease&#160;</td>
			<td>New England BioLabs</td>
			<td>M0262L</td>
			<td></td>
		</tr>
		<tr>
			<td>Loading Tips, 10 pack</td>
			<td>Agilent</td>
			<td>5067-5599</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnum FLX Enhanced Universal Magnet Plate&#160;</td>
			<td>Alpaqua</td>
			<td>A00400</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge Tube</td>
			<td>Axygen</td>
			<td>31104051</td>
			<td></td>
		</tr>
		<tr>
			<td>Microtube AFA Fiber Pre-Slit Snap-Cap&#160;</td>
			<td>Covaris</td>
			<td>520045</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR-1 5x Supplement</td>
			<td>StemCell Technology</td>
			<td>85852</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR-1 Basal Medium (400 mL)</td>
			<td>StemCell Technology</td>
			<td>85851</td>
			<td>Media for maintaining iPSC in culture</td>
		</tr>
		<tr>
			<td>Nanodrop 8000 Spectrophotometer&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>ND-8000-GL</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBNext Multiplex Oligos for Illumina&#160;</td>
			<td>New England BioLabs</td>
			<td>E7600S</td>
			<td>Dual Index Primers Set 1</td>
		</tr>
		<tr>
			<td>Optical tube strip caps, 8x strip</td>
			<td>Agilent</td>
			<td>401425</td>
			<td></td>
		</tr>
		<tr>
			<td>Optical tube strips, 8x strip</td>
			<td>Agilent</td>
			<td>401428</td>
			<td></td>
		</tr>
		<tr>
			<td>Other Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Plate Sealer&#160;</td>
			<td>Bio-Rad</td>
			<td>PX1</td>
			<td>Model Number PX1</td>
		</tr>
		<tr>
			<td>PEG/NaCl SPRI Solution&#160;</td>
			<td>Kapa Biosystems</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion Hot Start Flex 2x Master Mix&#160;</td>
			<td>New England BioLabs</td>
			<td>M0536L</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierceable Foil Heat Seal&#160;</td>
			<td>Bio-Rad</td>
			<td>1814040</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid-Safe ATP-dependent DNase&#160;</td>
			<td>Epicentre</td>
			<td>E3110K</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers, Adapters and Probes</td>
			<td>IDT</td>
			<td></td>
			<td>Sequences are listed in Table 1</td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Qiagen</td>
			<td>19131</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit&#160;</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAxcel Gel Analysis System&#160;</td>
			<td>Qiagen</td>
			<td>9001941</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>ThermoFisher Scientific</td>
			<td>Q32856</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>Q32853</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>Q32853</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>Q32854</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit Fluorometer&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 Droplet Digital PCR System</td>
			<td>Bio-Rad</td>
			<td>1864001</td>
			<td>Contain a QX200 droplet generator and a QX200 droplet reader</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Qiagen</td>
			<td>19101</td>
			<td></td>
		</tr>
		<tr>
			<td>Semi-skirted PCR Plate&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>14230244</td>
			<td></td>
		</tr>
		<tr>
			<td>SeqPlaque GTG Agarose&#160;</td>
			<td>Lonza</td>
			<td>50110</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Safe DNA Gel Stain&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202L</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase (PNK)</td>
			<td>New England BioLabs</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>T-75 Flasks&#160;</td>
			<td>FisherScientific</td>
			<td>7202000</td>
			<td></td>
		</tr>
		<tr>
			<td>Tapestation 4150</td>
			<td>Agilent</td>
			<td>G2992AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermocycler with programmable temperature-stepping functionality</td>
			<td>Bio-Rad C1000 Touch</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>ThermoFisher Scientific</td>
			<td>BP1521</td>
			<td></td>
		</tr>
		<tr>
			<td>Twin.tec PCR Plate&#160;</td>
			<td>Eppendorf</td>
			<td>E951020346</td>
			<td>96 wells, semi-skirted, green</td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water&#160;</td>
			<td>ThermoFisher Scientific</td>
			<td>10977015</td>
			<td></td>
		</tr>
		<tr>
			<td>USER Enzyme&#160;</td>
			<td>New England BioLabs</td>
			<td>M5505L</td>
			<td></td>
		</tr>
	</tbody>
</table>

circle-seq for interrogation of off-target gene editing

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of unintended cleavage sites of CRISPR-Cas9 through targeted sequencing of CRISPR-Cas9 cleaved DNA. The protocol involves circularizing genomic DNA (gDNA), which is subsequently treated with the Cas9 protein and a guide RNA (gRNA) of interest. Following treatment, the cleaved DNA is purified and prepared as a library for Illumina sequencing. The sequencing process generates paired-end reads, offering comprehensive data on each cleavage site. CIRCLE-seq provides several advantages over other in vitro methods, including minimal sequencing depth requirements, low background, and high enrichment for Cas9-cleaved gDNA. These advantages enhance sensitivity in identifying both intended and unintended cleavage events. This study provides a comprehensive, step-by-step procedure for examining the off-target activity of CRISPR-Cas9 using CIRCLE-seq. As an example, this protocol is validated by mapping genome-wide unintended cleavage sites of CRISPR-Cas9 during the modification of the AAVS1 locus. The entire CIRCLE-seq process can be completed in two weeks, allowing sufficient time for cell growth, DNA purification, library preparation, and Illumina sequencing. The input of sequencing data into the CIRCLE-seq pipeline facilitates streamlined interpretation and analysis of cleavage sites.

Here, CIRCLE-seq is utilized to investigate the nuclease-induced cleavage sites of Cas9 in a complex with the gRNA designed to target the adeno-associated virus integration site 1 (AAVS1) using DNA isolated from induced pluripotent stem cells (iPSCs). This gRNA was previously described in our publication27. Approximately 25 &#956;g of gDNA was isolated from iPSCs, sheared through focused ultrasonication, and size selected using AMPure XP bead purification to yield fragments of approx. 300 bps. From this 25 &#956;g of DNA, approx. 2-5 ng of DNA was successfully circularized for in vitro Cas9:gRNA cleavage. The entire procedure is depicted in Figure 1.
Following a CIRCLE-seq procedure and analysis using our computation workflow, a visualization of all detected on- and off-target cleavage sites is presented in Figure 2A. The CIRCLE-seq pipeline also provided &#39;merged reads&#39;, analyzed via R statistical software to yield a Manhattan plot showing the detected nuclease-induced cleavage sites mapped along each chromosome (Figure 2B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/67069/67069fig01.jpg" /> 
Figure 1: CIRCLE-seq workflow schematics. Major steps of the protocol are indicated. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67069/67069fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/67069/67069fig02.jpg" /> 
Figure 2: CIRCLE-seq visualization and Manhattan Plot. (A) Alignment of off-target sites against the intended target for the AAVS1 locus. The target sequence is displayed at the top, where off-targets are ranked by read count in descending order. Differences in the original target sequences are shown by colored nucleotides. A sample of the top unintended cleavage sites for the AAVS1 locus is shown. (B) Manhattan plot illustrating the detected unintended cleavage sites for the AAVS1 locus. Bar heights represent read counts for each chromosomal position. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/67069/67069fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence (5&#39;-3&#39;)</td>
			<td>Comments/Description</td>
		</tr>
		<tr>
			<td>AAVS1 Single guide RNA (sgRNA)</td>
			<td>GGGGCCACUAGGGACAGGAU</td>
			<td>For AAVS1 Locus&#39; Fluorescent Protein Knock-In</td>
		</tr>
		<tr>
			<td>AAVS1 Forward Primer</td>
			<td>GCTCTGGGCGGAGGAATATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>AAVS1 Reverse Primer</td>
			<td>ATTCCCAGGGCCGGTTAATG</td>
			<td>For gRNA in vitro cleavage test</td>
		</tr>
		<tr>
			<td>oSQT1288</td>
			<td>/5Phos/CGGTGGACCGATGATC /ideoxyU/ATCGGTCCACCGaT</td>
			<td>CIRCLE-seq hairpin adapter</td>
		</tr>
		<tr>
			<td>oSQT1274</td>
			<td>AATGATACGGCGACCACCGAG</td>
			<td>TruSeq F1</td>
		</tr>
		<tr>
			<td>oSQT1275</td>
			<td>CAAGCAGAAGACGGCATACGAGAT</td>
			<td>TruSeqF2</td>
		</tr>
		<tr>
			<td>oSQT1310</td>
			<td>/56-FAM/CCTACACGA/ZEN/CGCTCTTCCGATCT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
		<tr>
			<td>oSQT1311</td>
			<td>/5HEX/TCGGAAGAG/ZEN/CACACGTCTGAACT/3IABkFQ/</td>
			<td>TruSeq probe</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of gRNA and primers used for CIRCLE-seq analysis of AAVS1 locus.

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of ...

circle-seq-for-interrogation-of-off-target-gene-editing

Nanyang Technological University

Research

JoVE Journal

Genetics

382 Views.  University of Colorado School of Medicine, Anschutz Medical Campus. A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

Video: CIRCLE-Seq for Interrogation of Off-Target Gene Editing

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene function. Gene knockout has been used to study these gene functions in vivo. The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system is a powerful tool used to edit genomic DNA sequences to alter gene function. While the traditional approach has been to introduce CRISPR/Cas9 mRNA into the single cell embryos through microinjection, this can be a slow and inefficient process in catfish. Here, a detailed protocol for microinjection of channel catfish embryos with CRISPR/Cas9 protein is described. Briefly, eggs and sperm were collected and then artificial fertilization performed. Fertilized eggs were transferred to a Petri dish containing Holtfreter's solution. Injection volume was calibrated and then guide RNAs/Cas9 targeting the toll/interleukin 1 receptor domain-containing adapter molecule (TICAM 1) gene and rhamnose binding lectin (RBL) gene were microinjected into the yolk of one-cell embryos. The gene knockout was successful as indels were confirmed by DNA sequencing. The predicted protein sequence alterations due to these mutations included frameshift and truncated protein due to premature stop codons.

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

A simple and efficient microinjection protocol for gene editing in channel catfish embryos using the CRISPR/Cas9 system is presented. In this protocol, guide RNAs and Cas9 protein were microinjected into the yolk of one-cell embryos. This protocol has been validated by knocking out two channel catfish immune-related genes.

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing in C. albicans requires Cas9, guide RNA, and repair template. A plasmid expressing a yeast codon optimized Cas9 (CaCas9) has been generated. Guide sequences directly upstream from a PAM site (NGG) are cloned into the Cas9 expression vector. A repair template is then made by primer extension in vitro. Cotransformation of the repair template and vector into C. albicans leads to genome editing. Depending on the repair template used, the investigator can introduce nucleotide changes, insertions, or deletions. As C. albicans is a diploid, mutations are made in both alleles of a gene, provided that the A and B alleles do not harbor SNPs that interfere with guide targeting or repair template incorporation. Multimember gene families can be edited in parallel if suitable conserved sequences exist in all family members. The C. albicans CRISPR system described is flanked by FRT sites and encodes flippase. Upon induction of flippase, the antibiotic marker (CaCas9) and guide RNA are removed from the genome. This allows the investigator to perform subsequent edits to the genome. C. albicans CRISPR is a powerful fungal genetic engineering tool, and minor alterations to the described protocols permit the modification of other fungal species including C. glabrata, N. castellii, and S. cerevisiae.

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

Efficient genome engineering of Candida albicans is critical to understanding the pathogenesis and development of therapeutics. Here, we described a protocol to quickly and accurately edit the C. albicans genome using CRISPR. The protocol allows investigators to introduce a wide variety of genetic modifications including point mutations, insertions, and deletions.

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Using Sniper-Cas9 to Minimize Off-target Effects of CRISPR-Cas9 Without the Loss of On-target Activity Via Directed Evolution

The development of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) into therapeutic modalities requires the avoidance of its potentially deleterious off-target effects. Several methods have been devised to reduce such effects. Here, we present an Escherichia coli-based directed evolution method called Sniper-screen to obtain a Cas9 variant with optimized specificity and retained on-target activity, called Sniper-Cas9. Using Sniper-screen, positive and negative selection can be performed simultaneously. The screen can also be repeated with other single-guide RNA (sgRNA) sequences to enrich for the true positive hits. By using the CMV-PltetO1 dual promoter to express Cas9 variants, the performance of the pooled library can be quickly checked in mammalian cells. Methods to increase the specificity of Sniper-Cas9 are also described. First, the use of truncated sgRNAs has previously been shown to increase Cas9 specificity. Unlike other engineered Cas9s, Sniper-Cas9 retains a wild-type (WT) level of on-target activity when combined with truncated sgRNAs. Second, the delivery of Sniper-Cas9 in a ribonucleoprotein (RNP) format instead of a plasmid format is possible without affecting its on-target activity.

Here, we present a protocol to optimize CRISPR-Cas9 to achieve a higher specificity without the loss of on-target activity. We use a directed evolution approach called Sniper-screen to find a mutant Cas9 with the desired characteristics. Sniper-Cas9 is compatible with truncated single-guide RNAs and delivery in a ribonucleoprotein format, well-known strategies for achieving higher specificities.

The development of clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) into therapeutic modalities requires the ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...