ونود أن نشكر الدكتور ويسلي وانغ على إرساء الأساس لهذا البروتوكول وإرشاده القيم. وقد تم دعم هذا العمل جزئيا من قبل المعاهد الوطنية للصحة (المنح R01GM127575 وR01GM121584) ومؤسسة ويلش (منحة A-1715).

1. البناء البلازميد
<ol><li>تبدأ من خلال تحديد البروتين الهستون الذي سيتم أسيتيلاتيد وفي أي موقع ليسين. تحور الموقع إلى وقف الكهرمان كودون (TAG) باستخدام موقع موجهة mutagenesis. ملاحظة: هناك أربعة البلازميدات المصممة سابقا المستخدمة للتعبير عن بروتينات الهستون. تم استنساخ جميع بروتينات الهستون الأربعة في ناقلات pETDuet-1 مع علامة الهستيدين N-terminal. Histone H4 يتضمن أيضا علامة سومو، وأصل colE1 النسخ المتماثل مع عدد نسخة من حوالي 40، ومقاومة الأمبيسلين، ومروج T7.<ol>
<li>تصميم التمهيديات إلى الأمام وعكس التي تحتوي على طفرة TAG في الموقع المطلوب (استبدال كودون ليسين القائمة مع codon وقف العنبر) في واحدة من أربعة البلازميدات بروتين الهستون.</li>
		<li>استخدام PCR كامل البلازميد لتضخيم TAG التي تحتوي على البلازميد. تحديد درجة حرارة التلين المناسبة للمبرمجين. بشكل عام، فإن درجة حرارة ذوبان (Tm)من التمهيديات ناقص 5 درجة مئوية تكون كافية. إذا واجهت صعوبة في الحصول على منتج PCR ، يمكن استخدام تدرج درجة الحرارة حول Tm - 5 °C لتحسين درجة حرارة التلاحم للتضخيم. ملاحظة: في هذه التجربة تم استخدام بوليمرات PFU المعبر عنها داخليا لمدة 30 دورة مع الشروط التالية: 94 درجة مئوية لمدة 30 s (التشبع)، ودرجة حرارة التلين لمدة 30 s، و 72 درجة مئوية لمدة 6 دقائق (أو دقيقة واحدة لكل كيلوبيس-أزواج). لمزيد من التفاصيل حول هذا النوع من طريقة PCR انظر ليو ونايسميث7.</li>
		<li>تنظيف المنتج PCR مع مجموعة تنظيف PCR باتباع بروتوكول الشركة المصنعة. تحليل المنتج PCR بواسطة أجاروز هلام الكهربائي وتلطيخ بروميد الإيثيديوم اللاحقة.</li>
		<li>Ligate وplasmid عن طريق احتضان مع T4 ligase بين عشية وضحاها في 16 درجة مئوية.</li>
	</ol>
</li>
	<li>أولا تحويل TAG التي تحتوي على البلازميد (أمبيرR)إلى الإشريكية القولونيةالمختصة كيميائيا . اختيار ما لا يقل عن 4 مستعمرات من التحول وتنقية البلازميد. جعل مخزونات الخلايا من كل مع الجلسرين باستخدام أساليب قياسية وتخزينها في -80 درجة مئوية. أرسل للتسلسل لتأكيد طفرة TAG المطلوبة.</li>
	<li>بمجرد تأكيد التسلسل ، شارك في تحويل البلازميد المحتوي على TAG (AmpR)مع pEVOL-AckRS (ChlR)إلى CobB المختص كيميائيا (الهستون الوحيد ليسين deacetylase المعروف في E. coli.) حذف خلايا BL21 باستخدام طريقة الصدمة الحرارية. pEVOL هو plasmid مع منتصف عدد النسخ إلى انخفاض عدد نسخة p15A الأصل. ملاحظة: تم بناء سلسلة pEVOL من البلازميدات استنادا إلى الدراسات السابقة التي أظهرت زيادة التعبير عن الزوج aaRS متعامد / TRNATyr كانت فعالة في خفض اقتطاع البروتين وفي زيادة الغلة الإجمالية للبروتينات متحولة8. إذا لم يكن من السهل الوصول إلى خلايا حذف CobB ، فانتقل إلى خلايا BL21 المختصة كيميائيا. CobB هو سيرتوين مثل الهستون ليسين deacetylase ونيكوتيناميد يمكن أن تضاف في التركيز النهائي 5 MM خلال التعبير البروتين الهستون لمنع كوب كنهج بديل9.</li>
	<li>جعل مخزون الخلية وتخزينها في -80 درجة مئوية.</li>
</ol>2. أسيتيلاتيد الهستون البروتين التعبير
<ol><li>إعداد 1 لتر من الوسائط 2YT autoclaved (أو حجم الاختيار) في قارورة الثقافة.</li>
	<li>تلقيح 20 مل من وسائط 2YT التي تحتوي على المضادات الحيوية المناسبة مع مخزون الخلايا التي تم تحويلها المشتركة التي تحتوي على البلازميد المحتوي على TAG (أمبيرR)وpEVOL-AckRS (ChlR)وتنمو عند 37 درجة مئوية إلى OD = 0.6 (4-6 ساعة).</li>
	<li>إضافة المضادات الحيوية المناسبة إلى 1 لتر من وسائل الإعلام 2YT autoclaved والتطعيم مع ثقافة بداية 20 مل. تنمو عند 37 درجة مئوية إلى OD = 0.6-0.8 (2-3 ساعة).</li>
	<li>إضافة عوامل تحريضية والأستيتيل (AcK) إلى التركيزات النهائية من IPTG 1 mM, 0.2٪ أرابينوس, وAcK 5 mM.</li>
	<li>تنمو الثقافة في 37 درجة مئوية لمدة 6-8 ساعة.</li>
	<li>الكريات الخلايا في 2700 س ز لمدة 15 دقيقة.</li>
	<li>تخزين بيليه الخلية في -80 درجة مئوية بين عشية وضحاها.</li>
	<li>من هذه الخطوة فصاعدا إبقاء العينة على الجليد في جميع الأوقات. حل بيليه الخلية في 50 مل من العازلة تحلل الهستون لكل 1 لتر من الثقافة.</li>
	<li>Sonicate وفقا للدورة التالية: 1 ق على، 1 ق قبالة، المجموع في الوقت المحدد: 3 دقيقة في 60٪ السعة.</li>
	<li>بيليه إدراج الهيئات في 41600 × غرام لمدة 45 دقيقة.</li>
	<li>تجاهل الهيئات إدراج supernatant وإعادة الإنفاق في 30 مل من العازلة تحلل الهستون. بيليه إدراج يبشر في 41600 × ز لمدة 30 دقيقة.</li>
	<li>تجاهل الهيئات إدراج supernatant وإعادة الإنفاق في 30 مل من العازلة غسل بيليه. بيليه إدراج الهيئات في 41600 × غرام لمدة 30 دقيقة.</li>
	<li>تجاهل الهيئات فائقة التناسل وتذوب إدراج في 25 مل من 6 م جوانيدين هيدروكلوريد (GuHCl) العازلة. احتضان مع التحريض في 37 درجة مئوية لمدة 1 ساعة. ملاحظة: إذا لزم الأمر، يمكن احتضان هيئات الإدماج مع التحريض بين عشية وضحاها في 4 درجة مئوية.</li>
	<li>بيليه إدراج يبشر في 41600 × ز لمدة 45 دقيقة. احتضان supernatant مع 1 مل من راتنج ني-NTA متساوية مع 6 M GuHCl العازلة لمدة 2 ساعة.</li>
	<li>المضي قدما في تنقية Ni-NTA في ظل ظروف مشوهة. اغسل العمود ب 3 وحدات تخزين عمود من المخزن المؤقت لغسل العمود. Elute بروتين الهستون الأسيتي مع 10 مل من العازلة elution. ملاحظة: محاولة تركيز البروتين هنا هو خيار ولكن الهستونات الأسيتيlated لا يمكن التنبؤ بها جدا ويمكن أن تعجل بسهولة. لا ينصح بالتركيز على 2 مل في الحجم الإجمالي.</li>
	<li>dialyze على نطاق واسع بروتين الهستون أسيتيلاتيد ضد 5٪ حمض الخليك العازلة لإزالة الأملاح. Dialyze لمدة 3 ساعة في وقت واحد في 4 درجة مئوية، وتبادل لعازلة جديدة لا تقل عن 6 مرات. ملاحظة: لتحسين نقاء البروتين، هناك خيار ل dialyze ضد المياه النقية. ومع ذلك، وهذا يسبب هطول الأمطار كبيرة وانخفاض في الغلة التي قد تكون غير مرغوب فيها لبروتينات الهستون الأسيتيلاتيد منخفضة الغلة.</li>
	<li>الكوت والليوفليزي البروتين، وتخزينها إلى أجل غير مسمى في -80 درجة مئوية. البرية نوع البروتينات الهستون تسفر عموما 10-50 ملغ / لتر في حين أن بروتينات الهستون الأسيتيlated تسفر عن أقل من 10 ملغ / لتر اعتمادا على موقع اليسين محددة. على سبيل المثال، يبلغ متوسط H3K79Ac 5 ملغم/لتر.</li>
</ol>3. البرية نوع الهستون البروتين التعبير
<ol><li>لتجميع النوى الكاملة، والتعبير عن جميع البروتينات الهستون 4. عند التعبير عن وتنقية نوع البرية histones البروتوكول هو نفسه كما هيستونات أسيتيلاتيد باستثناء ما يلي:<ol>
<li>لا تقم بإجراء التحويل المشترك. لا تستخدم pEVOL-AcKRS للتعبير عن الهستون نوع البرية. ضبط المضادات الحيوية وفقا لذلك.</li>
		<li>لا تستخدم خط الخلية حذف كوب أو إضافة نيكوتيناميد، AcK، أو أرابينوس أثناء تحريض التعبير الخلوي.</li>
	</ol>
</li>
</ol>4. إعداد الحمض النووي 601
ملاحظة: تم تجميع تسلسل الحمض النووي الأمثل المصمم مسبقا لتحديد المواقع النيوكليوسوم المباشر مع ثمانيات الهستون لإنتاج مونونوكليوسوم بكفاءة عالية. ويشار إلى هذا التسلسل باسم 601 DNA أو تسلسل Widom. وقد أصبح هذا التسلسل تسلسل الحمض النووي القياسية للدراسات المختبرية من النيوكليوسومات من الكروماتين إعادة عرض المقايسات لقياس جزيء واحد10.
<ol><li>لإعداد كميات كبيرة من الحمض النووي 601 للتجميع النيوكليوسوم، تحويل pGEM-3z/601 إلى أعلى 10 خلايا وتنمو 10 مل من الثقافة لتضخيم البلازميد واستخراج. استخدام عدة استخراج البلازميد واتبع توصية الشركة المصنعة.</li>
	<li>استخدام البوليمرات PFU أعرب في المنزل (أكثر كفاءة) لهذا البروتوكول تضخيم. إعداد تفاعل PCR: لتفاعل 250 ميكرولتر، استخدام 207.5 ميكرولتر autoclaved MQH 2O، 25 ميكرولتر 10x PFU العازلة، 5 ميكرولتر التمهيدي إلى الأمام: ctggagaatcccgggccg، 5 ميكرولتر عكس التمهيدي: acaggatgtatatatctgacg، 5 ميكرولتر مزيج DNTP، 2.5 ميكرولتر إنزيم PFU. نحن عادة تشغيل 60 ردود الفعل في وقت واحد للحصول على ما يكفي من الحمض النووي لتجميع.</li>
	<li>استخدام درجة حرارة التلين من 52 درجة مئوية لمدة 30 ق وفترة تمديد 30 ق إذا باستخدام البوليميراز PFU. وإلا اتبع الشروط الموصى بها من قبل الشركات المصنعة.</li>
	<li>وبمجرد الانتهاء من PCR، استخدم مجموعة تنظيف PCR من الاختيار لتنقية المنتج PCR.</li>
</ol>5. جمعية اوكتامر الهستون
<ol><li>حل aliquots من الكريات البروتين الهستون H2A، H2B، H3، وH4 بحيث يكون هناك مخزون منفصل من كل بروتين الهستون في مخزن GuHCl مع حجم إجمالي قدره 100 ميكرولتر.</li>
	<li>حساب تركيز كل بروتين الهستون عن طريق قياس امتصاصA 280.</li>
	<li>إذا كان الامتصاص أكبر من 1 لأي بروتين، تخفيف مع العازلة GuHCl للحصول على تركيز أكثر دقة.</li>
	<li>الجمع بين H2A و H2B البروتينات في نسبة الضرس 1:1 وتمييع إلى تركيز البروتين الكلي من 4 ميكروغرام / ميكرولتر. كرر لH3 و H4.</li>
	<li>Dialyze بالتسلسل عند 4 درجة مئوية مقابل 2 M TE العازلة بين عشية وضحاها، 1 M TE العازلة لمدة 2 ساعة و 0.5 M TE العازلة لمدة 5 ساعة. ملاحظة: الخطوات الثانية والثالثة من غسيل الكلى يسبب تشكيلات غير مستقرة من البروتين لتسريع بها. ومن المتوقع أن تشهد هطول الأمطار الغزيرة في هذه الخطوات.</li>
	<li>إزالة الترسبات عن طريق الطرد المركزي عند 16,800 × ز عند 4 °C.</li>
	<li>مرة أخرى، حساب تركيز ديمرات الهستون (خليط H2A/H2B) و tetramers (خليط H3/H4) قياس امتصاص A280.</li>
	<li>مزيج dimers و tetramers في نسبة 1:1 الضرس وضبط NaCl إلى 2 M بإضافة NaCl الصلبة.</li>
	<li>يمكن تخزين ثماني الهستون عند 4 درجة مئوية وهو أكثر استقرارا من الدامرات والتترامرات. أبدا تجميد ثماني الهستون لأن هذا يمكن أن يسبب تفكيك.</li>
	<li>إذا تجميع مع الهستونات الأسيتيlated، ببساطة استبدال البروتين نوع البرية مع البروتين الأسيتيلاتيد في الإجراء.</li>
</ol>6. التجمع النوى
<ol><li>استخدم 100x TE العازلة وNaCl الصلبة لضبط 601 الحمض النووي إلى 2M TE العازلة. أضف الحمض النووي 601 في 2M TE العازلة إلى ثماني الهستون في نسبة الضرس من 0.85:1 إلى 0.90:1. يمكن إضافة نسبة أقل من الحمض النووي إذا كان الحمض النووي المجاني موجودا في تحليل تحول الجل.</li>
	<li>نقل خليط الحمض النووي-الهستون كيس غسيل الكلى ومكان في حوالي 200 مل من العازلة TE 2M (أو أكثر إذا تجميع عينات متعددة) ويحرك بلطف جدا في 4 درجة مئوية.</li>
	<li>تعيين مضخة التجذم لتطهير بالتنقيط ببطء في أي عازلة TE الملح. عندما يتضاعف حجم تقريبا، صب من نصف حجم. القيام بذلك على الأقل 4 مرات في المجموع. مع مضخة هذا يمكن أن يستغرق 4-8 ساعة اعتمادا على حجم البداية. تتشكل النيوكليوسومات عندما ينخفض تركيز الملح إلى 150 مليون متر (يقاس بمقياس الملوحة).</li>
	<li>بعد تقليل تركيز الملح إلى 150 mM، dialyze ضد 20 متر TE العازلة بين عشية وضحاها.</li>
	<li>إزالة الرواسب عن طريق الطرد المركزي وقياس تركيز النوى من قبل قراءةA 260 باستخدام قارئ لوحة.</li>
	<li>إضافة له-TEV protease (TEV: نوى 1:30, ث:ث) واحتضان بين عشية وضحاها في 4 °C لإزالة جميع العلامات الهستيدين. إزالة الشوائب العلامة الهستيدين من الحل النيوكليوسوم بواسطة راتنج ني-NTA سحب إلى أسفل.</li>
	<li>لوضع النوى وتجانس العينة، واحتضان في 60 درجة مئوية لمدة 1 ساعة. ملاحظة: بالنسبة للمواقع التي تم تحديدها بشكل خاص غير مستقرة، قد لا تكون هذه الخطوة مستحسنة.</li>
	<li>تخزين النوى على المدى القصير (بضعة أسابيع) في 4 °C.</li>
	<li>للتخزين على المدى الطويل، النوى dialyze ضد المخزن المؤقت وتخزينها في -80 درجة مئوية.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

ولا توجد مصالح مالية متنافسة يعلن عنها أي من أصحاب البلاغ.

من الضروري اتباع هذا البروتوكول بكل التفاصيل أثناء التجربة. النوى ليست مستقرة جدا والكثير من التجربة والخطأ قد ذهب إلى تحديد هذا البروتوكول. من المهم إزالة الرواسب في كل خطوة (أو كلما لوحظ) لأن الجسيمات يمكن أن تتداخل بسهولة مع عمليات التجميع. دائما احتفظ بعينات الهستون على الثلج إذا تم تخ?...

لقد استخدمنا PylRS و TRNAPyl لتجميع وتجميع mononucleosomes المعاد تشكيلها مع الهستونات الأسيتيlated الموقع محددة. وقد ثبت PylRS لا تقدر بثمن كأداة لتوسيع الشفرة الوراثية لإنتاج البروتينات مع تعديلات ما بعد التحويل (PTMs) وتطورت وراثيا لدمج حوالي 200 ncAAs مختلفة. PylRS يدمج في وقف الكهرمان codon، وإزالة المنافسة من الأحماض الأمينية الأخرى أثناء الترجمة. تم اكتشاف PylRS لأول مرة في archaea الميثانوجينية ، ومنذ ذلك الحين تم استخدامه في البيولوجيا الكيميائية لدمج مجموعات كيميائية تفاعلية جديدة في البروتينات1،2.
تم تطوير MmAcKRS1 من ميتانوساركينا مازي PylRS وكثيرا ما تستخدم في مختبرنا لتركيب البروتينات الأسيتيلاتيد3،4،5،6. MmAcKRS1 يسلم AcK في موقع طفرة العنبر في مرنا من اختيار أثناء الترجمة في الإشريكية القولونية. وقد استخدمت هذه التقنية سابقا لدمج ACK في K4، K9، K14، K18، K23، K27، K36، K56، K64، و K79 هيستون H3 مواقع ليسين لدراسة نشاط سيرتوين 1، 2، 6، و 7 على mononucleosomes أسيتيلاتيد4،5،6. هنا نحن بالتفصيل هذه الطريقة للتعبير عن الهستونات أسيتيلاتيد وإعادة تشكيل النيوكليوسومات الأسيتيlated.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

يمكن التعبير بسهولة عن بروتينات الهستون الأسيتية في الإشريكية القولونية ترميز متحولة، Nε-أسيتيل ليسين (AcK) محددة ميتانوساركينا مازي بيروليسين tRNA-synthetase (MmAcKRS1) ورنا cognate (tRNAPyl)لتجميع الرتابات المعاد تشكيلها مع الهستونات المحددة الموقع. MmAcKRS1 و TRNAPyl تسليم ACK في موقع طفرة العنبر في مرنا من اختيار أثناء الترجمة في الإشريكية القولونية. وقد استخدمت هذه التقنية على نطاق واسع لدمج AcK في مواقع ال ليسين H3. يمكن أيضا أن تتطور بسهولة بيروليسيل-TRNA synthetase (PylRS) لدمج الأحماض الأمينية غير الكانانية الأخرى (ncAAs) لتعديل البروتين محددة الموقع أو وظيفية. هنا نحن بالتفصيل طريقة لدمج AcK باستخدام نظام MmAcKRS1 في H3 الهستون ودمج البروتينات H3 أسيتيلاتيد في mononucleosomes المعاد تشكيلها. يمكن استخدام أحاديات النوكليوسومات المعاد تشكيلها في المقايسات الكيميائية الحيوية والملزمة ، وتحديد الهيكل ، وأكثر من ذلك. يعد الحصول على النويدات أحادية النواة المعدلة أمرا حاسما لتصميم التجارب المتعلقة باكتشاف تفاعلات جديدة وفهم علم الوراثة اللاجينية.

يمكن تقييم الديمرات والتترامر والأوكتامات عن طريق تشغيل هلام صفحة SDS بنسبة 12٪ (الشكل 1 والشكل 2). هنا يمكنك أن ترى أن بعض tetramers أسيتيلاتيد لديها عائد أقل من غيرها(الشكل 1). في الواقع، كلما اقتربنا من المنطقة الأساسية، انخفض ال?...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

هنا نقدم طريقة للتعبير عن بروتينات الهستون الأسيتية باستخدام توسيع الشفرة الوراثية وتجميع النيوكليوسومات المعاد تشكيلها في المختبر.

موقع محدد ليسين أسيتيل الهستونات لإعادة تشكيل النوكليوسوم باستخدام توسيع الشفرة الوراثية في الإشريكية القولونية

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Universidad San Sebastian

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. هنا نقدم طريقة للتعبير عن بروتينات الهستون الأسيتية باستخدام توسيع الشفرة الوراثية وتجميع النيوكليوسومات المعاد تشكيلها في المختبر.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

توجه التغليف البروتين داخل الخارجي غشاء الحويصلات من<em&gt; كولاي</em&gt;: تصميم وإنتاج وتنقية

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

الكشف عن تعتمد على درجة الحموضة آخر من<em&gt; كولاي</em&gt; الوصيفة HdeB<em&gt; في المختبر</em&gt; و<em&gt; في فيفو</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

كفاءة والخاصة بالموقع الأجسام المضادة وصفها من قبل Cycloaddition-أزيد آلكاين-روجت سلالة

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

إعادة تشكيل جسيم نووي مع الهستونات الأخت المسمى النظائر-تفاضلي

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

التحديد الكمي للوفرة وفرض مستويات نقل الكشف في الإشريكيّة القولونية

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Purification and Reconstitution of TRPV1 for Spectroscopic Analysis

Polymodal ion channels transduce multiple stimuli of different natures into allosteric changes; these dynamic conformations are challenging to determine and remain largely unknown. With recent advances in single-particle cryo-electron microscopy (cryo-EM) shedding light on the structural features of agonist binding sites and the activation mechanism of several ion channels, the stage is set for an in-depth dynamic analysis of their gating mechanisms using spectroscopic approaches. Spectroscopic techniques such as electron paramagnetic resonance (EPR) and double electron-electron resonance (DEER) have been mainly restricted to the study of prokaryotic ion channels that can be purified in large quantities. The requirement for large amounts of functional and stable membrane proteins has hampered the study of mammalian ion channels using these approaches. EPR and DEER offer many advantages, including determination of the structure and dynamic changes of mobile protein regions, albeit at low resolution, that might be difficult to obtain by X-ray crystallography or cryo-EM, and monitoring reversible gating transition (i.e., closed, open, sensitized, and desensitized). Here, we provide protocols for obtaining milligrams of functional detergent-solubilized transient receptor potential cation channel subfamily V member 1 (TRPV1) that can be labeled for EPR and DEER spectroscopy.

This article describes specific methods to obtain biochemical quantities of detergent-solubilized TRPV1 for spectroscopic analysis. The combined protocols provide biochemical and biophysical tools that can be adapted to facilitate structural and functional studies for mammalian ion channels in a membrane-controlled environment.

تنقية وإعادة تشكيل TRPV1 لتحليل سبيكتروسكوبيك

Polymodal ion channels transduce multiple stimuli of different natures into allosteric changes; these dynamic conformations are challenging to determine ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

الإنتاج الواسع النطاق للكشف المؤتلف في سقالة دائرية باستخدام نظام المستمدة من فرويد في الإشريكيّة القولونية

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

الطفرات موقع الموجه لفي المختبر وفي فيفو التجارب المتمثلة بالتفاعلات الحمض النووي الريبي في الإشريكيّة القولونية

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

في كل مكان في المختبر واختبارات الديوبيكيتيمنت النيوكليوسوم

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.