This work was supported by a Discovery Grant from the Natural Science and Engineering Council of Canada to AK. The schematics used in the figures are created with BioRender.com.

1. Experimental preparation
<ol>
	<li>Purify the plasmid pUC18T-mini-Tn7T-LAC-Gm9 (insertion plasmid, Figure 2A) with the gene of interest. 
	NOTE: Here, the gene of interest is adeIJK. The final plasmid concentration should be &#8805;100 ng/&#181;L.</li>
	<li>Purify the helper plasmid (pTNS2)9 and the excision plasmid (pFLP2ab)6 (Figure 2B,C, respectively), ideally to a final plasmid DNA concentration of &#8805;100 ng/&#181;L.</li>
	<li>Prepare 50 mL of sterile ultrapure water and 25 mL of sterile LB (Lennox) broth (see Table of Materials).</li>
	<li>Prepare a minimum of 10 LB agar plates, each with the following additives: plain (no additives), gentamicin (Gm) at 50 &#181;g/mL, carbenicillin (Cb) at 200 &#181;g/mL (for selection via the ampicillin resistance gene), and 5% sucrose (see Table of Materials).</li>
	<li>Streak out the strain to be used for insertion on LB agar and incubate at 37 &#176;C for 16-18 h. Here, A. baumannii AB258 is used. 
	NOTE: This protocol must be performed in a sterile environment as much as possible by using a Bunsen burner at the bench or a biological safety cabinet. All consumables (pipette tips, inoculating loops, microfuge tubes, etc.) need to be sterile.</li>
</ol>
2. Culture preparation
<ol>
	<li>Inoculate a single colony of A. baumannii AB258 into 4 mL of LB broth in a sterile 13 mL culture tube using a sterile inoculation loop or sterile wooden inoculating stick. 
	NOTE: A single 4 mL culture is used for one sample and one control. Increase the number of cultures depending on the number of samples needed.</li>
	<li>Incubate overnight at 37 &#176;C with shaking (250 rpm).</li>
	<li>Place a bottle of sterile distilled water (25-50 mL) at 4 &#176;C overnight for use in step 3.</li>
</ol>
3. Preparation of electrocompetent cells
<ol>
	<li>Place all sterile 1.5 mL microfuge tubes (two per culture) and sterile electroporation cuvettes (two per culture) on ice (see Table of Materials). Keep the samples on ice as much as possible throughout the procedure.</li>
	<li>Place the bottle of sterile water that was stored at 4 &#176;C on ice.</li>
	<li>Transfer 1.5 mL of the overnight bacterial culture into one of the 1.5 mL microfuge tubes.</li>
	<li>Centrifuge at 13,000 x g for 2 min to pellet the cells. 
	NOTE: Centrifugation would ideally be performed at 4 &#176;C, but ambient temperature centrifugation is acceptable and not detrimental.</li>
	<li>Using a 1 mL pipette, remove all of the supernatant without disturbing the cell pellet.</li>
	<li>Add another 1.5 mL of bacterial culture into the same microfuge tube. Centrifuge at 13,000 x g for 2 min, then remove all of the supernatant.</li>
	<li>Repeat step 3.6 one final time with the remaining 1 mL of culture.</li>
	<li>Add 1 mL of ice-cold sterile water to the cell pellet and resuspend with gentle pipetting until the pellet no longer sits at the bottom of the microfuge tube.</li>
	<li>Centrifuge the resuspended cells at 13,000 x g for 2 min.</li>
	<li>Carefully remove the supernatant using a 1 mL pipette. Do not pour off the supernatant, especially in the subsequent wash steps when the cells tend to form less compact pellets.</li>
	<li>Repeat this wash step with ice-cold sterile water, steps 3.8 to step 3.10, twice more.</li>
	<li>Gently resuspend the final cell pellet in 200 &#181;L of ice-cold sterile water.</li>
	<li>Transfer 100 &#181;L of the final cell suspension into the second ice-cold 1.5 mL microfuge tube. This second aliquot will become the negative control for electroporation. Keep the cell samples on ice.</li>
</ol>
4. Electroporation
<ol>
	<li>Pre-warm 1 mL of LB broth and one LB + Gm50 agar plate (prepared in step 1.4) for each sample and control in a static incubator set to 37 &#176;C.</li>
	<li>In a combined volume of 5 &#181;L or less, add 100-200 ng each of the pTNS2 helper plasmid and the pUC18T-mini-Tn7T-LAC-Gm-adeIJK insertion plasmid to an aliquot of electrocompetent cells.</li>
	<li>Mix with gentle fingertip tapping to ensure complete mixing of the plasmids with the electrocompetent cells without introducing bubbles.</li>
	<li>Add an equivalent volume of sterile distilled water into the negative control cell aliquot and mix gently as above.</li>
	<li>Incubate the samples on ice for 20 min.</li>
	<li>Transfer the entire cell sample into an ice-cold electroporation cuvette, then place the cuvette back on ice. Repeat for the negative control cell sample.</li>
	<li>Electroporate the cell sample.
	<ol>
		<li>Turn on the electroporator and set it to 2.0 kV (25 &#181;F, 200 &#937;) (see Table of Materials).</li>
		<li>Wipe the surface of the cuvette with a soft tissue to remove any adhering ice or moisture.</li>
		<li>Insert the cuvette into the electroporator and deliver the electric shock.</li>
		<li>Immediately add 0.9 mL of pre-warmed LB broth to the cells in the cuvette and gently pipette up and down to mix the cells with the media.</li>
		<li>Transfer the entire cell suspension into a new 1.5 mL microfuge tube (room temperature).</li>
		<li>Check the time constant value on the electroporator; for best results, this value should be between 4 and 6.</li>
	</ol>
	</li>
	<li>Repeat the electroporation procedure (steps 4.7.1 to step 4.7.6) for the negative control cell sample.</li>
	<li>Incubate the electroporated samples at 37 &#176;C for 1 h at 250 rpm to allow for cell recovery.</li>
	<li>Using an inoculation spreader, spread 100 &#181;L of each electroporated cell sample onto a pre-warmed LB + Gm50 agar plate.
	<ol>
		<li>Centrifuge the remaining samples at 13,000 x g for 2 min to pellet the cells.</li>
		<li>After removing all of the supernatant using a pipette, resuspend the cells in 100 &#181;L of LB broth.</li>
		<li>Spread each entire sample onto individual pre-warmed LB + Gm50 agar plates. 
		NOTE: Electroporation efficiency can be strain-dependent. When electroporating a strain for the first time, it can be informative to plate out different volumes, or even dilutions, of the electroporation sample to ensure the resulting plates have isolated colonies.</li>
	</ol>
	</li>
	<li>Incubate the plates at 37 &#176;C for 16-18 h.</li>
</ol>
5. Selecting transformed colonies for PCR-based screening
<ol>
	<li>Check the electroporation plates. The negative control should have no colonies; the sample should have distinct colonies. 
	NOTE: Plates with colonies, at this step and at all subsequent steps where agar plates with colonies or patches are produced, can be stored at 4 &#176;C for up to 3 days before proceeding.</li>
	<li>Using sterile toothpicks, pick up to 10 single colonies from the LB + Gm50 agar plates and patch them onto a fresh LB + Gm50 agar plate.</li>
	<li>Incubate the plates at 37 &#176;C for 16-18 h.</li>
</ol>
6. Verifying chromosomal insertion by colony PCR
<ol>
	<li>Remove the LB + Gm50 agar plates containing the patched colonies from the incubator.</li>
	<li>Using a sterile toothpick or sterile pipette tip, remove a small portion (about the size of a large colony) from a patch into 20 &#181;L of sterile distilled water in a 0.2 mL PCR tube; mix well. The water sample should become visibly cloudy as the cells are released from the toothpick. Prepare any number of samples that need to be screened, but 6 should be sufficient.</li>
	<li>Incubate the PCR tube containing the bacterial suspension at 100 &#176;C for 5-10 min.</li>
	<li>Using a mini-centrifuge (see Table of Materials), spin the sample at the fixed maximum speed for 2 min to pellet cellular debris.</li>
	<li>Transfer the supernatant to a new 0.2 mL PCR tube and place it on ice. This sample contains the template DNA for the PCR reaction. 
	NOTE: This template DNA can be stored at -20 &#176;C before proceeding with PCR.</li>
	<li>Prepare a PCR reaction mixture containing 1x polymerase buffer, 200 &#181;M dNTPs, 0.18 &#181;M ABglmS2_F_New forward primer, 0.18 &#181;M Tn7R reverse primer (Table 1), 1 U of Taq DNA polymerase, and 1 &#181;L of the prepared template DNA in a total volume of 25 &#181;L. Prepare a no-template control (NTC), including all but the template DNA (see Table of Materials).</li>
	<li>Enter the reaction conditions into a thermal cycler: 95 &#176;C for 2 min; 95 &#176;C for 30 s, 49 &#176;C for 30 s, and 72 &#176;C for 30 s for a total of 35 cycles; 72 &#176;C for 10 min; 12 &#176;C hold. Run the samples.</li>
	<li>Following the addition of DNA loading dye to a final concentration of 1x, load 10 &#181;L of each PCR reaction on a 2% agarose gel and run at 80 V for 40 min. The expected amplicon size for this primer pair is 382 bp. The NTC should have no bands.</li>
	<li>Identify the samples that produced the expected PCR product. Prepare a streak plate on LB + Gm50 agar plates from any of the PCR-positive patches; incubate at 37 &#176;C for 16-18 h. The goal is to generate a plate with single colonies for the preparation of a glycerol stock to preserve this marked strain and as a starting point for creating an unmarked strain (described below).</li>
</ol>
7. Removal of the GmR marker using pFLP2ab
<ol>
	<li>Follow the procedure mentioned in step 2: Culture preparation. The sample used to prepare the overnight culture is a single colony from the LB + Gm50 agar plates prepared to generate discrete colonies in step 6.9.</li>
	<li>Follow the procedure mentioned in step 3: Preparation of&#160;electrocompetent cells. Prepare the cells from the overnight culture for electroporation.</li>
	<li>Follow the procedure mentioned in step 4: Electroporation. Here, the plasmid to introduce to the cells is pFLP2ab (100-200 ng), which will remove the gentamicin resistance gene, flanking the chromosomally inserted gene of interest.</li>
	<li>After the cells have recovered for 1 h (step 4.9), spread 100 &#181;L of the electroporated cell sample onto a pre-warmed LB + Cb200 agar plate (prepared in step 1.4). This selective pressure ensures that only cells harboring the pFLP2ab excision plasmid will grow.</li>
	<li>Incubate the plates at 37 &#176;C for 16-18 h.</li>
	<li>Check the plate for colonies. The negative control plate should have no colonies; the LB + Cb200 agar sample plate should have distinct colonies.</li>
	<li>Using sterile toothpicks, cross-patch up to 20 isolated colonies onto an LB + Cb200 agar plate and an LB + Gm50 agar plate.</li>
	<li>Incubate the plates for 16-18 h at 37 &#176;C.</li>
	<li>Check the plates for patches. Clones that grow on the LB + Cb200 agar plate but not the LB + Gm50 agar plate have had the gentamicin resistance gene removed from the original insert.</li>
	<li>Select the patches that are carbenicillin resistant and gentamicin susceptible for streaking onto individual LB agar plates supplemented with 5% (w/v) sucrose, which forces the expulsion of the pFLP2ab plasmid from the bacteria. Choose up to 10 colonies.</li>
	<li>Incubate the plates for 16-18 h at 37 &#176;C.</li>
	<li>Check the plates for colonies.</li>
	<li>As a final confirmation of pFLP2ab plasmid loss, cross-patch 4-6 isolated colonies from the 5% sucrose plates onto an LB + Cb200 agar plate and an LB agar plate.</li>
	<li>Incubate the plates for 16-18 h at 37 &#176;C.</li>
	<li>Choose a clone that is growing on the LB agar plate, and that is carbenicillin sensitive for the preparation of a glycerol stock to preserve this unmarked strain.
	<ol>
		<li>Genetic verification of the unmarked strain can be performed with colony PCR (step 6: Verifying chromosomal insertion by colony PCR) using the primers that target the gentamicin resistance gene.</li>
		<li>Prepare a PCR reaction mixture containing 1x polymerase buffer, 200 &#181;M dNTPs, 0.18 &#181;M Gm_F forward primer, 0.18 &#181;M Gm_R reverse primer (Table 1), 1 U of Taq DNA polymerase, and 1 &#181;L of the prepared template DNA in a total volume of 25 &#181;L. Prepare a no-template control (NTC) including all but the template DNA, and a positive control using DNA from the marked strain.</li>
		<li>Enter the reaction conditions into a thermal cycler: 95 &#176;C for 2 min; 95 &#176;C for 30 s, 50 &#176;C for 30 s, and 72 &#176;C for 40 s for a total of 35 cycles; 72 &#176;C for 10 min; 12 &#176;C hold. Run the samples.</li>
		<li>Following the addition of DNA loading dye to a final concentration of 1x, load 10 &#181;L of each PCR reaction on a 1% agarose gel and run at 80 V for 40 min. The expected amplicon size for this primer pair is 525 bp. The positive control should have a single band; the samples and the NTC should have no bands.</li>
	</ol>
	</li>
</ol>

Single&#45;Copy Gene Expression for Characterizing Multidrug Efflux Systems

<ol>
	<li>Prioritization of pathogens to guide research, discovery, research and development of new antibiotics for drug-resistant bacterial infections, including tuberculosis. World Health Organization Available from: <a target="_blank" href="https://www.who.int/publications/i/item/WHO-EMP-IAU-2017.12">https://www.who.int/publications/i/item/WHO-EMP-IAU-2017.12</a> (2017)</li><li>Kornelsen, V., Kumar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+on+multidrug+resistance+efflux+pumps+in+Acinetobacter+spp.">Update on multidrug resistance efflux pumps in Acinetobacter spp.</a> Antimicrob Agents Chemother. 65 (7), e00514-00521 (2021).</li><li>Sykes, E. M., Deo, S., Kumar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+genetic+tools+for+Acinetobacter+baumannii.">Recent advances in genetic tools for Acinetobacter baumannii.</a> Front Genet. 11, 601380 (2020).</li><li>Kumar, A., Chua, K. L., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+regulated+expression+of+single-copy+efflux+pump+genes+in+a+surrogate+Pseudomonas+aeruginosa+strain:+identification+of+the+BpeEF-OprC+chloramphenicol+and+trimethoprim+efflux+pump+of+Burkholderia+pseudomallei+1026b.">Method for regulated expression of single-copy efflux pump genes in a surrogate Pseudomonas aeruginosa strain: identification of the BpeEF-OprC chloramphenicol and trimethoprim efflux pump of Burkholderia pseudomallei 1026b.</a> Antimicrob Agents Chemother. 50 (10), 3460-3463 (2006).</li><li>Kumar, A., Dalton, C., Cortez-Cordova, J., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tn7+vectors+as+genetic+tools+for+single+copy+gene+cloning+in+Acinetobacter+baumannii.">Mini-Tn7 vectors as genetic tools for single copy gene cloning in Acinetobacter baumannii.</a> J Microbiol Methods. 82 (3), 296-300 (2010).</li><li>Ducas-Mowchun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next+generation+of+Tn7-based+single-copy+insertion+elements+for+use+in+multi-+and+pan-drug+resistant+strains+of+Acinetobacter+baumannii.">Next generation of Tn7-based single-copy insertion elements for use in multi- and pan-drug resistant strains of Acinetobacter baumannii.</a> Appl Environ Microbiol. 85 (11), e00066-00119 (2019).</li><li>Ducas-Mowchun, K., De Silva, P. M., Patidar, R., Schweizer, H. P., Kumar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn7-based+single-copy+insertion+vectors+for+Acinetobacter+baumannii.">Tn7-based single-copy insertion vectors for Acinetobacter baumannii.</a> Methods Mol Biol. 1946, 135-150 (2019).</li><li>Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+the+Saccharomyces+cerevisiae+Flp-FRT+system+in+bacterial+genetics.">Applications of the Saccharomyces cerevisiae Flp-FRT system in bacterial genetics.</a> J Mol Microbiol Biotechnol. 5 (2), 67-77 (2003).</li><li>Choi, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Tn7-based+broad-range+bacterial+cloning+and+expression+system.">A Tn7-based broad-range bacterial cloning and expression system.</a> Nat Methods. 2 (6), 443-448 (2005).</li><li>Choi, K. H., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tn7+insertion+in+bacteria+with+single+attTn7+sites:+example+Pseudomonas+aeruginosa.">Mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa.</a> Nat Protoc. 1 (1), 153-161 (2006).</li><li>Kornelsen, V., Unger, M., Kumar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Atorvastatin+does+not+display+an+antimicrobial+activity+on+its+own+nor+potentiates+the+activity+of+other+antibiotics+against+Acinetobacter+baumannii+ATCC+17978+or+A.+baumannii+AB030.">Atorvastatin does not display an antimicrobial activity on its own nor potentiates the activity of other antibiotics against Acinetobacter baumannii ATCC 17978 or A. baumannii AB030.</a> Access Microbiol. 3, 000288 (2021).</li><li>Reyrat, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Counterselectable+markers:+untapped+tools+for+bacterial+genetics+and+pathogenesis.">Counterselectable markers: untapped tools for bacterial genetics and pathogenesis.</a> Infect Immun. 66 (9), 4011-4017 (1998).</li><li>Gay, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positive+selection+procedure+for+entrapment+of+insertion+sequence+elements+in+gram-negative+bacteria.">Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria.</a> J Bacteriol. 164, 918-921 (1985).</li><li>Kyriakidis, I., Vasileiou, E., Pana, Z. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tragiannidis,+Acinetobacter+baumannii+antibiotic+resistance+mechanisms.">Tragiannidis, Acinetobacter baumannii antibiotic resistance mechanisms.</a> Pathogens. 10 (3), 373 (2021).</li><li>Clinical and Laboratory Standards Institute. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+standards+for+antimicrobial+susceptibility+testing.">Performance standards for antimicrobial susceptibility testing.</a> CLSI Supplement M100., 31st edn. , (2021).</li><li>Dijkshoorn, L., Nemec, A., Seifert, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+increasing+threat+in+hospitals:+multidrug-resistant+Acinetobacter+baumannii.">An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii.</a> Nature Reviews Microbiology. 5, 939-951 (2007).</li><li>Yildirim, S., Thompson, M. G., Jacobs, A. C., Zurawski, D. V., Kirkup, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+parameters+for+high+efficiency+transformation+of+Acinetobacter+baumannii.">Evaluation of parameters for high efficiency transformation of Acinetobacter baumannii.</a> Sci Rep. 25 (6), 22110 (2016).</li><li>Thompson, M. G., Yildirim, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Acinetobacter+baumannii:+electroporation.">Transformation of Acinetobacter baumannii: electroporation.</a> Methods Mol Biol. 1946, 69-74 (2019).</li><li>Choi, K. H., DeShazer, D., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tn7+insertion+in+bacteria+with+multiple+glmS-linked+attTn7+sites:+example+Burkolderia+mallei+ATCC+2334.">Mini-Tn7 insertion in bacteria with multiple glmS-linked attTn7 sites: example Burkolderia mallei ATCC 2334.</a> Nat Protoc. 1 (1), 162-169 (2006).</li><li>Jittawuttipoka, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tn7+vectors+as+genetic+tools+for+gene+cloning+at+a+single+copy+number+in+an+industrially+important+and+phytopathogenic+bacteria,+Xanthomonas+spp.">Mini-Tn7 vectors as genetic tools for gene cloning at a single copy number in an industrially important and phytopathogenic bacteria, Xanthomonas spp.</a> FEMS Microbiol Lett. 298 (1), 111-117 (2009).</li><li>P&#233;rez-Varela, M., Tierney, A. R. P., Kim, J. S., V&#225;zquez-Torres, A., Rather, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+RelA+in+Acinetobacter+baumannii.">Characterization of RelA in Acinetobacter baumannii.</a> J Bacteriol. 202 (12), e00045 (2020).</li><li>Williams, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Acinetobacter+baumannii+copper+resistance+reveals+a+role+in+virulence.">Characterization of Acinetobacter baumannii copper resistance reveals a role in virulence.</a> Front Microbiol. 11, 16 (2020).</li></ol>

The authors have nothing to disclose.

Even though this procedure for the chromosomal insertion of an inducible single-copy gene expression system in A. baumannii is technically straightforward and not labor-intensive, there are a few important steps that need to be emphasized. First, preparation of the competent cells needs to be done on ice as much as possible as the cells become fragile during the replacement of the media with ice-cold water. Ideally, the centrifugation steps are performed at 4 &#176;C, but centrifugation at room temperature is acceptable. Given the increasing fragility of the cells during the water washes, gentle pipetting is also critical. Second, electroporation is sensitive to the presence of ions. Washing the cells with multiple rounds of pelleting and resuspending in water ensures the media is fully removed. Also, plasmids should be freshly purified and may be eluted in standard kit elution buffers (normally TE buffer) as long as the plasmid DNA concentration is high enough. We aim to add &lt;5 &#181;L of plasmid to 100 &#181;L of cell suspension to keep the ionic strength of the sample very low, although up to 10 &#181;L should be tolerated. Third, selective agar plates should be prepared as needed to ensure the efficacy of the added antibiotic. Note that carbenicillin was used instead of the usual ampicillin for selection during the transformation of the excision plasmid, pFLP2ab. A. baumannii is intrinsically resistant to aminopenicillins (ampicillin)16; substituting a carboxypenicillin (carbenicillin) allows for continued selection with the plasmid-encoded &#946;-lactamase. 
Optimization of the experimental protocol is more nuanced and will vary between different species of Acinetobacter (or even genetically manipulated strains within the same species) and possibly the particular reagents used in the lab. For example, the voltage used for electroporation can vary between 1.8 and 2.5 kV, and thermocycling conditions may need to be altered slightly depending on the DNA polymerase used for PCR. Helpful hints to consider if cells are growing poorly after electroporation include reducing the concentration of gentamicin in the agar plates from 50 &#181;g/mL to 30 &#181;g/mL and/or extending the incubation time of the agar plates to &#8805;24 h. Regarding the steps to remove the gentamicin cassette, better success may be had using LB agar plates with 10% sucrose and/or incubating them at 30 &#176;C for &#8805;24 h if carbenicillin resistance persists.
Numerous A. baumannii cell preparation methods for use with electroporation can be found in the literature, but they often include a subculturing step after the initial overnight culture and then a long growth phase to a prescribed optical density. We have found that a simple overnight culture can be used just as effectively. Electroporation of A. baumannii has been well described, and readers may gain further insight into this specific aspect of the protocol here17,18. The key advantages of this mini-Tn7 chromosomal gene complementation system compared with a plasmid-based complementation system are the ability to regulate the level of expression of the complemented gene through the IPTG-controllable lacIq repressor system and the choice to remove the gentamicin marker (aacC1 gene) via the flanking FRT sites. It was observed that the tolerance of the cells to the expression of efflux pumps can vary depending on the pump inserted. For example, cells are more sensitive to the expression of AdeIJK compared with AdeABC or AdeFGH; this can be addressed by modifying the concentration of IPTG in culture conditions. Removing the antibiotic marker reduces mutational risk to the strain due to constant selection pressure and also allows for unrestricted antibiotic susceptibility investigations3. 
This mini-Tn7 system has been used successfully with Pseudomonas9,10, Yersinia9, Burkholderia19, Xanthomonas20, and Acinetobacter5,6,21,22 species, however, some limitations exist. For example, in A. baumannii there is only one functional attTn7 insertion site in the genome5, so a strain can be created with multiple deletions, but only one gene at a time can be complemented. Also, this system has not yet been proven effective for Gram-positive bacteria10. 
RND efflux pumps are important facilitators of antibiotic resistance in A. baumannii. What makes them so powerful is their three-part structure that spans across the inner and outer membranes, allowing the removal of antibiotics from the periplasm to outside the cell. The most studied and ubiquitous RND pumps-designated AdeABC, AdeFGH, and AdeIJK-have been shown to eliminate antibiotics encompassing all classes. Elucidating efflux pump function in detail will provide a good starting point to design novel therapeutic options against multidrug-resistant strains. Using the AB258 triple RND pump deletion strain and complementing back one pump at a time allows for the study of each pump independent of the others, discerning for each their unique substrate profiles and most effective inhibitors. Of course, efflux pumps also have a "day-to-day" role in the normal function of the bacterium. Understanding those roles could lead to indirect crippling of the pumps, which would, in turn, interrupt antibiotic efflux, possibly making multidrug-resistant bacteria susceptible to commonly-used antibiotics once again. Generally, the mini-Tn7 system can be used to introduce any gene of interest for detailed study or helpful markers, for example, fluorescent proteins for microscopic imaging6. 
The increasing prevalence of multidrug resistant bacteria is a concern for us all. Understanding the protective mechanisms provided by efflux pumps in pathogens like A. baumannii is critical for combatting serious infections. This chromosomal single-copy gene expression system is a powerful tool for mechanistic studies as well as for identifying inhibitors to thwart efflux pump function.

Acinetobacter baumannii is a World Health Organization top priority pathogen due to its encompassing resistance to all classes of antibiotics1. It is an opportunistic pathogen mostly affecting hospitalized, injured, or immunocompromised people. A. baumannii largely evades antibiotics via efflux pumps, the most relevant being the Resistance-Nodulation-Division (RND) family of exporters2. Understanding how these efflux pumps work mechanistically will allow one to develop targeted therapeutic options.
One common way that cellular processes can be specifically distinguished is through genetic manipulation. However, the tools available for A. baumannii genetic studies are limited, and to further confound experimental design, clinical isolates often are resistant to the antibiotics routinely used for selection in genetic manipulations3. A second hurdle encountered when studying efflux pumps specifically is that they are strictly regulated-often by unknown factors-making it difficult to accurately isolate and attribute function to a single pump4. Seeing this need to expand the research toolbox, we developed a mini-Tn7-based, single-copy-insertion, inducible expression system that incorporates a Flp recombinase target (FRT) cassette, which allows for the removal of the selection marker5,6,7 (Figure 1). First created for Pseudomonas8,9,10, this elegant cloning and expression system was used to generate single-copy efflux pump complements into an RND efflux pump-deficient strain of A. baumannii (ATCC 17978::&#916;adeIJK,&#916;adeFGH,&#916;adeAB: hereafter referred to as A. baumannii AB258) that we generated11. Being able to study one efflux pump at a time and not overwhelm the bacterial cells with high-copy expression (as generally seen with plasmid-based expression systems), one can better learn about the critical, physiological aspects of each efflux pump with minimal interference and reduced complications.
This article describes how to use the mini-Tn7 system to complement a deleted gene of interest, RND efflux pump adeIJK, into the chromosome of A. baumannii AB258 through a series of uncomplicated steps performed over the course of 9 days7. The first set of steps re-introduces the deleted efflux pump genes cloned into the mini-Tn7-based insertion plasmid (Figure 2A) at the single attTn7 insertion site downstream of the well-conserved glmS gene (Figure 3A). This process is facilitated by a non-replicative helper plasmid (Figure 2B) that encodes for the transposase genes needed for Tn7-driven insertion. The second set of steps uses an excision plasmid (Figure 2C) for Flp recombinase-mediated removal of the gentamicin gene flanked by FRT sites (Figure 3B) to create an unmarked strain. Though this system is used to elucidate the essential roles and possible inhibitors of RND efflux pumps with respect to antibiotic resistance, it can be used to investigate any gene of interest.

<table><tbody><tr><td>0.2 mL PCR tube</td><td>VWR</td><td>20170-012</td><td>For colony boil preparations and PCR reactions</td></tr><tr><td>1.5 mL microfuge tubes</td><td>Sarstedt</td><td>72-690-301</td><td>General use</td></tr><tr><td>13-mL culture tubes, Pyrex</td><td>Fisher</td><td>14-957K</td><td>Liquid culture vessels</td></tr><tr><td>6x DNA loading buffer</td><td>Froggabio</td><td>LD010</td><td>Agarose gel electrophoresis sample loading dye</td></tr><tr><td>Acetic acid, glacial</td><td>Fisher</td><td>351271-212</td><td>Agarose gel running buffer component</td></tr><tr><td>Agar</td><td>Bioshop</td><td>AGR003</td><td>Solid growth media</td></tr><tr><td>Agarose</td><td>BioBasic</td><td>D0012</td><td>Electrophoretic separation of PCR reaction products; used at a concentration of 0.8&amp;ndash;2%</td></tr><tr><td>Agarose gel electrophoresis unit</td><td>Fisher</td><td>29-237-54</td><td>Agarose gel electrophoresis; separation of PCR reaction products</td></tr><tr><td>Carbenicillin</td><td>Fisher</td><td>50841231</td><td>Selective media</td></tr><tr><td>Culture tube closures</td><td>Fisher</td><td>13-684-138</td><td>Stainless steel closure for 13-mL culture tubes</td></tr><tr><td>Deoxynucleotide triphosphate (dNTP) set</td><td>Biobasic</td><td>DD0058</td><td>PCR reaction component; supplied as 100 mM each dATP, dCTP, dGTP, dTTP; mixed and diluted for 10 mM each dNTP</td></tr><tr><td>Dry bath/block heater</td><td>Fisher</td><td>88860023</td><td>Isotemp digital dry bath for boil preparations</td></tr><tr><td>Electroporation cuvettes</td><td>VWR</td><td>89047-208</td><td>2 mm electroporation cuvettes with round cap</td></tr><tr><td>Electroporator</td><td>Cole Parmer</td><td>940000009</td><td>110 VAC, 60 Hz electroporator</td></tr><tr><td>Ethidium bromide</td><td>Fisher</td><td>BP102-1</td><td>Visualization of PCR reaction products and DNA marker in agarose gel</td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>VWR</td><td>CA-EM4050</td><td>Agarose gel running buffer component</td></tr><tr><td>Gentamicin</td><td>Biobasic</td><td>GB0217</td><td>For the preparation of selective media</td></tr><tr><td>Glycerol</td><td>Fisher</td><td>G33</td><td>Preparation of bacterial stocks for long-term storage in an ultra-low freezer</td></tr><tr><td>Incubator (shaking)</td><td>New Brunswick Scientific</td><td>M1352-0000</td><td>Excella E24 Incubator Shaker for liquid culture growth</td></tr><tr><td>Incubator (static)</td><td>Fisher</td><td>11-690-550D</td><td>Isotemp Incubator Oven Model 550D for solid (LB agar) culture growth</td></tr><tr><td>Inoculation loop</td><td>Sarstedt</td><td>86.1562.050</td><td>Streaking colonies onto agar plates</td></tr><tr><td>Inoculation spreader</td><td>Sarstedt</td><td>86.1569.005</td><td>Spreading of culture onto agar plates</td></tr><tr><td>Lysogeny broth (LB) broth, Lennox</td><td>Fisher</td><td>BP1427</td><td>Liquid growth media (20 g/L: 5 g/L sodium chloride, 10 g/L tryptone, 5 g/L yeast extract)</td></tr><tr><td>Microfuge</td><td>Fisher</td><td>75002431</td><td>Sorvall Legend Micro 17 for centrifugation of samples</td></tr><tr><td>Mini-centrifuge</td><td>Fisher</td><td>S67601B</td><td>Centrifugation of 0.2 mL PCR tubes</td></tr><tr><td>Petri dishes</td><td>SPL Life Sciences</td><td>10090</td><td>For solid growth media (agar plates): 90 x 15 mm</td></tr><tr><td>Pipettes&amp;nbsp;</td><td>Mandel</td><td>Various</td><td>Gilson single channel pipettes (P10, P20, P200, P1000)</td></tr><tr><td>Power supply</td><td>Biorad</td><td>1645050</td><td>PowerPac Basic power supply for electrophoresis</td></tr><tr><td>Primers</td><td>IDT</td><td>NA</td><td>PCR reaction component; specific to gene of interest; prepared at 100 &amp;mu;M as directed on the product specification sheet</td></tr><tr><td>Sucrose</td><td>BioBasic</td><td>SB0498</td><td>For the preparation of counterselective media for removal of the pFLP2&lt;sup&gt;ab&lt;/sup&gt; plasmid from transformed A. baumannii</td></tr><tr><td>Taq DNA polymerase</td><td>FroggaBio</td><td>T-500</td><td>PCR reaction component; polymerase supplied with a 10x buffer</td></tr><tr><td>Thermal cycler</td><td>Biorad</td><td>1861096</td><td>Model T100 for PCR</td></tr><tr><td>Toothpicks</td><td>Fisher</td><td>S24559</td><td>For patching colonies onto agar plates</td></tr><tr><td>Trizma base</td><td>Sigma</td><td>T1503</td><td>Agarose gel running buffer component</td></tr><tr><td>Ultrapure water</td><td>Millipore Sigma</td><td>ZLXLSD51040</td><td>MilliQ water purification system: ultra pure water for media and solution preparation, and cell washing</td></tr><tr><td>Wide range DNA marker</td><td>Biobasic</td><td>M103R-2</td><td>Size determination of PCR products on an agarose gel</td></tr><tr><td>Wooden inoculating sticks</td><td>Fisher</td><td>29-801-02</td><td>Inoculating cultures with colonies from agar plates</td></tr></tbody></table>

characterizing multidrug efflux systems in acinetobacter baumannii using an efflux&#45;deficient bacterial strain and a single&#45;copy gene expression system

Acinetobacter baumannii is recognized as a challenging Gram-negative pathogen due to its widespread resistance to antibiotics. It is crucial to comprehend the mechanisms behind this resistance to design new and effective therapeutic options. Unfortunately, our ability to investigate these mechanisms in A. baumannii is hindered by the paucity of suitable genetic manipulation tools. Here, we describe methods for utilizing a chromosomal mini-Tn7-based system to achieve single-copy gene expression in an A. baumannii strain that lacks functional RND-type efflux mechanisms. Single-copy insertion and inducible efflux pump expression are quite advantageous, as the presence of RND efflux operons on high-copy number plasmids is often poorly tolerated by bacterial cells. Moreover, incorporating recombinant mini-Tn7 expression vectors into the chromosome of a surrogate A. baumannii host with increased efflux sensitivity helps circumvent interference from other efflux pumps. This system is valuable not only for investigating uncharacterized bacterial efflux pumps but also for assessing the effectiveness of potential inhibitors targeting these pumps.

The chromosomal insertion procedure takes only 2 h total across 3 days to see a result-colonies growing on a selective agar plate (Figure 1A-C). The expected number of colonies on the transformation plate is strain dependent: one may see 20-30 or even hundreds of colonies as insertion of Tn7 at attTn7 sites is specific and efficient9. Patching transformation plate colonies onto selective media (Figure 4A) preserves the transformed strain and provides starting material for colony PCR screening (Figure 1E and Figure 4B). Screening of colonies by PCR can be kept to a minimum-no more than 10 colonies should need to be processed, and most should yield a positive result for insertion. The PCR product for the screening primers, ABglmS2_F_New and Tn7R (Table 1), is 382 bp (Figure 4B lane 4); negative controls for the reaction include wild-type A. baumannii ATCC 17978 (Figure 4B lane 2), AB258 (Figure 4B lane 3), and no template (Figure 4B lane 5). Colonies that are PCR-positive represent complemented, marked strains.
Removal of the gentamicin resistance gene (unmarking) takes less than 3 h, spanning 6 days as cells transformed with the excision plasmid need to be chosen through selective plating, and then the excision plasmid needs to be cured from the bacteria (Figure 1F). Flp-FRT recombination-based excision is precise and effective and should result in &#8805;20 colonies on the transformation plate. Colonies that are cross-patched onto carbenicillin (selecting for &#946;-lactam resistance conferred by the excision plasmid) and gentamicin (looking for loss of gentamicin resistance) should all be carbenicillin-resistant and gentamicin-sensitive, respectively. The excision plasmid is forced out of the bacteria by growth on 5% sucrose agar plates. Growth on sucrose forces the cells to eliminate pFLP2ab as the sacB gene on the plasmid promotes the conversion of sucrose to levans, a polysaccharide toxic to the bacteria12,13. All colonies that grow on 5% sucrose media should then grow only on plain LB agar plates; there should be no growth on carbenicillin agar plates. Colonies growing on the plain LB agar plates represent unmarked strains. Confirming loss of the gentamicin marker can be achieved by colony PCR using the Gm_F and Gm_R primers (Table 1 and Figure 5). This primer pair yields an amplicon of 525 bp only in the positive control (the initially created marked strain, Figure 5 lane 4); wild-type ATCC 17978 (Figure 5 lane 2), AB258 (Figure 5 lane 3), any tested colony (Figure 5 lane 5), and the no-template control (Figure 5 lane 6) should not show amplification.
Once the unmarked strain is confirmed, functional testing can commence with phenotypic assays. Here, the obvious first choice is determining the minimum inhibitory concentration (MIC) of a range of antibiotics: ciprofloxacin is a known substrate of AdeIJK, tetracycline can be removed by AdeIJK (the major efflux pump is AdeAB), and kanamycin has a relatively minor effect on A. baumannii ATCC 179782,14. Using the broth micro-dilution method according to the CLSI guidelines15, the complemented unmarked strain AB258::adeIJK was challenged with each antibiotic in the absence and presence of 50 &#181;M IPTG; wild-type strain ATCC 17978 and RND efflux-deficient strain AB258 were included as controls (Table 2). Overall, the trend seen in the MIC values tells the expected story-decreased susceptibility of AB258::adeIJK to ciprofloxacin and tetracycline with induced expression of the efflux pump, verifying that the insertion of adeIJK was successful.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66471/66471fig01.jpg" /> 
Figure 1: Overview of the procedure. (A) An overnight culture of the A. baumannii strain to be complemented is prepared. (B) The cells from the overnight culture are washed with water 3 times via centrifugation and kept on ice. (C) The delivery and helper plasmids are added to the cells and incubated on ice for 20 min. The sample is electroporated, LB media is added, and the cells are allowed to recover for 1 h at 37 &#176;C. A 100 &#181;L aliquot of cells is spread onto LB + Gm50 agar plates and incubated at 37 &#176;C overnight. (D) Colonies from the transformation plate are patched onto an LB + Gm50 agar plate and grown overnight at 37 &#176;C. (E) Patched colonies are prepared for PCR to screen for the presence of an amplification product spanning the chromosomal insertion site. PCR amplification is visualized by agarose gel electrophoresis. PCR-positive samples represent successful insertion of the gene of interest into the chromosome and the creation of a marked strain. (F) A colony positive for gentamicin is prepared as in steps (A-C), with electroporation of the pLFP2ab plasmid to remove the gentamicin cassette from the chromosomal insertion. Selective plating on LB + Cb200 agar confirms uptake of the plasmid. Duplicate patching on LB + Cb200 and LB + Gm50 agar plates reveals colonies that are CbR and GmS confirming loss of the gentamicin cassette from the insertion. Growth of selected CbR colonies on 5% sucrose cures the pLFP2ab plasmid from the cells. Colonies from the 5% sucrose plate are patched onto LB + Cb200 agar and LB agar to reveal desired CbS and GmS colonies and confirm the creation of the unmarked strain. Gm50, gentamicin at 50 &#181;g/mL; Cb200, carbenicillin at 200 &#181;g/mL; R, resistant; S, sensitive. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66471/66471fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66471/66471fig02.jpg" /> 
Figure 2: Plasmids used in this protocol. General plasmid maps of (A) pUC18T-mini-Tn7T-LAC-Gm (insertion plasmid), (B) pTNS2 (helper plasmid), and (C) pFLP2ab (excision plasmid). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66471/66471fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66471/66471fig03.jpg" /> 
Figure 3: Schematic of insertion and unmarking. (A) Insertion. The single Tn7 insertion site in the A. baumannii chromosome is located 24 bp from the end of the glmS2 gene. Co-electroporation of the insertion plasmid and the helper plasmid allows for complementation of the gene of interest (inserted gene, purple) along with the rest of the insertion cassette (FRT sites for marker excision, yellow; accC1 gene for gentamicin resistance, green; lacIq gene for inducible expression, blue) into the chromosome. (B) Unmarking. Electroporation of the complemented, marked insertion strain with the pFLP2ab excision plasmid facilitates removal of the gentamicin resistance gene (accC1, green) via Flp-FRT recombination (FRT sites, yellow), creating an unmarked strain. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66471/66471fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/66471/66471fig04.jpg" /> 
Figure 4: Transformation, patching, and insertion confirmation by colony PCR. Representative result of (A) the growth of transformation colonies after patching, and (B) colony PCR amplification with ABglmS_F_New (grey) and Tn7R (orange) primers to confirm chromosomal insertion. Lane 1: Low molecular weight DNA ladder; Lane 2: ATCC 179798; Lane 3: AB258; Lane 4: AB258::adeIJK-LAC-Gm; Lane 5: no-template control. The expected band of 382 bp is labeled. Note that the gentamicin-specific primers (Gm_F and Gm_R, green) could also be used to affirm chromosomal insertion. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66471/66471fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/66471/66471fig05.jpg" /> 
Figure 5: Confirmation of loss of marker by colony PCR. Representative result of colony PCR amplification with gentamicin-specific primers (Gm_F and Gm_R) to confirm the loss of the antibiotic marker via pFLPab-based excision. Lane 1: low molecular weight DNA ladder; Lane 2: ATCC 179798; Lane 3: AB258; Lane 4: AB258::adeIJK-LAC-Gm; Lane 5: AB258::adeIJK; Lane 6: no-template control. The expected band of 525 bp is labeled. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/66471/66471fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Strains, plasmids, and primers</td>
			<td>Relevant characteristics</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>Stain</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>A. baumannii ATCC 17978</td>
			<td>Type strain</td>
			<td>ATCC</td>
		</tr>
		<tr>
			<td>A. baumannii ATCC 17978 AB258</td>
			<td>&#916;adeAB,&#916;adeFGH,&#916;adeIJK</td>
			<td>11</td>
		</tr>
		<tr>
			<td>Plasmids</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pUC18T-miniTn7T-Gm-LAC</td>
			<td>GmR, AmpR</td>
			<td>9</td>
		</tr>
		<tr>
			<td>pUC18T-miniTn7T-Gm-LAC-adeIJK</td>
			<td>GmR, AmpR, adeIJK</td>
			<td>This study</td>
		</tr>
		<tr>
			<td>pTNS2</td>
			<td>AmpR</td>
			<td>9</td>
		</tr>
		<tr>
			<td>pFLP2ab</td>
			<td>pWH1266 origin or replication, sacB, AmpR</td>
			<td>7</td>
		</tr>
		<tr>
			<td>Primers</td>
			<td>Sequence (5&#8242;&#8211;3&#8242;)</td>
			<td></td>
		</tr>
		<tr>
			<td>ABglmS_F_New</td>
			<td>CACAGCATAACTGGACTGATTTC</td>
			<td>7</td>
		</tr>
		<tr>
			<td>Tn7R</td>
			<td>TATGGAAGAAGTTCAGGCTC</td>
			<td>7</td>
		</tr>
		<tr>
			<td>Gm_F</td>
			<td>TGGAGCAGCAACGATGTTAC</td>
			<td>This study</td>
		</tr>
		<tr>
			<td>Gm_R</td>
			<td>TGTTAGGTGGCGGTACTTGG</td>
			<td>This study</td>
		</tr>
	</tbody>
</table>
Table 1: Bacterial strains, plasmids, and primers used in this protocol. Gm, gentamicin; Amp, ampicillin; R, resistant.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="2">Ciprofloxacin</td>
			<td colspan="2">Tetracycline</td>
			<td colspan="2">Kanamycin</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>&#8722;</td>
			<td>+</td>
			<td>&#8722;</td>
			<td>+</td>
			<td>&#8722;</td>
			<td>+</td>
		</tr>
		<tr>
			<td>ATCC 17978</td>
			<td>0.250</td>
			<td>nd</td>
			<td>0.500</td>
			<td>nd</td>
			<td>1.5</td>
			<td>nd</td>
		</tr>
		<tr>
			<td>AB258</td>
			<td>0.031</td>
			<td>nd</td>
			<td>0.063</td>
			<td>nd</td>
			<td>4</td>
			<td>nd</td>
		</tr>
		<tr>
			<td>AB258::adeIJK</td>
			<td>0.016</td>
			<td>0.063</td>
			<td>0.031</td>
			<td>0.125</td>
			<td>8</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Fold change</td>
			<td></td>
			<td>4.01</td>
			<td></td>
			<td>4.03</td>
			<td></td>
			<td>0.25</td>
		</tr>
	</tbody>
</table>
Table 2: Testing the functionality of the inserted genes via antibiotic susceptibility. Comparison of minimum inhibitory concentration (MIC) values for A. baumannii ATCC 17978, AB258, uninduced AB258::adeIJK, and IPTG-induced AB258::adeIJK against ciprofloxacin, tetracycline, and kanamycin. Fold change = induced (+ IPTG)/uninduced (&#8722; IPTG); nd = not determined.

Watch this Scientific Journal Video about Author Spotlight: Advancing Antibiotic Resistance Research Using an Efflux-Deficient Bacterial Strain and a Single-Copy Gene Expression System at JoVE.com

Author Spotlight: Advancing Antibiotic Resistance Research Using an Efflux&#45;Deficient Bacterial Strain and a Single&#45;Copy Gene Expression System

We describe a facile procedure for the single-copy chromosomal complementation of an efflux pump gene using a mini-Tn7-based expression system into an engineered efflux-deficient strain of Acinetobacter baumannii. This precise genetic tool allows for controlled gene expression, which is key for the characterization of efflux pumps in multidrug resistant pathogens.

Characterizing Multidrug Efflux Systems in Acinetobacter baumannii Using an Efflux&#45;Deficient Bacterial Strain and a Single&#45;Copy Gene Expression System

Acinetobacter baumannii is recognized as a challenging Gram-negative pathogen due to its widespread resistance to antibiotics. It is crucial to comprehend ...

characterizing-multidrug-efflux-systems-acinetobacter-baumannii-using

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

478 Views.  University of Manitoba. We describe a facile procedure for the single-copy chromosomal complementation of an efflux pump gene using a mini-Tn7-based expression system into an engineered efflux-deficient strain of Acinetobacter baumannii. This precise genetic tool allows for controlled gene expression, which is key for the characterization of efflux pumps in multidrug resistant pathogens.

Video: Author Spotlight: Advancing Antibiotic Resistance Research Using an Efflux-Deficient Bacterial Strain and a Single-Copy Gene Expression System

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Genetics

A Fluorescence-based Method to Study Bacterial Gene Regulation in Infected Tissues

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some factors act directly on virulence genes; others control pathogenesis by adjusting the expression of downstream regulators or the accumulation of signals that affect regulator activity. While regulation has been studied extensively during in vitro growth, relatively little is known about how gene expression is adjusted during infection. Such information is important when a particular gene product is a candidate for therapeutic intervention. Transcriptional approaches like quantitative, real-time RT-PCR and RNA-Seq are powerful ways to examine gene expression on a global level but suffer from many technical challenges including low abundance of bacterial RNA compared to host RNA, and sample degradation by RNases. Evaluating regulation using fluorescent reporters is relatively easy and can be multiplexed with fluorescent proteins with unique spectral properties. The method allows for single-cell, spatiotemporal analysis of gene expression in tissues that exhibit complex three-dimensional architecture and physiochemical gradients that affect bacterial regulatory networks. Such information is lost when data are averaged over the bulk population. Herein, we describe a method for quantifying gene expression in bacterial pathogens in situ. The method is based on simple tissue processing and direct observation of fluorescence from reporter proteins. We demonstrate the utility of this system by examining the expression of Staphylococcus aureus thermonuclease (nuc), whose gene product is required for immune evasion and full virulence ex vivo and in vivo. We show that nuc-gfp is strongly expressed in renal abscesses and reveal heterogeneous gene expression due in part to apparent spatial regulation of nuc promoter activity in abscesses fully engaged with the immune response. The method can be applied to any bacterium with a manipulatable genetic system and any infection model, providing valuable information for preclinical studies and drug development.

Described here is a method for analyzing bacterial gene expression in animal tissues at a cellular level. This method provides a resource for studying the phenotypic diversity occurring within a bacterial population in response to the tissue environment during an infection.

Bacterial virulence genes are often regulated at the transcriptional level by multiple factors that respond to different environmental signals. Some ...

Quantification of Plasmid-Mediated Antibiotic Resistance in an Experimental Evolution Approach

Plasmids play a major role in microbial ecology and evolution as vehicles of lateral gene transfer and reservoirs of accessory gene functions in microbial populations. This is especially the case under rapidly changing environments such as fluctuating antibiotics exposure. We recently showed that plasmids maintain antibiotic resistance genes in Escherichia coli without positive selection for the plasmid presence. Here we describe an experimental system that allows following both the plasmid genotype and phenotype in long-term evolution experiments. We use molecular techniques to design a model plasmid that is subsequently introduced to an experimental evolution batch system approach in an E. coli host. We follow the plasmid frequency over time by applying replica plating of the E. coli populations while quantifying the antibiotic resistance persistence. In addition, we monitor the conformation of plasmids in host cells by analyzing the extent of plasmid multimer formation by plasmid nicking and agarose gel electrophoresis. Such an approach allows us to visualize not only the genome size of evolving plasmids but also their topological conformation-a factor highly important for plasmid inheritance. Our system combines molecular strategies with traditional microbiology approaches and provides a set-up to follow plasmids in bacterial populations over a long time. The presented approach can be applied to study a wide range of mobile genetic elements in the future.

Our experimental approach provides a strategy to follow plasmid abundance and antibiotic resistance over time in bacterial populations.

Plasmids play a major role in microbial ecology and evolution as vehicles of lateral gene transfer and reservoirs of accessory gene functions in microbial ...

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine exchangers in plants have not been identified. Here, we outline a method to characterize polyamine antiporters using membrane vesicles generated from the lysis of Escherichia coli cells heterologously expressing a plant antiporter. First, we heterologously expressed AtBAT1 in an E. coli strain deficient in polyamine and arginine exchange transporters. Vesicles were produced using a French press, purified by ultracentrifugation and utilized in a membrane filtration assay of labeled substrates to demonstrate the substrate specificity of the transporter. These assays demonstrated that AtBAT1 is a proton-mediated transporter of arginine, &#947;-aminobutyric acid (GABA), putrescine and spermidine. The mutant strain that was developed for the assay of AtBAT1 may be useful for the functional analysis of other families of plant and animal polyamine exchangers. We also hypothesize that this approach can be used to characterize many other types of antiporters, as long as these proteins can be expressed in the bacterial cell membrane. E. coli is a good system for the characterization of novel transporters, since there are multiple methods that can be employed to mutagenize native transporters.

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

We describe a method for the characterization of proton-driven membrane transporters in membrane vesicle preparations produced by heterologous expression in E. coli and lysis of cells using a French press.

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine ...

Biochemistry

Isolation and Identification of Waterborne Antibiotic-Resistant Bacteria and Molecular Characterization of their Antibiotic Resistance Genes

The development and spread of antibiotic resistance (AR) through microbiota associated with freshwater bodies is a major global health concern. In the present study, freshwater samples were collected and analyzed with respect to the total bacterial diversity and AR genes (ARGs) using both conventional culture-based techniques and a high-throughput culture-independent metagenomic approach. This paper presents a systematic protocol for the enumeration of the total and antibiotic-resistant culturable bacteria from freshwater samples and the determination of phenotypic and genotypic resistance in the culturable isolates. Further, we report the use of whole metagenomic analysis of the total metagenomic DNA extracted from the freshwater sample for the identification of the overall bacterial diversity, including non-culturable bacteria, and the identification of the total pool of different ARGs (resistome) in the water body. Following these detailed protocols, we observed a high antibiotic-resistant bacteria load in the range of 9.6 &#215; 105-1.2 &#215; 109 CFU/mL. Most isolates were resistant to the multiple tested antibiotics, including cefotaxime, ampicillin, levofloxacin, chloramphenicol, ceftriaxone, gentamicin, neomycin, trimethoprim, and ciprofloxacin, with multiple antibiotic resistance (MAR) indexes of &#8805;0.2, indicating high levels of resistance in the isolates. The 16S rRNA sequencing identified potential human pathogens, such as Klebsiella pneumoniae,&#160;and opportunistic bacteria, such as Comamonas spp., Micrococcus spp., Arthrobacter spp., and Aeromonas spp. The molecular characterization of the isolates showed the presence of various ARGs, such as blaTEM, blaCTX-M (&#946;-lactams), aadA, aac (6&#39;)-Ib (aminoglycosides), and dfr1 (trimethoprims), which was also confirmed by the whole metagenomic DNA analysis. A high prevalence of other ARGs encoding for antibiotic efflux pumps-mtrA, macB, mdtA, acrD, &#946;-lactamases-SMB-1, VIM-20, ccrA, ampC, blaZ, the&#160;chloramphenicol acetyltransferase gene catB10, and&#160;the rifampicin resistance gene rphB-was also detected in the metagenomic DNA. With the help of the protocols discussed in this study, we confirmed the presence of waterborne MAR bacteria with diverse AR phenotypic and genotypic traits. Thus, whole metagenomic DNA analysis can be used as a complementary technique to conventional culture-based techniques to determine the overall AR status of a water body.

Here, we present a detailed protocol for the isolation and identification of antibiotic-resistant bacteria from water and the molecular characterization of their antibiotic resistance genes (ARGs). The use of culture-based and non-culture-based (metagenomic analysis) techniques provides complete information about the total bacterial diversity and the total pool of different ARGs present in freshwaters from Mumbai, India.

The development and spread of antibiotic resistance (AR) through microbiota associated with freshwater bodies is a major global health concern. In the ...

Environment

Expression, Detergent Solubilization, and Purification of a Membrane Transporter, the MexB Multidrug Resistance Protein

Multidrug resistance (MDR), the ability of a cancer cell or pathogen to be resistant to a wide range of structurally and functionally unrelated anti-cancer drugs or antibiotics, is a current serious problem in public health. This multidrug resistance is largely due to energy-dependent drug efflux pumps. The pumps expel anti-cancer drugs or antibiotics into the external medium, lowering their intracellular concentration below a toxic threshold. We are studying multidrug resistance in Pseudomonas aeruginosa, an opportunistic bacterial pathogen that causes infections in patients with many types of injuries or illness, for example, burns or cystic fibrosis, and also in immuno-compromised cancer, dialysis, and transplantation patients. The major MDR efflux pumps in P. aeruginosa are tripartite complexes comprised of an inner membrane proton-drug antiporter (RND), an outer membrane channel (OMF), and a periplasmic linker protein (MFP) 1-8. The RND and OMF proteins are transmembrane proteins. Transmembrane proteins make up more than 30% of all proteins and are 65% of current drug targets. The hydrophobic transmembrane domains make the proteins insoluble in aqueous buffer. Before a transmembrane protein can be purified, it is necessary to find buffer conditions containing a mild detergent that enable the protein to be solubilized as a protein detergent complex (PDC) 9-11. In this example, we use an RND protein, the P. aeruginosa MexB transmembrane transporter, to demonstrate how to express a recombinant form of a transmembrane protein, solubilize it using detergents, and then purify the protein detergent complexes. This general method can be applied to the expression, purification, and solubilization of many other recombinantly expressed membrane proteins. The protein detergent complexes can later be used for biochemical or biophysical characterization including X-ray crystal structure determination or crosslinking studies.

In this protocol we demonstrate the expression, solubilization, and purification of a recombinantly expressed membrane protein, MexB, as a soluble protein detergent complex. MexB is a multidrug resistance membrane transporter from the opportunistic bacterial pathogen Pseudomonas aeruginosa.

Multidrug resistance (MDR), the ability of a cancer cell or pathogen to be resistant to a wide range of structurally and functionally unrelated ...

Biology

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

In vitro Investigation of the MexAB Efflux Pump From Pseudomonas aeruginosa

There is an emerging scientific need for reliable tools for monitoring membrane protein transport. We present a methodology leading to the reconstitution of efflux pumps from the Gram-negative bacteria Pseudomonas aeruginosa in a biomimetic environment that allows for an accurate investigation of their activity of transport. Three prerequisites are fulfilled: compartmentation in a lipidic environment, use of a relevant index for transport, and generation of a proton gradient. The membrane protein transporter is reconstituted into liposomes together with bacteriorhodopsin, a light-activated proton pump that generates a proton gradient that is robust as well as reversible and tunable. The activity of the protein is deduced from the pH variations occurring within the liposome, using pyranin, a pH-dependent fluorescent probe. We describe a step-by-step procedure where membrane protein purification, liposome formation, protein reconstitution, and transport analysis are addressed. Although they were specifically designed for an RND transporter, the described methods could potentially be adapted for use with any other membrane protein transporter energized by a proton gradient.

In vitro Investigation of the MexAB Efflux Pump From Pseudomonas aeruginosa

We present a protocol for the in vitro investigation of efflux pumps from Pseudomonas aeruginosa. This protocol allows for the generation of a robust, reversible, and tunable proton gradient within the liposome membrane and hence should be adaptable to any membrane protein energized by the protomotive force.

There is an emerging scientific need for reliable tools for monitoring membrane protein transport. We present a methodology leading to the reconstitution ...

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Characterizing Multidrug Efflux Systems in Acinetobacter baumannii Using an Efflux-Deficient Bacterial Strain and a Single-Copy Gene Expression System

Summary

Explore More Videos

Chapters in this video

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

A Fluorescence-based Method to Study Bacterial Gene Regulation in Infected Tissues

Quantification of Plasmid-Mediated Antibiotic Resistance in an Experimental Evolution Approach

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

Isolation and Identification of Waterborne Antibiotic-Resistant Bacteria and Molecular Characterization of their Antibiotic Resistance Genes

Expression, Detergent Solubilization, and Purification of a Membrane Transporter, the MexB Multidrug Resistance Protein

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

In vitro Investigation of the MexAB Efflux Pump From Pseudomonas aeruginosa

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis