We would like to thank Dr. Wesley Wang for laying the groundwork for this protocol and his valuable mentorship.&#160;This work was partially supported by National Institutes of Health (Grants R01GM127575 and R01GM121584) and Welch Foundation (Grant A-1715).

1.&#160;Plasmid construction
<ol>
	<li>Begin by deciding which histone protein will be acetylated and at which lysine site. Mutate the site to the amber stop codon (TAG) using site directed mutagenesis. 
	&#8203;NOTE: There are four previously designed plasmids utilized for expression of histone proteins. All four histone proteins were cloned into the pETDuet-1 vector with an N-terminal histidine tag. Histone H4 also includes a SUMO tag, the origin of replication colE1 with a copy number of approximately 40, ampicillin resistant, and a T7 promoter.
	<ol>
		<li>Design forward and reverse primers that contain a TAG mutation at the desired site (replacing an existing lysine codon with the amber stop codon) in one of the four histone protein plasmids.</li>
		<li>Use whole-plasmid PCR to amplify the TAG containing plasmid. Determine an appropriate annealing temperature for the primers. In general, the melting temperature (Tm) of the primers minus 5 &#176;C will be sufficient. If difficulty is experienced obtaining a PCR product, a temperature gradient around Tm - 5 &#176;C can be used to optimize the annealing temperature for amplification. 
		NOTE: In this experiment an in-house expressed PFU polymerase was used for 30 cycles with the following conditions: 94 &#176;C for 30 s (denaturation), annealing temperature for 30 s, and 72 &#176;C for 6 min (or 1 min per kilobase-pairs). For more details on this type of PCR method see Liu and Naismith7.</li>
		<li>Clean up the PCR product with a PCR clean up kit by following the manufacturer&#39;s protocol. Analyze the PCR product by agarose gel electrophoresis and subsequent ethidium bromide staining.</li>
		<li>Ligate the plasmid by incubating with T4 ligase overnight at 16 &#176;C.</li>
	</ol>
	</li>
	<li>First transform the TAG containing plasmid (AmpR) into chemically competent Escherichia coli. Pick a minimum of 4 colonies from the transformation and purify the plasmid. Make cell stocks of each with glycerol using standard methods and store at -80 &#176;C. Send for sequencing to confirm the desired TAG mutation.</li>
	<li>Once the sequence is confirmed, co-transform the TAG-containing plasmid (AmpR) with pEVOL-AckRS (ChlR) into chemically competent CobB (the only histone lysine deacetylase known in E. coli.) deletion BL21 cells using the heat shock method. pEVOL is a plasmid with a mid-copy-number to low-copy-number p15A origin. 
	NOTE: The pEVOL series of plasmids were constructed based on previous studies that showed an increased expression of the orthogonal aaRS/tRNATyr pair was effective in decreasing protein truncation and in increasing overall yields of mutant proteins8. If CobB deletion cells are not accessible, proceed with chemically competent BL21 cells. CobB is a Sirtuin-like histone lysine deacetylase and Nicotinamide can be added at a 5 mM final concentration during histone protein expression to inhibit CobB as an alternative approach9.</li>
	<li>Make a cell stock and store at -80 &#176;C.</li>
</ol>
2. Acetylated histone protein expression
<ol>
	<li>Prepare 1 L of autoclaved 2YT media (or volume of choice) in a culture flask.</li>
	<li>Inoculate 20 mL of 2YT media containing the appropriate antibiotics with the co-transformed cell stock that has the TAG-containing plasmid (AmpR) and pEVOL-AckRS (ChlR) and grow at 37 &#176;C to OD = 0.6 (4-6 h).</li>
	<li>Add the appropriate antibiotics to the 1 L of autoclaved 2YT media and inoculate with the 20 mL starter culture. Grow at 37 &#176;C to OD = 0.6-0.8 (2-3 h).</li>
	<li>Add inducing agents and acetyllysine (AcK) to the final concentrations of IPTG 1 mM, 0.2% arabinose, and AcK 5 mM.</li>
	<li>Grow the culture at 37 &#176;C for 6-8 h.</li>
	<li>Pellet cells at 2,700 x g for 15 min.</li>
	<li>Store the cell pellet at -80 &#176;C overnight.</li>
	<li>From this step onwards keep the sample on ice all times. Dissolve the cell pellet in 50 mL of histone lysis buffer per 1 L of culture.</li>
	<li>Sonicate according to the following cycle: 1 s on, 1 s off, total on time: 3 min at 60% amplitude.</li>
	<li>Pellet inclusion bodies at 41,600 x g for 45 min.</li>
	<li>Discard the supernatant and resuspend inclusion bodies in 30 mL of histone lysis buffer. Pellet inclusion bodes at 41,600 x g for 30 min.</li>
	<li>Discard the supernatant and resuspend inclusion bodies in 30 mL of pellet wash buffer. Pellet inclusion bodies at 41,600 x g for 30 min.</li>
	<li>Discard the supernatant and dissolve inclusion bodies in 25 mL of 6 M Guanidine Hydrochloride (GuHCl) buffer. Incubate with agitation at 37 &#176;C for 1 h. 
	NOTE: If needed, inclusion bodies can be incubated with agitation overnight at 4 &#176;C.</li>
	<li>Pellet inclusion bodes at 41,600 x g for 45 min. Incubate the supernatant with 1 mL of Ni-NTA resin equilibrated with 6 M GuHCl buffer for 2 h.</li>
	<li>Proceed with Ni-NTA purification under denatured conditions. Wash the column with 3 column volumes of column wash buffer. Elute acetylated histone protein with 10 mL of elution buffer. 
	NOTE: Attempting to concentrate the protein here is an option but acetylated histones are very unpredictable and can easily precipitate. It is not recommended to concentrate past 2 mL in total volume.</li>
	<li>Extensively dialyze the acetylated histone protein against 5% acetic acid buffer to remove salts. Dialyze for 3 h at a time at&#160;4 &#176;C, exchanging for fresh buffer a minimum of 6 times. 
	NOTE: For improved protein purity, there is an option to dialyze against pure water. However, this causes significant precipitation and reduction in yield which may be undesirable for low-yielding acetylated histone proteins.</li>
	<li>Aliquot and lyophilize protein, and store indefinitely at -80 &#176;C. Wild type histone proteins generally yield 10-50 mg/L whereas acetylated histone proteins yield less than 10 mg/L depending on the specific lysine site. For example, H3K79Ac averages 5 mg/L.</li>
</ol>
3. Wild-type histone protein expression
<ol>
	<li>To assemble full nucleosomes, express all 4 histone proteins. When expressing and purifying wild type histones the protocol is the same as the acetylated histones except the following:
	<ol>
		<li>Do not perform co-transformation. Do not use pEVOL-AcKRS for wild type histone expression. Adjust antibiotics accordingly.</li>
		<li>Do not use a CobB deletion cell line or add Nicotinamide, AcK, or arabinose during induction of cellular expression.</li>
	</ol>
	</li>
</ol>
4. Preparation of 601 DNA
NOTE: A previously designed optimized DNA sequence to direct nucleosome positioning is assembled with histone octamers to produce mononucleosome with high efficiency. This sequence is referred to as 601 DNA or the Widom sequence. This sequence has become the standard DNA sequence for in vitro studies of nucleosomes from chromatin remodeling assays to single molecule measurements10.
<ol>
	<li>To prepare significant quantities of 601 DNA for nucleosome assembly, transform pGEM-3z/601 into Top 10 cells and grow 10 mL of culture for plasmid amplification and extraction. Use a plasmid extraction kit and follow manufacturer&#39;s recommendation.</li>
	<li>Use an in-house expressed PFU polymerase (more efficient) for this amplification protocol. Set up a PCR reaction: For 250 &#181;L reaction, use 207.5 &#181;L autoclaved MQ H2O, 25 &#181;L 10x PFU Buffer, 5 &#181;L Forward Primer: ctggagaatcccggtgccg, 5 &#181;L Reverse Primer: acaggatgtatatatctgacacg, 5 &#181;L dNTP mix, 2.5 &#181;L PFU enzyme.&#160;We typically run 60 reactions at once to get enough DNA to assemble.</li>
	<li>Use an annealing temperature of 52 &#176;C for 30 s and an extension time of 30 s if using PFU polymerase. Otherwise follow the manufacturers recommended conditions.</li>
	<li>Once PCR is done, use a PCR clean up kit of choice to purify the PCR product.</li>
</ol>
5. Assembly of histone octamer
<ol>
	<li>Dissolve aliquots of histone protein pellets H2A, H2B, H3, and H4 so that there is a separate stock of each histone protein in GuHCl Buffer with a total volume of 100 &#181;L.</li>
	<li>Calculate the concentration of each histone protein by measuring the A280 absorbance.</li>
	<li>If absorbance is greater than 1 for any protein, dilute with GuHCl buffer to get a more accurate concentration.</li>
	<li>Combine H2A and H2B proteins in a 1:1 molar ratio and dilute to a total protein concentration of 4 &#181;g/&#181;L. Repeat for H3 and H4.</li>
	<li>Dialyze sequentially at 4 &#176;C against 2 M TE buffer overnight, 1 M TE buffer for 2 h and 0.5 M TE buffer for 5 h. 
	NOTE: The second and third steps of dialysis causes unstable conformations of protein to precipitate out. It is expected to see heavy precipitation at these steps.</li>
	<li>Remove precipitates by centrifugation at 16,800 x g at 4 &#176;C.</li>
	<li>Again, calculate the concentration of histone dimers (H2A/H2B mixture) and tetramers (H3/H4 mixture) measuring the A280 absorbance.</li>
	<li>Mix dimers and tetramers in a 1:1 molar ratio and adjust NaCl to 2 M by the addition of solid NaCl.</li>
	<li>Histone octamer can be stored at 4 &#176;C and is more stable than dimers and tetramers. Never freeze histone octamer as this can cause disassembly.</li>
	<li>If assembling with acetylated histones, simply replace the wild type protein with the acetylated protein in the procedure.</li>
</ol>
6. Nucleosome assembly
<ol>
	<li>Use 100x TE buffer and solid NaCl to adjust 601 DNA to 2M TE buffer. Add the 601 DNA in 2M TE buffer to histone octamer in a molar ratio of 0.85:1 to 0.90:1. A lower ratio of DNA may be added if free DNA is present in the gel shift analysis.</li>
	<li>Transfer the DNA-histone mixture a dialysis bag and place in about 200 mL of 2M TE buffer (or more if assembling multiple samples) and very gently stir at 4 &#176;C.</li>
	<li>Set a peristaltic pump to purge to slowly drip in no salt TE buffer. When the volume has roughly doubled, pour out half the volume. Do this at least 4 times in total. With a pump this can take 4-8 h depending on the starting volume. Nucleosomes form when the salt concentration is reduced to 150 mM (measured by salinity meter).</li>
	<li>After the salt concentration is reduced to 150 mM, dialyze against a 20 mM TE buffer overnight.</li>
	<li>Remove precipitates by centrifugation and measure the concentration of the nucleosomes by A260 reading using a plate reader.</li>
	<li>Add His-TEV protease (TEV: nucleosome 1:30, w:w ) and incubate&#160;overnight at 4 &#176;C to remove all histidine tags. Remove the histidine tag impurities from the nucleosome solution by Ni-NTA resin pull down.</li>
	<li>To position the nucleosome and homogenize the sample, incubate at 60 &#176;C for 1 h. 
	NOTE: For acetylated sites that are particularly unstable, this step may not be advisable.</li>
	<li>Store nucleosomes for short term (a few weeks) at 4 &#176;C.</li>
	<li>For long-term storage, dialyze nucleosomes against storage buffer and store at -80 &#176;C.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

There are no competing financial interests to declare by any of the authors.

It is essential to follow this protocol in every detail during an experiment. Nucleosomes are not very stable and much trial and error has gone into determining this protocol. It is key to remove precipitates at every step (or whenever observed) because particulates can easily interfere with the assembling processes. Always keep histone samples on ice. If nucleosomes are stored at 4 &#176;C for too long, they can spontaneously disassemble. Be sure to check any samples by Native PAGE if stored at 4 &#176;C for more than 2...

We have utilized PylRS and tRNAPyl to synthesize and assemble reconstituted mononucleosomes with site specific acetylated histones. PylRS has proven invaluable as a genetic code expansion tool to produce proteins with post translational modifications (PTMs) and has been genetically evolved to incorporate about 200 different ncAAs. PylRS incorporates at an amber stop codon, removing competition from other amino acids during translation. PylRS was first discovered in methanogenic archaea, and has since been utilized in chemical biology to incorporate novel reactive chemical groups into proteins1,2.
MmAcKRS1 was evolved from Methanosarcina mazei PylRS and frequently used in our laboratory for the synthesis of acetylated proteins3,4,5,6. MmAcKRS1 delivers AcK at an amber mutation site in the mRNA of choice during translation in Escherichia coli. This technique has been previously used to incorporate AcK at K4, K9, K14, K18, K23, K27, K36, K56, K64, and K79 histone H3 lysine sites to study the activity of Sirtuin 1, 2, 6, and 7 on acetylated mononucleosomes4,5,6. Here we detail this method to express acetylated histones and reconstitute acetylated nucleosomes.

<table><tbody><tr><td>0.5 M TE Buffer</td><td>NA</td><td>NA</td><td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>1 M TE Buffer</td><td>NA</td><td>NA</td><td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>100x TE Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>2 M TE Buffer</td><td>NA</td><td>NA</td><td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>20 mM TE Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td></tr><tr><td>6 M GuHCl</td><td></td><td></td><td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td></tr><tr><td>Acetyllysine</td><td></td><td></td><td></td></tr><tr><td>Column Wash Buffer</td><td>NA</td><td>NA</td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td></tr><tr><td>Elution Buffer</td><td>NA</td><td>NA</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Variable-Flow Chemical Transfer Pump</td><td>Fischer Scientific</td><td>15-077-67</td><td></td></tr><tr><td>His-TEV protease</td><td></td><td></td><td></td></tr><tr><td>Histone Lysis Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td></tr><tr><td>Ni-NTA Resin</td><td></td><td></td><td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td></tr><tr><td>PCR Clean-Up Kit</td><td>Epoch Life Sicences</td><td>2360050</td><td></td></tr><tr><td>Pellet Wash Buffer</td><td>NA</td><td>NA</td><td>60 mM Tris, 100 mM NaCl, pH 8.0</td></tr><tr><td>petDUET-His-SUMO-TEV-H4</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2A</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H2B</td><td></td><td></td><td></td></tr><tr><td>petDUET-His-TEV-H3</td><td></td><td></td><td></td></tr><tr><td>pEVOL-AckRS</td><td>Addgene</td><td>137976</td><td></td></tr><tr><td>pGEM-3z/601</td><td>Addgene</td><td>26656</td><td></td></tr><tr><td>Storage Buffer</td><td>NA</td><td>NA</td><td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr></tbody></table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi pyrrolysine tRNA-synthetase (MmAcKRS1) and its cognate tRNA (tRNAPyl) to assemble reconstituted mononucleosomes with site specific acetylated histones. MmAcKRS1 and tRNAPyl deliver AcK at an amber mutation site in the mRNA of choice during translation in Escherichia coli. This technique has been used extensively to incorporate AcK at H3 lysine sites. Pyrrolysyl-tRNA synthetase (PylRS) can also be easily evolved to incorporate other noncanonical amino acids (ncAAs) for site specific protein modification or functionalization. Here we detail a method to incorporate AcK using the MmAcKRS1 system into histone H3 and integrate acetylated H3 proteins into reconstituted mononucleosomes. Acetylated reconstituted mononucleosomes can be used in biochemical and binding assays, structure determination, and more. Obtaining modified mononucleosomes is crucial for designing experiments related to discovering new interactions and understanding epigenetics.

Dimers, tetramers, and octamers can be assessed by running a 12% SDS PAGE gel (Figure 1 and Figure 2). Here you can see that some of the acetylated tetramers have a lower yield than others (Figure 1). In fact, the closer to the core region, the lower the yield observed. This is most likely due to the acetylation interfering with the assembling of the tetramer the closer you get to the core regions. A...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Here we present a method to express acetylated histone proteins using genetic code expansion and assemble reconstituted nucleosomes in vitro.

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. Here we present a method to express acetylated histone proteins using genetic code expansion and assemble reconstituted nucleosomes in vitro.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Analysis of Histone Antibody Specificity with Peptide Microarrays

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The mass production and distribution of antibodies specific to histone PTMs has greatly facilitated research on these marks. As histone PTM antibodies are key reagents for many chromatin biochemistry applications, rigorous analysis of antibody specificity is necessary for accurate data interpretation and continued progress in the field. This protocol describes an integrated pipeline for the design, fabrication and use of peptide microarrays for profiling the specificity of histone antibodies. The design and analysis aspects of this procedure are facilitated by ArrayNinja, an open-source and interactive software package we recently developed to streamline the customization of microarray print formats. This pipeline has been used to screen a large number of commercially available and widely used histone PTM antibodies, and data generated from these experiments are freely available through an online and expanding Histone Antibody Specificity Database. Beyond histones, the general methodology described herein can be applied broadly to the analysis of PTM-specific antibodies.

This manuscript describes methods for applying peptide microarray technology to specificity profiling of antibodies that recognize histones and their post-translational modifications.

Post-translational modifications (PTMs) on histone proteins are widely studied for their roles in regulating chromatin structure and gene expression. The ...

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

Chemistry

Detection of Post-translational Modifications on Native Intact Nucleosomes by ELISA

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 base pairs of DNA associated with two each of histones H2A, H2B, H3, and H41. The N-terminal tails of histones are rich in lysine and arginine and are modified post-transcriptionally by acetylation, methylation, and other post-translational modifications (PTMs). The PTM configuration of nucleosomes can affect the transcriptional activity of associated DNA, thus providing a mode of gene regulation that is epigenetic in nature 2,3. We developed a method called nucleosome ELISA (NU-ELISA) to quantitatively determine global PTM signatures of nucleosomes extracted from cells. NU-ELISA is more sensitive and quantitative than western blotting, and is useful to interrogate the epiproteomic state of specific cell types. This video journal article shows detailed procedures to perform NU-ELISA analysis.

Nucleosome ELISA (NU-ELISA) is a sensitive and quantitative method to detect global patterns of post-translational modifications in preparations of native, intact nucleosomes. These modifications include methylations, acetylations, and phosphorylations at specific histone amino acid residues, and hence NU-ELISA provides a global proteomic assay of the overall chromatin modification states of specific cell types.

The genome of eukaryotes exists as chromatin which contains both DNA and proteins. The fundamental unit of chromatin is the nucleosome, which contains 146 ...

Biology

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Bioengineering

In Situ Nucleosome Reconstitution for Single-Molecule Studies

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

Author Spotlight: Efficient Nucleosome Reconstitution for Single-Molecule Techniques

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Immunology and Infection

Application of MassSQUIRM for Quantitative Measurements of Lysine Demethylase Activity

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small molecule studies and drug development 4. Many epigenetic regulators have only recently been discovered and are still in the process of being classified. Among these enzymes are lysine demethylases which remove methyl groups from lysines on histones and other proteins. Due to the novel nature of this class of enzymes, few assays have been developed to study their activity. This has been a road block to both the classification and high throughput study of histone demethylases. Currently, very few demethylase assays exist. Those that do exist tend to be qualitative in nature and cannot simultaneously discern between the different lysine methylation states (un-, mono-, di- and tri-). Mass spectrometry is commonly used to determine demethylase activity but current mass spectrometric assays do not address whether differentially methylated peptides ionize differently. Differential ionization of methylated peptides makes comparing methylation states difficult and certainly not quantitative (Figure 1A). Thus available assays are not optimized for the comprehensive analysis of demethylase activity.
Here we describe a method called MassSQUIRM (mass spectrometric quantitation using isotopic reductive methylation) that is based on reductive methylation of amine groups with deuterated formaldehyde to force all lysines to be di-methylated, thus making them essentially the same chemical species and therefore ionize the same (Figure 1B). The only chemical difference following the reductive methylation is hydrogen and deuterium, which does not affect MALDI ionization efficiencies. The MassSQUIRM assay is specific for demethylase reaction products with un-, mono- or di-methylated lysines. The assay is also applicable to lysine methyltransferases giving the same reaction products. Here, we use a combination of reductive methylation chemistry and MALDI mass spectrometry to measure the activity of LSD1, a lysine demethylase capable of removing di- and mono-methyl groups, on a synthetic peptide substrate 5. This assay is simple and easily amenable to any lab with access to a MALDI mass spectrometer in lab or through a proteomics facility. The assay has ~8-fold dynamic range and is readily scalable to plate format 5.

We present a method for using MALDI mass spectrometry and reductive methylation chemistry to quantify changes in lysine methylation.

Recently, epigenetic regulators have been discovered as key players in many different diseases 1-3. As a result, these enzymes are prime targets for small ...

Assembly of Nucleosomal Arrays from Recombinant Core Histones and Nucleosome Positioning DNA

Core histone octamers that are repetitively spaced along a DNA molecule are called nucleosomal arrays. Nucleosomal arrays are obtained in one of two ways: purification from in vivo sources, or reconstitution in vitro from recombinant core histones and tandemly repeated nucleosome positioning DNA. The latter method has the benefit of allowing for the assembly of a more compositionally uniform and precisely positioned nucleosomal array. Sedimentation velocity experiments in the analytical ultracentrifuge yield information about the size and shape of macromolecules by analyzing the rate at which they migrate through solution under centrifugal force. This technique, along with atomic force microscopy, can be used for quality control, ensuring that the majority of DNA templates are saturated with nucleosomes after reconstitution. Here we describe the protocols necessary to reconstitute milligram quantities of length and compositionally defined nucleosomal arrays suitable for biochemical and biophysical studies of chromatin structure and function.

A method is presented for the reconstitution of model nucleosomal arrays from recombinant core histones and tandemly repeated nucleosome positioning DNA. We also describe how sedimentation velocity experiments in the analytical ultracentrifuge, and atomic force microscopy (AFM) are used to monitor the extent of nucleosomal array saturation after reconstitution.

Core histone octamers that are repetitively spaced along a DNA molecule  are called nucleosomal arrays. Nucleosomal arrays are obtained in one of two  ...

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

The canonical set of amino acids leads to an exceptionally wide range of protein functionality. Nevertheless, the set of residues still imposes limitations on potential protein applications. The incorporation of noncanonical amino acids can enlarge this scope. There are two complementary approaches for the incorporation of noncanonical amino acids. For site-specific incorporation, in addition to the endogenous canonical translational machineries, an orthogonal aminoacyl-tRNA-synthetase-tRNA pair must be provided that does not interact with the canonical ones. Consequently, a codon that is not assigned to a canonical amino acid, usually a stop codon, is also required. This genetic code expansion enables the incorporation of a noncanonical amino acid at a single, given site within the protein. The here presented work describes residue-specific incorporation where the genetic code is reassigned within the endogenous translational system. The translation machinery accepts the noncanonical amino acid as a surrogate to incorporate it at canonically prescribed locations, i.e., all occurrences of a canonical amino acid in the protein are replaced by the noncanonical one. The incorporation of noncanonical amino acids can change the protein structure, causing considerably modified physical and chemical properties. Noncanonical amino acid analogs often act as cell growth inhibitors for expression hosts since they modify endogenous proteins, limiting in vivo protein production. In vivo incorporation of toxic noncanonical amino acids into proteins remains particularly challenging. Here, a cell-free approach for a complete replacement of L-arginine by the noncanonical amino acid L-canavanine is presented. It circumvents the inherent difficulties of in vivo expression. Additionally, a protocol to prepare target proteins for mass spectral analysis is included. It is shown that L-lysine can be replaced by L-hydroxy-lysine, albeit with lower efficiency. In principle, any noncanonical amino acid analog can be incorporated using the presented method as long as the endogenous in vitro translation system recognizes it.

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

An easy-to-use, cell-free expression protocol for the residue-specific incorporation of noncanonical amino acid analogs into proteins, including downstream analysis, is presented for medical, pharmaceutic, structural and functional studies.

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Summary

Explore More Videos

Chapters in this video

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Analysis of Histone Antibody Specificity with Peptide Microarrays

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

Detection of Post-translational Modifications on Native Intact Nucleosomes by ELISA

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Application of MassSQUIRM for Quantitative Measurements of Lysine Demethylase Activity

Assembly of Nucleosomal Arrays from Recombinant Core Histones and Nucleosome Positioning DNA

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System