This study is supported by the Japan Society for the Promotion of Science Overseas Research Fellowships (S.G.), a Loris and David Rich Postdoctoral Scholar (S.G.), and a grant from the National Eye Institute of the National Institutes of Health (R01EY012392; C.F.W.).

All animal care and treatments used in this study conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The experimental protocols were approved by the Animal Care and Use Committee of the University of California, Berkeley.
1. Enucleation of the guinea pig eye
<ol>
	<li>Euthanize a guinea pig&#160;with an intracardiac injection of sodium pentobarbital delivered under anesthesia (5% isoflurane in oxygen).</li>
	<li>Enucleate the eyes with the aid of forceps and scissors, and immediately transfer them to a 10 cm Petri dish with sterile phosphate-buffered saline (PBS) for washing. Transfer the eyes to fresh PBS solution. 
	&#8203;NOTE: A 6-well plate containing 4 mL of solution per well is recommended.</li>
</ol>
2. Isolation of the ocular posterior eye cup and RPE/choroid/sclera complex
<ol>
	<li>With the aid of a dissecting microscope, use an 18 G needle to make an initial small incision in the sclera, approximately 1.0 mm behind the limbal boundary (i.e., between the cornea and sclera) (Figure 1A); then use scissors to remove the anterior segment, including the cornea, iris, ciliary body, and crystalline lens.</li>
	<li>Next, working with the remaining posterior ocular segment eye cup, detach the retina from the RPE/choroid/sclera complex; use forceps to first grasp and then gently tug on the zonule of Zinn and then to progressively peel away the retina without fragmentation (Figure 1B). 
	&#8203;NOTE: The retina must not be directly grasped to avoid retinal fragmentation and incomplete retinal tissue isolation. The use of a microscope is essential for this dissection step.</li>
</ol>
3. Isolation of the RPE from the choroid
<ol>
	<li>After the retina has been completely removed, immerse the remaining posterior eye cup, which includes the RPE, choroid, and sclera, in tissue storage reagent for 5 min (see the Table of Materials). 
	NOTE: Use a 12-well plate with identified wells, each filled with 2 mL of the tissue storage reagent.</li>
	<li>Transfer the eye cup to another well filled with 4 mL of PBS for 10 s before moving it to a third well filled with 2 mL of PBS.</li>
	<li>Attach a 30 G needle to a 1 mL syringe filled with PBS for the final RPE isolation step. Gently push on the syringe to create a jet stream of PBS; first, aim this stream at the RPE to make a small tear or hole in it, and then direct the stream of PBS into the created opening to detach the RPE as a sheet from the choroid (Figure 1C). 
	NOTE: The detachment of the RPE as a sheet yields the largest RPE sample. Again, the use of a microscope is essential for this step.</li>
	<li>After detaching the RPE from the choroid (Figure 1D), collect the RPE tissue in a needleless 1 mL syringe, and then transfer the collected sample to a 1.5 mL tube.</li>
	<li>Centrifuge the 1.5 mL tube with the collected RPE at 8,000 &#215; g for 1 min to obtain an RPE pellet (Figure 2A).</li>
	<li>Discard the PBS solution, and replace it with 350 mL of lysis buffer, as included in RNA isolation kits (see the Table of Materials); pipette 20x to mix and, thus, preserve the quality of the sample. For longer-term storage and preservation, transfer the samples to a &#8722;80 &#176;C freezer. 
	&#8203;NOTE: The lysis buffer is a proprietary component of the RNA isolation kit for cell and tissue lysis before RNA isolation and simultaneous RNA/DNA/protein isolation. To inactivate the RNAses in the lysate, be sure to add &#946;-mercaptoethanol to the lysis buffer (10 &#181;L of &#946;-mercaptoethanol per 1 mL of lysis buffer).</li>
</ol>
4. RPE-RNA extraction
<ol>
	<li>Use an RNA isolation kit (see the Table of Materials) to isolate and collect the RNA from the RPE samples following the manufacturer&#39;s instructions provided. Evaluate the quality of the sample via electrophoresis. 
	NOTE: The described protocol yielded a good-quality product (i.e., RNA integrity number [RIN] over 8.0).</li>
</ol>

<ol>
	<li>Strauss, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinal+pigment+epithelium+in+visual+function.">The retinal pigment epithelium in visual function.</a> Physiological Reviews. 85 (3), 845-881 (2005).</li><li>Amram, B., Cohen-Tayar, Y., David, A., Ashery-Padan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinal+pigmented+epithelium+-+from+basic+developmental+biology+research+to+translational+approaches.">The retinal pigmented epithelium - from basic developmental biology research to translational approaches.</a> The International Journal of Developmental Biology. 61 (3-4-5), 225-234 (2017).</li><li>Goto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+retina-specific+Aldh1a1+controls+dorsal+choroidal+vascular+development+via+Sox9+expression+in+retinal+pigment+epithelial+cells.">Neural retina-specific Aldh1a1 controls dorsal choroidal vascular development via Sox9 expression in retinal pigment epithelial cells.</a> Elife. 7, 32358 (2018).</li><li>Rymer, J., Wildsoet, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+retinal+pigment+epithelium+in+eye+growth+regulation+and+myopia:+A+review.">The role of the retinal pigment epithelium in eye growth regulation and myopia: A review.</a> Visual Neuroscience. 22 (3), 251-261 (2005).</li><li>Wallman, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moving+the+retina:+Choroidal+modulation+of+refractive+state.">Moving the retina: Choroidal modulation of refractive state.</a> Vision Research. 35 (1), 37-50 (1995).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scleral+hypoxia+is+a+target+for+myopia+control.">Scleral hypoxia is a target for myopia control.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (30), 7091-7100 (2018).</li><li>Troilo, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imi+-+Report+on+experimental+models+of+emmetropization+and+myopia.">Imi - Report on experimental models of emmetropization and myopia.</a> Investigative Ophthalmology and Visual Science. 60 (3), 31-88 (2019).</li><li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Violet+light+suppresses+lens-induced+myopia+via+neuropsin+(OPN5)+in+mice.">Violet light suppresses lens-induced myopia via neuropsin (OPN5) in mice.</a> Proceedings of the National Academy of Sciences of the United States of America. 118 (22), e2018840118 (2021).</li><li>Zhang, Y., Wildsoet, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RPE+and+choroid+mechanisms+underlying+ocular+growth+and+myopia.">RPE and choroid mechanisms underlying ocular growth and myopia.</a> Progress in Molecular Biology and Translational Science. 134, 221-240 (2015).</li><li>Jager, R. D., Mieler, W. F., Miller, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Age-related+macular+degeneration.">Age-related macular degeneration.</a> New England Journal of Medicine. 358 (24), 2606-2617 (2008).</li><li>McLeod, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+between+RPE+and+choriocapillaris+in+age-related+macular+degeneration.">Relationship between RPE and choriocapillaris in age-related macular degeneration.</a> Investigative Opthalmology and Visual Science. 50 (10), 4982 (2009).</li><li>Bhutto, I., Lutty, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+age-related+macular+degeneration+(AMD):+Relationships+between+the+photoreceptor/retinal+pigment+epithelium/Bruch's+membrane/choriocapillaris+complex.">Understanding age-related macular degeneration (AMD): Relationships between the photoreceptor/retinal pigment epithelium/Bruch's membrane/choriocapillaris complex.</a> Molecular Aspects of Medicine. 33 (4), 295-317 (2012).</li><li>Shelton, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microarray+analysis+of+choroid/RPE+gene+expression+in+marmoset+eyes+undergoing+changes+in+ocular+growth+and+refraction.">Microarray analysis of choroid/RPE gene expression in marmoset eyes undergoing changes in ocular growth and refraction.</a> Molecular Vision. 14, 1465-1479 (2008).</li><li>Wang, S., Liu, S., Mao, J., Wen, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+retinoic+acid+on+the+tight+junctions+of+the+retinal+pigment+epithelium-choroid+complex+of+guinea+pigs+with+lens-induced+myopia+in+vivo.">Effect of retinoic acid on the tight junctions of the retinal pigment epithelium-choroid complex of guinea pigs with lens-induced myopia in vivo.</a> International Journal of Molecular Medicine. 33 (4), 825-832 (2014).</li><li>He, L., Frost, M. R., Siegwart, J. T., Norton, T. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+gene+expression+in+tree+shrew+retina+and+retinal+pigment+epithelium+produced+by+short+periods+of+minus-lens+wear.">Altered gene expression in tree shrew retina and retinal pigment epithelium produced by short periods of minus-lens wear.</a> Experimental Eye Research. 168 (3), 77-88 (2018).</li><li>Nickla, D. L., Wallman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multifunctional+choroid.">The multifunctional choroid.</a> Progress in Retinal and Eye Research. 29 (2), 144-168 (2010).</li><li>Zhang, Y., Liu, Y., Wildsoet, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional,+optical+sign-dependent+regulation+of+BMP2+gene+expression+in+chick+retinal+pigment+epithelium.">Bidirectional, optical sign-dependent regulation of BMP2 gene expression in chick retinal pigment epithelium.</a> Investigative Ophthalmology and Visual Science. 53 (10), 6072-6080 (2012).</li><li>Xin-Zhao Wang, C., Zhang, K., Aredo, B., Lu, H., Ufret-Vincenty, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+for+the+rapid+isolation+of+RPE+cells+specifically+for+RNA+extraction+and+analysis.">Novel method for the rapid isolation of RPE cells specifically for RNA extraction and analysis.</a> Experimental Eye Research. 102 (1), 1-9 (2012).</li><li>Goto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+signatures+of+contact+lens-induced+myopia+in+guinea+pig+retinal+pigment+epithelium.">Gene expression signatures of contact lens-induced myopia in guinea pig retinal pigment epithelium.</a> Investigative Opthalmology and Visual Science. 63 (9), 25 (2022).</li><li>De Schaepdrijver, L., Simoens, P., Lauwers, H., De Geest, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinal+vascular+patterns+in+domestic+animals.">Retinal vascular patterns in domestic animals.</a> Research in Veterinary Science. 47 (1), 34-42 (1989).</li><li>Araki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Base-resolution+methylome+of+retinal+pigment+epithelial+cells+used+in+the+first+trial+of+human+induced+pluripotent+stem+cell-based+autologous+transplantation.">Base-resolution methylome of retinal pigment epithelial cells used in the first trial of human induced pluripotent stem cell-based autologous transplantation.</a> Stem Cell Reports. 13 (4), 761-774 (2019).</li><li>Sonoda, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+the+culture+and+differentiation+of+highly+polarized+human+retinal+pigment+epithelial+cells.">A protocol for the culture and differentiation of highly polarized human retinal pigment epithelial cells.</a> Nature Protocols. 4 (5), 662-673 (2009).</li><li>Fernandez-Godino, R., Garland, D. L., Pierce, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation,+culture+and+characterization+of+primary+mouse+RPE+cells.">Isolation, culture and characterization of primary mouse RPE cells.</a> Nature Protocols. 11 (7), 1206-1218 (2016).</li></ol>

The authors declare no competing financial interests.

In this article, we describe a method for isolating RPE, appropriate for RPE gene expression analyses, from the eyes of young, pigmented guinea pigs. The merits of this protocol are that it yields high-quality RPE samples that are relatively free from contamination, with&#160;RNA suitably preserved for RNA-specific analyses and, yet, is relatively simple and efficient. While in the example provided here, the RPE samples were collected from the eyes of a young (2 weeks old)&#160;guinea pig, the protocol has also been used successfully to collect RPE samples from older (young adult) animals.
For researchers with minimal prior experience with ocular surgery or dissection, protocol step 2.1 and step 2.2 can be challenging. The critical detail in step 2.1 is the location of the initial incision in the sclera, which should be accurately placed 1.0 mm behind the limbus so that the iris and lens are removed together with the cornea when detaching the anterior segment. If, instead, the iris remains attached to the posterior ocular segment, it is challenging to find the zonule of Zinn, which is key to successfully detaching the retina in the next step. As noted in the protocol, for the successful detachment of the retina, it is also critical that the retina not be grasped directly with the forceps to avoid its fragmentation. The guinea pig retina appears more fragile than the mouse retina, likely because of its avascular nature20. Ideally, the isolated posterior eye cup, comprising the RPE, choroid, and sclera, should be immersed in tissue storage reagent within 5 min of eye enucleation to ensure the adequate preservation of RNA in the collected RPE sample.
The SRIRS method, which was developed for the specific purpose of collecting high-quality samples of RPE from the eyes of mice, appears to have achieved that goal for mouse eyes; it is reported to be both efficient and effective18. This technique has also been successfully used to collect RPE from healthy human donor eyes21. However, based on the authors&#39; experience, this SRIRS method is not suitable for collecting RPE from the eyes of the guinea pig, tree shrew, and opossum, although the underlying reasons for this are not clear. By reporting the technique described here to isolate and collect RPE from the eyes of young guinea pigs, we hope to address an important unmet need in the myopia research field.
In terms of the limitations of the protocol described, the main one is the need for a period of hands-on training to ensure the efficient collection of samples, as the time to completion is key, in addition to the purity of the collected RPE samples. Researchers who have no experience with ocular micro-dissection or surgery will be most in need of training. Although several RPE isolation methods have been reported22,23, the method as described here is not suitable for RPE cell cultures or protein analyses due to the use of an RNA stabilizing reagent.
The RPE has long been recognized to play critical roles not only in maintaining the health and function of the retina but also in related diseases. The fact that the RPE is now also recognized to play a key role in ocular growth regulation and myopia development has considerably broadened the scope of research questions, for which the ability to collect high-quality RPE samples from either the eyes of guinea pigs, as described here, or other mammals used as animal models may be key to providing new insights. Such studies may also offer new insights into the pathological complications of myopia, including myopic maculopathy, for which the prevalence figures can be expected to rise in parallel with myopia prevalence figures per se.

The RPE comprises a unique monolayer of pigmented cells located between the neural retina and the vascular choroid, and the RPE has well-recognized roles in the development and maintenance of normal retinal function, including phototransduction1,2. More recently, the RPE has been assigned an additional key role in eye growth regulation3 and, thus, the development of myopia4. This assignment is based on the RPE&#39;s critical location,&#160;interposed between the retina and choroid and the now broad acceptance that eye growth and, thus, refractive errors are regulated locally5. The RPE is believed to play a key role as a signal relay, linking the retina, the assumed source of growth modulatory signals, to the choroid and sclera, the two targets of the relayed signals6,7,8.
The increase in axial length that characterizes most myopia cannot be considered benign, with pathophysiological changes involving the retina, choroid, and/or sclera representing unavoidable and now well-recognized consequences of excessive ocular elongation7,9. In this context, the RPE is perhaps the most vulnerable, since, being a nonmitotic tissue, it is only able to accommodate the expanding vitreous chamber by the stretching and thinning of individual cells. While its role in myopia-related pathologies, such as myopic macular degeneration, is yet to be fully understood, the RPE has been implicated in the pathogenesis of a number of other retinal diseases, including geographic atrophy, one of the leading causes of blindness, which is associated with documented abnormalities in the retina, RPE, and choroid10,11,12.
The successful isolation of RPE cells, free from contamination from adjacent ocular tissues, potentially opens up many research opportunities to gain new insights into the mechanisms underlying a variety of eye/retinal diseases. However, the isolation of the RPE has proven challenging, with many published studies making use of combined retina/RPE or RPE/choroid samples for this reason13,14,15. Studies involving the successful isolation of the RPE of a quality suitable for molecular biology studies has been limited to chick and mouse eyes16,17. For example, the simultaneous RPE isolation and RNA stabilization (SRIRS) method described by Wang et al.18. To isolate RPE cells in mice does not appear to work well in guinea pig eyes. The protocol described here represents a refinement of an approach that was initially prototyped with tree shrew eyes by one of the authors (M.F.) and has proven to yield high-quality RPE samples, appropriate for RNA and other molecular biology analyses, from the eyes of young pigmented guinea pigs19.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1 mL Syringe with Slip Tip</td>
			<td>Bd Vacutainer Labware Medical</td>
			<td>22-253-260</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Invitrogen</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>6 Well Tissue Culture Plate with Lid, Flat Bottom, Sterile</td>
			<td>pectrum Chemical Mfg. Corp</td>
			<td>970-95008</td>
			<td></td>
		</tr>
		<tr>
			<td>12 Well Tissue Culture Plate with Lid, Individual, Sterile</td>
			<td>Thomas Scientific LLC</td>
			<td>1198D72</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer</td>
			<td></td>
			<td></td>
			<td>automated electrophoresis to check RNA quality</td>
		</tr>
		<tr>
			<td>Balanced Salt Solutions</td>
			<td>Gibco</td>
			<td>10010031</td>
			<td></td>
		</tr>
		<tr>
			<td>Bonn Micro Forceps, Straight Smooth, 0.3 mm Tip, 7 cm</td>
			<td>Fine Science Tools, Inc.</td>
			<td>11083-07</td>
			<td></td>
		</tr>
		<tr>
			<td>Dumont forceps no. 5</td>
			<td>ROBOZ</td>
			<td>RS-5045</td>
			<td></td>
		</tr>
		<tr>
			<td>Hypodermic disposable needles</td>
			<td>Exelint International, Co.</td>
			<td>26419</td>
			<td></td>
		</tr>
		<tr>
			<td>Hypodermic disposable needles</td>
			<td>Exelint International, Co.</td>
			<td>26437</td>
			<td></td>
		</tr>
		<tr>
			<td>MiniSpin Microcentrifuges</td>
			<td>Eppendorf</td>
			<td>540108</td>
			<td>Max. Speed: 8,000 g</td>
		</tr>
		<tr>
			<td>RNAlater Stabilization Solution</td>
			<td>Invitrogen</td>
			<td>AM7020</td>
			<td>tissue storage reagent</td>
		</tr>
		<tr>
			<td>RNeasy Mini kits</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td>RNA isolation kit</td>
		</tr>
		<tr>
			<td>Student Vannas Spring Scissors</td>
			<td>Fine Science Tools, Inc.</td>
			<td>91500-09</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of retinal pigment epithelial cells from guinea pig eyes

This protocol describes the isolation of cells of the retinal pigment epithelium (RPE) from the eyes of young pigmented guinea pigs for potential application in molecular biology studies, including gene expression analyses. In the context of eye growth regulation and myopia, the RPE likely plays a role as a cellular relay for growth modulatory signals, as it is located between the retina and the two walls of the eye, such as the choroid and sclera. While protocols for isolating the RPE have been developed for both chicks and mice, these protocols have proven not to be directly translatable to the guinea pig, which has become an important and widely used mammalian myopia model. In this study, molecular biology tools were used to examine the expression of specific genes to confirm that the samples were free of contamination from the adjacent tissues. The value of this protocol has already been demonstrated in an RNA-Seq study of RPE from young pigmented guinea pigs exposed to myopia-inducing optical defocus. Beyond eye growth regulation, this protocol has other potential applications in studies of retinal diseases, including myopic maculopathy, one of the leading causes of blindness in myopes, in which the RPE has been implicated. The main advantage of this technique is that it is relatively simple and&#160;once perfected, yields high-quality RPE samples suitable for molecular biology studies, including RNA analysis.

The analysis of the RPE samples collected using the above protocol showed well-preserved RNA (RIN &#62;8.0, Figure 2B), with 240.2 ng &#177; 35.1 ng per eye (n = 8, NanoDrop, Figure 2B). To further evaluate the quality of the isolated RPE samples, particularly the absence of choroidal and scleral contaminants, we examined the expression of representative genes for each of the latter tissues in the RPE samples19. The RPE samples demonstrated a significantly higher expression of Rpe65 (an RPE-specific gene) compared with the Rpe65 expression levels in the choroid and sclera (Table 1 and Figure 2C). In contrast, the RPE samples showed minimal expression of Col1a1, the selected choroid-sclera-specific gene (Figure 2D).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64837/64837fig01v2.jpg" /> 
Figure 1: Procedure for collecting the RPE sheets. (A)&#160;A 2-week-old guinea pig eye with the first incision. (B) The anterior segment (cornea, iris, and lens), vitreous,and retina are then separated from the posterior eye cup (RPE, choroid, and sclera). (C) A jet stream of PBS, delivered via a 30 G needle, is used detach the RPE (D) as a sheet (black arrows) from the choroid. The procedure from the first incision to the RPE collection takes 5-7 min. Abbreviation: RPE = retinal pigment epithelium. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64837/64837fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64837/64837fig02.jpg" /> 
Figure 2: Procedure for assessing the quality of the isolated RPE samples. (A) Representative image of an RPE sample in a 1.5 mL microcentrifuge tube after being spun down. (B) Representative bioanalyzer output for RNA extracted from the collected RPE samples. (C,D) The gene expression levels of Rpe65, an RPE-specific gene, and Col1a1, which is not or minimally expressed in the RPE, measured by RT-qPCR in the RPE, choroid, and scleral samples from n = 3 untreated animals; both data sets were normalized to &#946;-actin. ** P &#60; 0.01; *** P &#60; 0.001. This figure has been modified from Goto et al.19. Abbreviations: RPE = retinal pigment epithelium; &#946;-actin = beta-actin; Col1a1 = collagen type-I alpha-1 chain; Rpe65 = retinoid isomerohydrolase; RT-qPCR = reverse-transcription quantitative polymerase chain reaction. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/64837/64837fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td colspan="3">Forward Primer (5&#39; to 3&#39;)</td>
			<td colspan="3">Reverse Primer (5&#39; to 3&#39;)</td>
		</tr>
		<tr>
			<td>Col1a1</td>
			<td colspan="3">GCCTCAGGCAAGACAGTCATT</td>
			<td colspan="3">GCTAACGGTAAAGCCGAATTCC</td>
		</tr>
		<tr>
			<td>Rpe65</td>
			<td colspan="3">GCCCTTCTGCACAAGTTTGAC</td>
			<td colspan="3">CAGTGCGGATGAACCTTCTGT</td>
		</tr>
		<tr>
			<td>&#946;-actin</td>
			<td colspan="3">GGCCGAGCGGGAAATT</td>
			<td colspan="3">CCAGGGCAACATAGCATAGCTT</td>
		</tr>
	</tbody>
</table>
Table 1: Nucleotide sequences of the primers used for PCR amplification in the sample quality analysis. Abbreviations: &#946;-actin = Beta-actin; Col1a1 = collagen type I alpha 1 chain; Rpe65 = retinoid isomerohydrolase.

Watch this Scientific Journal Video about Isolation of Retinal Pigment Epithelial Cells from Guinea Pig Eyes at JoVE.com

Isolation of Retinal Pigment Epithelial Cells from Guinea Pig Eyes

We describe a simple and efficient method for isolating cells of the retinal pigment epithelium (RPE) cells from the eyes of young pigmented guinea pigs. This procedure allows for follow-up molecular biology studies on the isolated RPE, including gene expression analyses.

This protocol describes the isolation of cells of the retinal pigment epithelium (RPE) from the eyes of young pigmented guinea pigs for potential ...

isolation-of-retinal-pigment-epithelial-cells-from-guinea-pig-eyes

Nanyang Technological University

Research

JoVE Journal

Biology

2.1K Views.  University of California, Berkeley. We describe a simple and efficient method for isolating cells of the retinal pigment epithelium (RPE) cells from the eyes of young pigmented guinea pigs. This procedure allows for follow-up molecular biology studies on the isolated RPE, including gene expression analyses.

Video: Isolation of Retinal Pigment Epithelial Cells from Guinea Pig Eyes

Isolation of Retinal Stem Cells from the Mouse Eye

The adult mouse retinal stem cell (RSC) is a rare quiescent cell found within the ciliary epithelium (CE) of the mammalian eye1,2,3. The CE is made up of non-pigmented inner and pigmented outer cell layers, and the clonal RSC colonies that arise from a single pigmented cell from the CE are made up of both pigmented and non-pigmented cells which can be differentiated to form all the cell types of the neural retina and the RPE. There is some controversy about whether all the cells within the spheres all contain at least some pigment4; however the cells are still capable of forming the different cell types found within the neural retina1-3. In some species, such as amphibians and fish, their eyes are capable of regeneration after injury5, however; the mammalian eye shows no such regenerative properties. We seek to identify the stem cell in vivo and to understand the mechanisms that keep the mammalian retinal stem cells quiescent6-8, even after injury as well as using them as a potential source of cells to help repair physical or genetic models of eye injury through transplantation9-12. Here we describe how to isolate the ciliary epithelial cells from the mouse eye and grow them in culture in order to form the clonal retinal stem cell spheres. Since there are no known markers of the stem cell in vivo, these spheres are the only known way to prospectively identify the stem cell population within the ciliary epithelium of the eye.

In this video, we will demonstrate how to isolate retinal stem cells from the ciliary epithelium of the mouse eye and grow them in culture to form clonal retinal spheres. The spheres that are isolated possess the cardinal properties of stem cells: self-renewal and multipotentiality.

The adult mouse retinal stem cell (RSC) is a rare quiescent cell found within the ciliary epithelium (CE) of the mammalian eye1,2,3. The CE is made up of ...

Isolation and Culture of Adult Epithelial Stem Cells from Human Skin

The homeostasis of all self-renewing tissues is dependent on adult stem cells. As undifferentiated stem cells undergo asymmetric divisions, they generate daughter cells that retain the stem cell phenotype and transit-amplifying cells (TA cells) that migrate from the stem cell niche, undergo rapid proliferation and terminally differentiate to repopulate the tissue.
Epithelial stem cells have been identified in the epidermis, hair follicle, and intestine as cells with a high in vitro proliferative potential and as slow-cycling label-retaining cells in vivo 1-3. Adult, tissue-specific stem cells are responsible for the regeneration of the tissues in which they reside during normal physiologic turnover as well as during times of stress 4-5. Moreover, stem cells are generally considered to be multi-potent, possessing the capacity to give rise to multiple cell types within the tissue 6. For example, rodent hair follicle stem cells can generate epidermis, sebaceous glands, and hair follicles 7-9. We have shown that stem cells from the human hair follicle bulge region exhibit multi-potentiality 10.
Stem cells have become a valuable tool in biomedical research, due to their utility as an in vitro system for studying developmental biology, differentiation, tumorigenesis and for their possible therapeutic utility. It is likely that adult epithelial stem cells will be useful in the treatment of diseases such as ectodermal dysplasias, monilethrix, Netherton syndrome, Menkes disease, hereditary epidermolysis bullosa and alopecias 11-13. Additionally, other skin problems such as burn wounds, chronic wounds and ulcers will benefit from stem cell related therapies 14,15. Given the potential for reprogramming of adult cells into a pluripotent state (iPS cells)16,17, the readily accessible and expandable adult stem cells in human skin may provide a valuable source of cells for induction and downstream therapy for a wide range of disease including diabetes and Parkinson's disease.

A rapid, robust way of isolating viable adult epithelial stem cells from human skin is described. The method utilizes enzymatic digestion of skin collagen matrix , followed by plucking of hair follicles and isolation of single cell suspensions or tissue fragments for cell culture.

The homeostasis of all self-renewing tissues is dependent on adult stem cells. As undifferentiated stem cells undergo asymmetric divisions, they generate ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Subretinal Transplantation of Human Embryonic Stem Cell Derived-retinal Pigment Epithelial Cells into a Large-eyed Model of Geographic Atrophy

Geographic atrophy (GA), the late stage of dry age-related macular degeneration is characterized by loss of the retinal pigment epithelial (RPE) layer, which leads to subsequent degeneration of vital retinal structures (e.g., photoreceptors) causing severe vision impairment. Similarly, RPE-loss and decrease in visual acuity is seen in long-term follow up of patients with advanced wet age-related macular degeneration (AMD) receiving intravitreal anti-vascular endothelial growth factor (VEGF) treatment. Therefore, on the one hand, it is fundamental to efficiently derive RPE cells from an unlimited source that could serve as replacement therapy. On the other hand, it is important to assess the behavior and integration of the derived cells in a model of the disease entailing surgical and imaging methods as close as possible to those applied in humans. Here, we provide a detailed protocol based on our previous publications that describes the generation of a preclinical model of GA using the albino rabbit eye, for evaluation of the human embryonic stem cell derived retinal pigment epithelial cells (hESC-RPE) in a clinically relevant setting. Differentiated hESC-RPE are transplanted into naive eyes or eyes with NaIO3-induced GA-like retinal degeneration using a 25 G transvitreal pars plana technique. Evaluation of degenerated and transplanted areas is performed by multimodal high-resolution non-invasive real-time imaging.

Retinal pigment epithelial cells could serve as a cell-replacement therapy for the advanced form of dry age-related macular degeneration. This protocol describes the generation of a large-eyed model of geographic atrophy and the subretinal transplantation of human embryonic stem cell-derived retinal pigment epithelial cells into this model of disease.

Geographic atrophy (GA), the late stage of dry age-related macular degeneration is characterized by loss of the retinal pigment epithelial (RPE) layer, ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...

Isolation, Culture, and Genetic Engineering of Mammalian Primary Pigment Epithelial Cells for Non-Viral Gene Therapy

Age-related macular degeneration (AMD) is the most frequent cause of blindness in patients &#62;60 years, affecting ~30 million people worldwide. AMD is a multifactorial disease influenced by environmental and genetic factors, which lead to functional impairment of the retina due to retinal pigment epithelial (RPE) cell degeneration followed by photoreceptor degradation. An ideal treatment would include the transplantation of healthy RPE cells secreting neuroprotective factors to prevent RPE cell death and photoreceptor degeneration. Due to the functional and genetic similarities and the possibility of a less invasive biopsy, the transplantation of iris pigment epithelial (IPE) cells was proposed as a substitute for the degenerated RPE. Secretion of neuroprotective factors by a low number of subretinally-transplanted cells can be achieved by Sleeping Beauty (SB100X) transposon-mediated transfection with genes coding for the pigment epithelium-derived factor (PEDF) and/or the granulocyte macrophage-colony stimulating factor (GM-CSF). We established the isolation, culture, and SB100X-mediated transfection of RPE and IPE cells from various species including rodents, pigs, and cattle. Globes are explanted and the cornea and lens are removed to access the iris and the retina. Using a custom-made spatula, IPE cells are removed from the isolated iris. To harvest RPE cells, a trypsin incubation may be required, depending on the species. Then, using RPE-customized spatula, cells are suspended in medium. After seeding, cells are monitored twice per week and, after reaching confluence, transfected by electroporation. Gene integration, expression, protein secretion, and function were confirmed by qPCR, WB, ELISA, immunofluorescence, and functional assays. Depending on the species, 30,000-5 million (RPE) and 10,000-1.5 million (IPE) cells can be isolated per eye. Genetically modified cells show significant PEDF/GM-CSF overexpression with the capacity to reduce oxidative stress and offers a flexible system for ex vivo&#160;analyses and in vivo studies transferable to humans to develop ocular gene therapy approaches.

Here, a protocol to isolate and transfect primary iris and retinal pigment epithelial cells from various mammals (mice, rat, rabbit, pig, and bovine) is presented. The method is ideally suited to study ocular gene therapy approaches in various set-ups for ex vivo&#160;analyses and&#160;in vivo studies transferable to humans.

Age-related macular degeneration (AMD) is the most frequent cause of blindness in patients &#62;60 years, affecting ~30 million people worldwide. AMD is a ...

Efficient Dissection and Culture of Primary Mouse Retinal Pigment Epithelial Cells

Eye disorders affect millions of people worldwide, but the limited availability of human tissues hinders their study. Mouse models are powerful tools to understand the pathophysiology of ocular diseases because of their similarities with human anatomy and physiology. Alterations in the retinal pigment epithelium (RPE), including changes in morphology and function, are common features shared by many ocular disorders. However, successful isolation and culture of primary mouse RPE cells is very challenging. This paper is an updated audiovisual version of the protocol previously published by Fernandez-Godino et al. in 2016 to efficiently isolate and culture primary mouse RPE cells. This method is highly reproducible and results in robust cultures of highly polarized and pigmented RPE monolayers that can be maintained for several weeks on Transwells. This model opens new avenues for the study of the molecular and cellular mechanisms underlying eye diseases. Moreover, it provides a platform to test therapeutic approaches that can be used to treat important eye diseases with unmet medical needs, including inherited retinal disorders and macular degenerations.

This protocol, which was originally reported by Fernandez-Godino et al. in 20161, describes a method to efficiently isolate and culture mouse RPE cells, which form a functional and polarized RPE monolayer within one week on Transwell plates. The procedure takes approximately 3 hours.

Eye disorders affect millions of people worldwide, but the limited availability of human tissues hinders their study. Mouse models are powerful tools to ...

Isolation of Epithelial Cells from Human Dental Follicle

The dental follicle (DF) was harvested during the removal of an impacted third molar by an oral maxillofacial surgeon. Epithelial cell isolation was performed on the day of DF harvest. The DF was washed three times with DPBS and then dissected with tissue scissors until the tissue had a pulpy or squishy consistency. Single-cell populations were pelleted by centrifugation and washed with keratinocyte serum-free medium. Heterogeneous cell populations were distributed in a culture dish. Keratinocyte serum-free medium was used to select the epithelial cells. The culture medium was changed daily until no floating debris or dead cells were observed. Epithelial cells appeared within 7-10 days after cell population distribution. Epithelial cells survived in serum-free medium, while &#945;-modification minimal essential medium supplemented with 10% fetal bovine serum allowed the proliferation of mesenchymal-type cells. The DF is a tissue source for the isolation of dental epithelial cells.
The purpose of this study was to establish a method for the isolation of epithelial cells from human DF. Periodontal ligament (PDL) was used for the isolation of human dental epithelial cells. Procuring epithelial cells from human PDL is not always successful due to the small tissue volume, leading to low numbers of epithelial cells. DF has a larger volume than PDL and contains more cells. DF can be a tissue source for the primary culture of human dental epithelial cells. This protocol is easier and more efficient than the isolation method using PDL. Procuring human dental epithelial cells may facilitate further studies of dental epithelial-mesenchymal interactions.

The dental follicle contains an epithelial population and mesenchymal cells. The epithelial population was selected from the heterogeneous dental follicle cell population by providing a distinct culture medium. Epithelial cells survived and formed colonies in a serum-free medium.

The dental follicle (DF) was harvested during the removal of an impacted third molar by an oral maxillofacial surgeon. Epithelial cell isolation was ...

Primary Culture of Porcine Retinal Pigment Epithelial Cells

The retinal pigment epithelium (RPE) is a monolayer of polarized pigmented epithelial cells, located between the choroid and neuroretina in the retina. Multiple functions, including phagocytosis, nutrient/metabolite transportation, vitamin A metabolism, etc., are conducted by the RPE on a daily basis. RPE cells are terminally differentiated epithelial cells with little or no regenerative capacity. Loss of RPE cells results in multiple eye diseases leading to visual impairment, such as age-related macular degeneration. Therefore, the establishment of an in vitro culture model of primary RPE cells, which more closely resembles the RPE in vivo than cell lines, is critical for the characteristic and mechanistic studies of RPE cells. Considering the fact that the source of human eyeballs is limited, we create a protocol to culture primary porcine RPE cells. By using this protocol, RPE cells can be easily dissociated from adult porcine eyeballs. Subsequently, these dissociated cells attach to culture dishes/inserts, proliferate to form a confluent monolayer, and quickly re-establish key features of epithelial tissue in vivo within 2 wks. By qRT-PCR, it is demonstrated that primary porcine RPE cells express multiple signature genes at comparable levels with native RPE tissue, while the expressions of most of these genes are lost/highly reduced in human RPE-like cells, ARPE-19. Moreover, the immunofluorescence staining shows the distribution of tight junction, tissue polarity, and cytoskeleton proteins, as well as the presence of RPE65, an isomerase critical for vitamin A metabolism, in cultured primary cells. Altogether, we have developed an easy-to-follow approach to culture primary porcine RPE cells with high purity and native RPE features, which could serve as a good model to understand RPE physiology, study cell toxicities, and facilitate drug screenings.

Here, an easy-to-follow method to culture primary porcine retinal pigment epithelial cells in vitro is presented.

The retinal pigment epithelium (RPE) is a monolayer of polarized pigmented epithelial cells, located between the choroid and neuroretina in the retina. ...

Isolation of Primary Mouse Retinal Pigmented Epithelium Cells

The retinal pigmented epithelium (RPE) layer lies immediately behind the photoreceptors and harbors a complex metabolic system that plays several critical roles in maintaining the photoreceptors' function. Thus, the RPE structure and function are essential to sustain normal vision. This manuscript presents an established protocol for primary mouse RPE cell isolation. RPE isolation is a great tool to investigate the molecular mechanisms underlying RPE pathology in the different mouse models of ocular disorders. Furthermore, RPE isolation can help in comparing primary mouse RPE cells isolated from wild-type and genetically modified mice, as well as testing drugs that can accelerate the development of therapy for visual disorders. The manuscript presents a step-by-step RPE isolation protocol; the entire procedure, from enucleation to seeding, takes approximately 4 hours. The media shouldn't be changed for 5-7 days after seeding, to allow the growth of the isolated cells without disturbance. This process is followed by the characterization of morphology, pigmentation, and specific markers in the cells via immunofluorescence. Cells can be passaged a maximum of three or four times.

This manuscript describes a simplified protocol for the isolation of retinal pigmented epithelium (RPE) cells from mouse eyes in a stepwise manner. The protocol includes the enucleation and dissection of mouse eyes, followed by the isolation, seeding, and culturing of RPE cells.

The retinal pigmented epithelium (RPE) layer lies immediately behind the photoreceptors and harbors a complex metabolic system that plays several critical ...