This work was supported by research grants from the United Arab Emirates University (UAEU), grant # 31R170 (Zayed Center for Health Sciences) and # 12R010 (UAEU-AUA grant). We thank Prof Randall Morse (Wadsworth Center, Albany, NY) for helping us to edit the manuscript for style and grammar.
All data are available upon request.

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent
<ol>
	<li>Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2 until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).</li>
	<li>Seed 4 x 106 cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids: 
	Entry vector = 10 &#181;g 
	psPAX2.0 = 7.5 &#181;g 
	pMD2.G = 5 &#181;g</li>
	<li>Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.</li>
	<li>Add 70 &#181;L of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (&#181;g):PEI (&#181;g).</li>
	<li>For lipofectamine-based transfection, dilute the above vectors in 500 &#181;L of serum-free DMEM media containing 45 &#181;L of reagent P supplied in the kit and incubate at room temperature for 5 min.</li>
	<li>Dilute 70 &#181;L of reagent L supplied in the kit using 500 &#181;L of serum-free DMEM media and incubate at room temperature for 5 min.</li>
	<li>Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.</li>
	<li>Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
</ol>
2. LVS collection and ultracentrifugation
<ol>
	<li>After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.</li>
	<li>After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.</li>
	<li>Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 &#176;C to pellet cellular debris.</li>
	<li>Filter the supernatant using a 0.45 &#181;m pore size low protein binding filter (either PES or SFCA) and store at 4 &#176;C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 &#176;C for 5 days without a significant loss in viral titers.</li>
	<li>Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 &#176;C.</li>
	<li>Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.</li>
	<li>Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.</li>
	<li>Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.</li>
	<li>Spin the tubes at 125,000 x g for 2 h at 4 &#176;C.</li>
	<li>After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.</li>
	<li>Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 &#181;L of sterile DPBS exactly at the top of the pellet. Keep at 4 &#176;C overnight undisturbed.</li>
	<li>The following day, gently mix by pipetting up and down 40x.</li>
	<li>Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.</li>
	<li>Transfer the supernatant to a new tube and aliquot the virus preparation as 20 &#181;L aliquots. Store at &#8722;80 &#176;C.</li>
	<li>Set aside 5 &#181;L of the preparation for viral titer measurements.</li>
</ol>
3. LVS titer measurement for pLKO.1-based vectors
<ol>
	<li>Determine the titer of lentiviral particles by using a qPCR following the manufacturer&#39;s recommendations.</li>
	<li>For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 &#181;L of DNA into 45 &#181;L of nuclease-free H2O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.</li>
	<li>Set up reactions on ice in duplicates in the following manner: 
	2x qPCR master mix&#160; &#160; &#160; &#160; 10 &#181;L 
	Primer mix&#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; &#160; 2 &#181;L 
	Sample or standard DNA&#160; &#160;2 &#181;L 
	Nuclease-free H2O&#160; &#160; &#160; &#160; &#160; &#160; 6 &#181;L</li>
	<li>Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.</li>
	<li>Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.</li>
	<li>Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.</li>
</ol>
4. LVS titer measurement for pll3.7-based vectors
<ol>
	<li>Seed 1 x 105 HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.</li>
	<li>Supplement the media with 8 &#181;g/mL polybrene and add 1 mL into each sterile 1.5 mL tube.</li>
	<li>Dilute the viral particles by using 4 &#181;L, 2 &#181;L, 1 &#181;L, 0.5 &#181;L, and 0.1 &#181;L of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.</li>
	<li>Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 &#181;g/mL polybrene and incubate for 24 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The next day, change to fresh media and continue the culture for 72 h at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>After 72 h, wash the cells with PBS, trypsinize at 37 &#176;C according to the manufacturer&#39;s protocol, and resuspend in 1 mL of PBS.</li>
	<li>Perform FACS cell sorting using a cell sorter, following the manufacturer&#39;s recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.</li>
	<li>Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.</li>
</ol>
5. Infection of hESCs and stable selection
<ol>
	<li>Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.</li>
	<li>Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37&#160;&#176;C for 5 min.</li>
	<li>Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.</li>
	<li>Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.</li>
	<li>Make a cell suspension with 2 x 105 cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI).</li>
	<li>Seed 1 x 105 cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 &#181;L of complete growth media and culture the cells at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2.</li>
	<li>The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 &#181;g/mL polybrene and incubate at 37 &#176;C for 8 h.</li>
	<li>After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.</li>
	<li>Start puromycin selection (0.8 &#181;g/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.</li>
	<li>After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.</li>
</ol>
6. Transduction of H9-derived neural progenitor cells (NPCs)
NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously19.
<ol>
	<li>Briefly, treat H9 cells with cell dissociation reagent at 37 &#176;C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 &#181;M ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm2 (day 0).</li>
	<li>Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 &#181;M) (day1).</li>
	<li>On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M).</li>
	<li>From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 &#181;M), and XAV939 (5 &#181;M) by increasing the N2 media 25% each day and changing the media after every 2 days.</li>
	<li>Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.</li>
	<li>Seed 2 x 105 cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.</li>
	<li>The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 &#181;g/mL polybrene.</li>
	<li>After 8 h, replace the virus-containing media with fresh NPC growth media.</li>
	<li>The next day, repeat the infections and change the media at 8 h.</li>
	<li>Keep the cells in culture for 72 h before harvesting for further analysis.</li>
</ol>

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282 (5391), 1145-1147 (1998).</li><li>Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+from+human+blastocysts:+Somatic+differentiation+in+vitro.">Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro.</a> Nature Biotechnology. 18 (4), 399-404 (2000).</li><li>Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cells+and+gene+therapy.">Human embryonic stem cells and gene therapy.</a> Molecular Therapy. 15 (5), 850-866 (2007).</li><li>Kane, N., McRae, S., Denning, C., Baker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+and+nonviral+gene+delivery+and+its+role+in+pluripotent+stem+cell+engineering.">Viral and nonviral gene delivery and its role in pluripotent stem cell engineering.</a> Drug Discovery Today. Technologies. 5 (4), 105 (2008).</li><li>Li, S. D., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+is+superior+to+viral+gene+delivery.">Nonviral is superior to viral gene delivery.</a> Journal of Controlled Release. 123 (3), 181-183 (2007).</li><li>Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+delivery+systems:+From+simple+transfection+agents+to+artificial+viruses.">Nonviral gene delivery systems: From simple transfection agents to artificial viruses.</a> Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).</li><li>Cao, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+gene-transfer+efficiency+in+human+embryonic+stem+cells.">Comparison of gene-transfer efficiency in human embryonic stem cells.</a> Molecular Imaging and Biology. 12 (1), 15-24 (2010).</li><li>Mohr, J. C., de Pablo, J. J., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+human+embryonic+stem+cells:+Small+and+macromolecule+loading+and+DNA+transfection.">Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection.</a> Biotechnology Progress. 22 (3), 825-834 (2006).</li><li>Sukhorukov, V. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surviving+high-intensity+field+pulses:+Strategies+for+improving+robustness+and+performance+of+electrotransfection+and+electrofusion.">Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion.</a> The Journal of Membrane Biology. 206 (3), 187-201 (2005).</li><li>Floch, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+phosphonolipids+as+non+viral+vectors+for+DNA+transfection+in+hematopoietic+cell+lines+and+CD34++cells.">Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells.</a> Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).</li><li>Lakshmipathy, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transfection+of+embryonic+and+adult+stem+cells.">Efficient transfection of embryonic and adult stem cells.</a> Stem Cells. 22 (4), 531-543 (2004).</li><li>Siemen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleofection+of+human+embryonic+stem+cells.">Nucleofection of human embryonic stem cells.</a> Stem Cells and Development. 14 (4), 378-383 (2005).</li><li>Zhang, X., Godbey, W. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+for+gene+delivery+in+tissue+engineering.">Viral vectors for gene delivery in tissue engineering.</a> Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).</li><li>Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+sustained+transgene+expression+in+human+embryonic+stem+cells+using+lentiviral+vectors.">High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors.</a> Stem Cells. 21 (1), 111-117 (2003).</li><li>Gropp, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+genetic+modification+of+human+embryonic+stem+cells+by+lentiviral+vectors.">Stable genetic modification of human embryonic stem cells by lentiviral vectors.</a> Molecular Therapy. 7 (2), 281-287 (2003).</li><li>Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HEK293+cell+line+as+a+platform+to+produce+recombinant+proteins+and+viral+vectors.">HEK293 cell line as a platform to produce recombinant proteins and viral vectors.</a> Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).</li><li>Merten, O. W., Hebben, M., Bovolenta, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+lentiviral+vectors.">Production of lentiviral vectors.</a> Molecular Therapy: Methods &amp; Clinical Development. 3, 16017 (2016).</li><li>Lungwitz, U., Breunig, M., Blunk, T., G&#246;pferich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+nonviral+gene+delivery+systems.">Polyethylenimine-based nonviral gene delivery systems.</a> European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation+during+in-vitro+human+embryonic+cortical+neurogenesis.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis.</a> Frontiers in Cellular Neuroscience. 11, 415 (2017).</li><li>Weissinger, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+in+purified+human+hematopoietic+peripheral-blood+stem+cells+by+means+of+electroporation+without+prestimulation.">Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation.</a> Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).</li><li>Cui, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+transgene+expression+to+antigen-presenting+cells+derived+from+lentivirus-transduced+engrafting+human+hematopoietic+stem/progenitor+cells.">Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells.</a> Blood. 99 (2), 399-408 (2002).</li><li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+with+two+independent+internal+promoters+transfer+high-level+expression+of+multiple+transgenes+to+human+hematopoietic+stem-progenitor+cells.">Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells.</a> Molecular Therapy. 7 (6), 827-838 (2003).</li><li>Sweeney, N. P., Vink, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+lentiviral+vector+genome+size+and+producer+cell+genomic+to+gag-pol+mRNA+ratios+on+packaging+efficiency+and+titre.">The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre.</a> Molecular Therapy - Methods &amp; Clinical Development. 21, 574-584 (2021).</li></ol>

The authors declare that there is no conflict of interest.

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods20. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased ...

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies7. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications11,12.
In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies13. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles14,15. Lipofection and CaPO4 precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles16. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO4 precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO4 precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations17. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.
Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods18. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 107 IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Invitrogen</td>
			<td>31350010</td>
			<td></td>
		</tr>
		<tr>
			<td>38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes</td>
			<td>Beckman Coulter</td>
			<td>C14292</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Stem Cell Technologies</td>
			<td>7920</td>
			<td></td>
		</tr>
		<tr>
			<td>bFGF Recombinant human</td>
			<td>Invitrogen</td>
			<td>PHG0261</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumin FRAC V</td>
			<td>Invitrogen</td>
			<td>15260037</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td>
			<td>Corning</td>
			<td>354234</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclopamine</td>
			<td>Stem Cell Technologies</td>
			<td>72074</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM media</td>
			<td>Invitrogen</td>
			<td>11995073</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM Nutrient mix F12&#160;</td>
			<td>Invitrogen</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS w/o: Ca and Mg</td>
			<td>PAN Biotech</td>
			<td>P04-36500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovie serum</td>
			<td>Invitrogen</td>
			<td>10270106</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH (14C10) Rabbit mAb Antibody</td>
			<td>CST</td>
			<td>2118S</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentle Cell Dissociation Reagent</td>
			<td>Stem Cell Technologies</td>
			<td>7174</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Non Essential Amino Acids (NEAA) 100X Solution</td>
			<td>GE healthcare</td>
			<td>SH30238.01</td>
			<td></td>
		</tr>
		<tr>
			<td>L Glutamine, 100X&#160;</td>
			<td>Invitrogen</td>
			<td>2924190090</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH Polyclonal antibody</td>
			<td>Proteintech</td>
			<td>15707-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH shRNA</td>
			<td>Macrogen</td>
			<td></td>
			<td>Seq: CGCATTCTTCATGTGAGAAAT</td>
		</tr>
		<tr>
			<td>Lipofectamine 3000 kit</td>
			<td>Thermo Fisher</td>
			<td>L3000001</td>
			<td></td>
		</tr>
		<tr>
			<td>mTesR1 complete media</td>
			<td>Stem Cell Technologies</td>
			<td>85850</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal medium 1X CTS</td>
			<td>Invitrogen</td>
			<td>A1371201</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 2 Supplement 100x</td>
			<td>PAN Biotech</td>
			<td>P07-11050</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 27 Supplement 50x</td>
			<td>PAN Biotech</td>
			<td>P07-07200</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin streptomycin SOL</td>
			<td>Invitrogen</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>pLKO.1 TRC vector</td>
			<td>Addgene</td>
			<td>10878</td>
			<td></td>
		</tr>
		<tr>
			<td>pLL3.7 vector&#160;</td>
			<td>Addgene</td>
			<td>11795</td>
			<td></td>
		</tr>
		<tr>
			<td>pMD2.G</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene infection reagent</td>
			<td>Sigma</td>
			<td>TR1003- G</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, branched</td>
			<td>Sigma</td>
			<td>408727</td>
			<td></td>
		</tr>
		<tr>
			<td>psPAX2.0</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr>
			<td>Purmorphamine</td>
			<td>Tocris</td>
			<td>4551/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invitrogen</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr>
			<td>ROCK inhibitor Y-27632 
			dihydrochloride&#160;</td>
			<td>Tocris</td>
			<td>1254</td>
			<td></td>
		</tr>
		<tr>
			<td>SB 431542</td>
			<td>Tocris</td>
			<td>1614/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin .05% EDTA&#160;</td>
			<td>Invitrogen</td>
			<td>25300062</td>
			<td></td>
		</tr>
		<tr>
			<td>XAV 939</td>
			<td>Tocris</td>
			<td>3748/10</td>
			<td></td>
		</tr>
	</tbody>
</table>

lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 107. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency20. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa...

Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) ...

lentiviral-mediated-delivery-shrnas-to-hescs-npcs-using-low-cost

Research

JoVE Journal

Biology

2.3K Views.  United Arab Emirates University. Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency. 

Video: Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

From MEFs to Matrigel I: Passaging hESCs in the Presence of MEFs

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells.


This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells. Part 1 of 3.

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells.
...

From MEFs to Matrigel 2: Splitting hESCs from MEFs onto Matrigel

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells, how to passage hESCs from MEF plates to feeder cell-free Matrigel plates.


This video demonstrates how to maintain the growth of human embryonic stem cells (hESCs) in feeder cell-free conditions and how to continuously passage hESCs in feeder cell-free conditions. Confirmation of hESC pluripotency grown in feeder cell-free conditions by immunofluorescence microscopy is also demonstrated. Part 2 of 3.

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells, how to passage hESCs from MEF ...

From MEFs to Matrigel 3: Passaging hESCs from Matrigel onto Matrigel

This video demonstrates how to maintain the growth of human embryonic stem cells (hESCs) in feeder cell-free conditions and how to continuously passage hESCs in feeder cell-free conditions. Confirmation of hESC pluripotency grown in feeder cell-free conditions by immunofluorescence microscopy is also demonstrated.

This video demonstrates how to maintain the growth of human embryonic stem cells (hESCs) in feeder cell-free conditions and how to continuously passage hESCs in feeder cell-free conditions. Confirmation of hESC pluripotency grown in feeder cell-free conditions by immunofluorescence microscopy is also demonstrated. Part 3 of 3.

This video demonstrates how to maintain the growth of human embryonic stem cells (hESCs) in feeder cell-free conditions and how to continuously passage ...

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

Erythropoiesis is a commonly used model system to study cell differentiation. During erythropoiesis, pluripotent adult human hematopoietic stem cells (HSCs) differentiate into oligopotent progenitors, committed precursors and mature red blood cells 1. This process is regulated for a large part at the level of gene expression, whereby specific transcription factors activate lineage-specific genes while concomitantly repressing genes that are specific to other cell types 2. Studies on transcription factors regulating erythropoiesis are often performed using human and murine cell lines that represent, to some extent, erythroid cells at given stages of differentiation 3-5. However transformed cell lines can only partially mimic erythroid cells and most importantly they do not allow one to comprehensibly study the dynamic changes that occur as cells progress through many stages towards their final erythroid fate. Therefore, a current challenge remains the development of a protocol to obtain relatively homogenous populations of primary HSCs and erythroid cells at various stages of differentiation in quantities that are sufficient to perform genomics and proteomics experiments.
Here we describe an ex vivo cell culture protocol to induce erythroid differentiation from human hematopoietic stem/progenitor cells that have been isolated from either cord blood, bone marrow, or adult peripheral blood mobilized with G-CSF (leukapheresis). This culture system, initially developed by the Douay laboratory 6, uses cytokines and co-culture on mesenchymal cells to mimic the bone marrow microenvironment. Using this ex vivo differentiation protocol, we observe a strong amplification of erythroid progenitors, an induction of differentiation exclusively towards the erythroid lineage and a complete maturation to the stage of enucleated red blood cells. Thus, this system provides an opportunity to study the molecular mechanism of transcriptional regulation as hematopoietic stem cells progress along the erythroid lineage. 
Studying erythropoiesis at the transcriptional level also requires the ability to over-express or knockdown specific factors in primary erythroid cells. For this purpose, we use a lentivirus-mediated gene delivery system that allows for the efficient infection of both dividing and non-dividing cells 7. Here we show that we are able to efficiently knockdown the transcription factor TAL1 in primary human erythroid cells. In addition, GFP expression demonstrates an efficiency of lentiviral infection close to 90%. Thus, our protocol provides a highly useful system for characterization of the regulatory network of transcription factors that control erythropoiesis.

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

An ex vivo protocol to generate mature human red blood cells from hematopoietic stem/progenitors is described. Additionally we describe an efficient lentiviral-delivery method to knockdown the transcription factor TAL1 in primary erythroid cells. The efficiency of lentivirus mediated gene delivery is demonstrated using GFP expressing viruses.

Erythropoiesis is a commonly used model system to study cell differentiation. During erythropoiesis, pluripotent adult human hematopoietic stem cells ...

Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Using the STEMCCA Lentiviral Vector

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, generating so-called induced pluripotent stem cells (iPSCs)1-4. Patient-specific iPSCs lack the ethical concerns that surround embryonic stem cells (ESCs) and would bypass possible immune rejection. Thus, iPSCs have attracted considerable attention for disease modeling studies, the screening of pharmacological compounds, and regenerative therapies5.
We have shown the generation of transgene-free human iPSCs from patients with different lung diseases using a single excisable polycistronic lentiviral Stem Cell Cassette (STEMCCA) encoding the Yamanaka factors6. These iPSC lines were generated from skin fibroblasts, the most common cell type used for reprogramming. Normally, obtaining fibroblasts requires a skin punch biopsy followed by expansion of the cells in culture for a few passages. Importantly, a number of groups have reported the reprogramming of human peripheral blood cells into iPSCs7-9. In one study, a Tet inducible version of the STEMCCA vector was employed9, which required the blood cells to be simultaneously infected with a constitutively active lentivirus encoding the reverse tetracycline transactivator. In contrast to fibroblasts, peripheral blood cells can be collected via minimally invasive procedures, greatly reducing the discomfort and distress of the patient. A simple and effective protocol for reprogramming blood cells using a constitutive single excisable vector may accelerate the application of iPSC technology by making it accessible to a broader research community. Furthermore, reprogramming of peripheral blood cells allows for the generation of iPSCs from individuals in which skin biopsies should be avoided (i.e. aberrant scarring) or due to pre-existing disease conditions preventing access to punch biopsies.
Here we demonstrate a protocol for the generation of human iPSCs from peripheral blood mononuclear cells (PBMCs) using a single floxed-excisable lentiviral vector constitutively expressing the 4 factors. Freshly collected or thawed PBMCs are expanded for 9 days as described10,11 in medium containing ascorbic acid, SCF, IGF-1, IL-3 and EPO before being transduced with the STEMCCA lentivirus. Cells are then plated onto MEFs and ESC-like colonies can be visualized two weeks after infection. Finally, selected clones are expanded and tested for the expression of the pluripotency markers SSEA-4, Tra-1-60 and Tra-1-81. This protocol is simple, robust and highly consistent, providing a reliable methodology for the generation of human iPSCs from readily accessible 4 ml of blood.

Here we show a simple and effective protocol for the generation of human iPSCs from 3-4 ml of peripheral blood using a single lentiviral reprogramming vector. Reprogramming of readily available blood cells promises to accelerate the utilization of iPSC technology by making it accessible to a broader research community.

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, ...

Long-term Silencing of Intersectin-1s in Mouse Lungs by Repeated Delivery of a Specific siRNA via Cationic Liposomes. Evaluation of Knockdown Effects by Electron Microscopy

Previous studies showed that knockdown of ITSN-1s (KDITSN), an endocytic protein involved in regulating lung vascular permeability and endothelial cells (ECs) survival, induced apoptotic cell death, a major obstacle in developing a cell culture system with prolonged ITSN-1s inhibition1. Using cationic liposomes as carriers, we explored the silencing of ITSN-1s gene in mouse lungs by systemic administration of siRNA targeting ITSN-1 gene (siRNAITSN). Cationic liposomes offer several advantages for siRNA delivery: safe with repeated dosing, nonimmunogenic, nontoxic, and easy to produce2. Liposomes performance and biological activity depend on their size, charge, lipid composition, stability, dose and route of administration3Here, efficient and specific KDITSN in mouse lungs has been obtained using a cholesterol and dimethyl dioctadecyl ammonium bromide combination. Intravenous delivery of siRNAITSN/cationic liposome complexes transiently knocked down ITSN-1s protein and mRNA in mouse lungs at day 3, which recovered after additional 3 days. Taking advantage of the cationic liposomes as a repeatable safe carrier, the study extended for 24 days. Thus, retro-orbital treatment with freshly generated complexes was administered every 3rd day, inducing sustained KDITSN throughout the study4. Mouse tissues collected at several time points post-siRNAITSN were subjected to electron microscopy (EM) analyses to evaluate the effects of chronic KDITSN, in lung endothelium. High-resolution EM imaging allowed us to evaluate the morphological changes caused by KDITSN in the lung vascular bed (i.e. disruption of the endothelial barrier, decreased number of caveolae and upregulation of alternative transport pathways), characteristics non-detectable by light microscopy. Overall these findings established an important role of ITSN-1s in the ECs function and lung homeostasis, while illustrating the effectiveness of siRNA-liposomes delivery in vivo.

Repeated retro-orbital injections of cationic liposomes/siRNA/ITSN-1s complexes in mice, every 72 hours for 24 days, efficiently deliver the siRNA duplex to the mouse lung microvasculature reducing ITSN-1s mRNA and protein expression by 75%. This technique is highly reproducible in an animal model, has no adverse effects and avoids fatalities.

Previous  studies showed that knockdown of ITSN-1s (KDITSN), an endocytic  protein involved in regulating lung vascular permeability and endothelial cells ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Generation of Myospheres From hESCs by Epigenetic Reprogramming

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based therapies and for a "disease in a dish" model of human neuromuscular diseases. Major hurdles, such as low abundance and heterogeneity of the population of interest, as well as a lack of protocols for the formation of three-dimensional contractile structures, have limited the applications of stem cells for neuromuscular disorders. We have designed a protocol that overcomes these limits by ectopic introduction of defined factors in hESCs - the muscle determination factor MyoD and SWI/SNF chromatin remodeling complex component BAF60C - that are able to reprogram hESCs into skeletal muscle cells. Here we describe the protocol established to generate hESC-derived myoblasts and promote their clustering into tridimensional miniaturized structures (myospheres) that functionally mimic miniaturized skeletal muscles7.

Here, we describe a protocol based on epigenetic reprogramming of human embryonic stem cells (hESCs) toward generating a homogeneous population of skeletal muscle progenitors that under permissive culture conditions form three-dimensional clusters of contractile myofibers (myospheres), which recapitulate biological features of human skeletal muscles.

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based ...

Phosphopeptide Analysis of Rodent Epididymal Spermatozoa

Spermatozoa are quite unique amongst cell types. Although produced in the testis, both nuclear gene transcription and translation are switched off once the pre-cursor round cell begins to elongate and differentiate into what is morphologically recognized as a spermatozoon. However, the spermatozoon is very immature, having no ability for motility or egg recognition. Both of these events occur once the spermatozoa transit a secondary organ known as the epididymis. During the ~12 day passage that it takes for a sperm cell to pass through the epididymis, post-translational modifications of existing proteins play a pivotal role in the maturation of the cell. One major facet of such is protein phosphorylation. In order to characterize phosphorylation events taking place during sperm maturation, both pure sperm cell populations and pre-fractionation of phosphopeptides must be established. Using back flushing techniques, a method for the isolation of pure spermatozoa of high quality and yield from the distal or caudal epididymides is outlined. The steps for solubilization, digestion, and pre-fractionation of sperm phosphopeptides through TiO2 affinity chromatography are explained. Once isolated, phosphopeptides can be injected into MS to identify both protein phosphorylation events on specific amino acid residues and quantify the levels of phosphorylation taking place during the sperm maturation processes.

Proteomic analysis of any cell type is highly dependent on both purity and pre-fractionation of the starting material in order to de-complexify the sample prior to liquid chromatography mass spectrometry (MS). By using back-flushing techniques, pure spermatozoa can be obtained from rodents. Following digestion, phosphopeptides can be enriched using TiO2.

Spermatozoa are quite unique amongst cell types. Although produced in the testis, both nuclear gene transcription and translation are switched off once ...

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth factors. Since organoids are highly similar to the original tissue in terms of homeostatic stem cell differentiation, cell polarity and presence of all terminally differentiated cell types known to the adult intestinal epithelium, they serve as an essential resource in experimental research on the epithelium. The possibility to express transgenes or interfering RNA using lentiviral or retroviral vectors in organoids has increased opportunities for functional analysis of the intestinal epithelium and intestinal stem cells, surpassing traditional mouse transgenics in speed and cost. In the current video protocol we show how to utilize transduction of small intestinal organoids with lentiviral vectors illustrated by use of doxycylin inducible transgenes, or IPTG inducible short hairpin RNA for overexpression or gene knockdown. Furthermore, considering organoid culture yields minute cell counts that may even be reduced by experimental treatment, we explain how to process organoids for downstream analysis aimed at quantitative RT-PCR, RNA-microarray and immunohistochemistry. Techniques that enable transgene expression and gene knock down in intestinal organoids contribute to the research potential that these intestinal epithelial structures hold, establishing organoid culture as a new standard in cell culture.

In this video protocol we give a step by step explanation of lentiviral transduction in organoids of primary intestinal epithelium and of processing and downstream analysis of these cultures by quantitative RT-PCR, RNA-microarray and immunohistochemistry.

Intestinal crypt-villus structures termed organoids, can be kept in sustained culture three dimensionally when supplemented with the appropriate growth ...

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Summary

Explore More Videos

Chapters in this video

From MEFs to Matrigel I: Passaging hESCs in the Presence of MEFs

From MEFs to Matrigel 2: Splitting hESCs from MEFs onto Matrigel

From MEFs to Matrigel 3: Passaging hESCs from Matrigel onto Matrigel

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Using the STEMCCA Lentiviral Vector

Long-term Silencing of Intersectin-1s in Mouse Lungs by Repeated Delivery of a Specific siRNA via Cationic Liposomes. Evaluation of Knockdown Effects by Electron Microscopy

Using Coculture to Detect Chemically Mediated Interspecies Interactions

Generation of Myospheres From hESCs by Epigenetic Reprogramming

Phosphopeptide Analysis of Rodent Epididymal Spermatozoa

A Protocol for Lentiviral Transduction and Downstream Analysis of Intestinal Organoids